ID: 929118524

View in Genome Browser
Species Human (GRCh38)
Location 2:38465046-38465068
Sequence CATGTAAATAGATGCCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929118515_929118524 5 Left 929118515 2:38465018-38465040 CCCCTCTCCTTCTCCCATGTAAA No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118519_929118524 -8 Left 929118519 2:38465031-38465053 CCCATGTAAATGCCCCATGTAAA No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118517_929118524 3 Left 929118517 2:38465020-38465042 CCTCTCCTTCTCCCATGTAAATG No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118520_929118524 -9 Left 929118520 2:38465032-38465054 CCATGTAAATGCCCCATGTAAAT No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118516_929118524 4 Left 929118516 2:38465019-38465041 CCCTCTCCTTCTCCCATGTAAAT No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118512_929118524 27 Left 929118512 2:38464996-38465018 CCTCTCTTCCTATGTTGTCTTCC No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118518_929118524 -2 Left 929118518 2:38465025-38465047 CCTTCTCCCATGTAAATGCCCCA No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118514_929118524 6 Left 929118514 2:38465017-38465039 CCCCCTCTCCTTCTCCCATGTAA No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data
929118513_929118524 19 Left 929118513 2:38465004-38465026 CCTATGTTGTCTTCCCCCTCTCC No data
Right 929118524 2:38465046-38465068 CATGTAAATAGATGCCTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929118524 Original CRISPR CATGTAAATAGATGCCTGTA TGG Intergenic
No off target data available for this crispr