ID: 929118871

View in Genome Browser
Species Human (GRCh38)
Location 2:38467438-38467460
Sequence CACAGCGGTCCCAGAGCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929118862_929118871 22 Left 929118862 2:38467393-38467415 CCCCTGAGGATTGTGGTGCAGGA No data
Right 929118871 2:38467438-38467460 CACAGCGGTCCCAGAGCCATAGG No data
929118858_929118871 30 Left 929118858 2:38467385-38467407 CCAGCCAACCCCTGAGGATTGTG No data
Right 929118871 2:38467438-38467460 CACAGCGGTCCCAGAGCCATAGG No data
929118863_929118871 21 Left 929118863 2:38467394-38467416 CCCTGAGGATTGTGGTGCAGGAA No data
Right 929118871 2:38467438-38467460 CACAGCGGTCCCAGAGCCATAGG No data
929118864_929118871 20 Left 929118864 2:38467395-38467417 CCTGAGGATTGTGGTGCAGGAAG No data
Right 929118871 2:38467438-38467460 CACAGCGGTCCCAGAGCCATAGG No data
929118860_929118871 26 Left 929118860 2:38467389-38467411 CCAACCCCTGAGGATTGTGGTGC No data
Right 929118871 2:38467438-38467460 CACAGCGGTCCCAGAGCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929118871 Original CRISPR CACAGCGGTCCCAGAGCCAT AGG Intergenic
No off target data available for this crispr