ID: 929133459

View in Genome Browser
Species Human (GRCh38)
Location 2:38601963-38601985
Sequence GGGTCTCCATAGGACCGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929133452_929133459 30 Left 929133452 2:38601910-38601932 CCTTCAAGGGAACTAGCATGTGA 0: 1
1: 0
2: 0
3: 9
4: 106
Right 929133459 2:38601963-38601985 GGGTCTCCATAGGACCGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 88
929133454_929133459 4 Left 929133454 2:38601936-38601958 CCAAGGCATAATCTGTTATTTAA 0: 1
1: 0
2: 0
3: 17
4: 261
Right 929133459 2:38601963-38601985 GGGTCTCCATAGGACCGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929133459 Original CRISPR GGGTCTCCATAGGACCGAGG CGG Intronic
900618289 1:3575365-3575387 GGGTCTGCAAAGGAGCGAGGGGG - Intronic
902406624 1:16187653-16187675 GGGACATCATAGGACCAAGGGGG + Intergenic
902820151 1:18938700-18938722 GGGTCTCCCTAGGTGTGAGGTGG - Intronic
906143152 1:43545584-43545606 GTGTGTCCATAGGCCCAAGGAGG + Intronic
906914083 1:49989371-49989393 GGGTCTAGATAGGAACAAGGAGG + Intronic
915346727 1:155201316-155201338 GGGTCTTCATAGGAGAGAGGTGG - Intronic
916518809 1:165544809-165544831 GGGTCTCCAGAGTAGTGAGGTGG - Exonic
918184553 1:182115407-182115429 GGGTCTCTCTAGGACTGGGGAGG - Intergenic
1064019285 10:11796349-11796371 GAGCCTCCAGGGGACCGAGGTGG - Intergenic
1067089564 10:43259736-43259758 GGGGCTCAATAGGCCAGAGGAGG + Intronic
1067524865 10:47032164-47032186 GGGTCTGCGCAGCACCGAGGAGG - Intergenic
1070598708 10:77850867-77850889 GGGCTTCCCTTGGACCGAGGTGG + Intronic
1074407520 10:113191991-113192013 TTGTCTCCATAGGACACAGGAGG - Intergenic
1081583409 11:44367660-44367682 TTGTCTCCATATGACGGAGGAGG + Intergenic
1088648576 11:111937637-111937659 GGGTCCCCAAAGGATGGAGGAGG - Intronic
1091446573 12:547045-547067 GTGTCCCCAGACGACCGAGGGGG - Intronic
1093576585 12:20737804-20737826 GGGTTTCCATAGGGCAGAAGAGG + Intronic
1095940070 12:47720895-47720917 GGGTCTCCATAGAGCTGAGTTGG - Intronic
1101674280 12:106903517-106903539 GGGTCTCCAGGGGTCCGGGGCGG - Intergenic
1103418402 12:120760250-120760272 GGGTGTCCACAGGACAGAGACGG - Intergenic
1107633094 13:42362553-42362575 GGGTCTCCAAGAGACTGAGGAGG + Intergenic
1122540654 14:102496110-102496132 CGGCCTCCATGGGACCGAGTGGG - Intronic
1124902051 15:33833037-33833059 GAGTCTCCATAGGACCACGTAGG + Intronic
1128114144 15:65094844-65094866 GGGTGTTCATAGAACCTAGGTGG + Intronic
1128995639 15:72292436-72292458 GGGCCTCCATAGTCCCAAGGGGG + Intronic
1130622788 15:85480980-85481002 GTGTCTCCTTAGGACAGACGCGG - Intronic
1136088814 16:27903811-27903833 GTGTCTTCATAGGACCTTGGTGG - Intronic
1136723060 16:32339380-32339402 GGGTCTGGGTAGGACCAAGGAGG + Intergenic
1136841381 16:33545379-33545401 GGGTCTGGGTAGGACCAAGGAGG + Intergenic
1136922833 16:34346013-34346035 GGTTCTCCAGAGGAAGGAGGAGG - Intergenic
1136981740 16:35065793-35065815 GGTTCTCCAGAGGAAGGAGGAGG + Intergenic
1203003371 16_KI270728v1_random:178384-178406 GGGTCTGGGTAGGACCAAGGAGG - Intergenic
1203134979 16_KI270728v1_random:1714791-1714813 GGGTCTGGGTAGGACCAAGGAGG - Intergenic
1203151546 16_KI270728v1_random:1845676-1845698 GGGTCTGGGTAGGACCAAGGAGG + Intergenic
1146445958 17:32933186-32933208 GGGTCTCCATGGCACCAATGAGG - Exonic
1151969205 17:77449298-77449320 GGGTCTCCAGAGCACAGAGAAGG - Intronic
1152008321 17:77695981-77696003 GGGTCTCCAGGGCACAGAGGAGG + Intergenic
1152148582 17:78584536-78584558 GGGTATCCATAGGCCTGGGGAGG - Intergenic
1156878201 18:42042269-42042291 GTGTCTTCATAGGACAGAGAGGG + Intronic
1158565053 18:58547743-58547765 GGATATCCATAGGCCCAAGGGGG - Intronic
1162044412 19:7988993-7989015 GGGTGGTCAGAGGACCGAGGAGG + Intronic
1163195978 19:15720485-15720507 AGGTCTCCAGAGCTCCGAGGTGG + Intergenic
1165055991 19:33176671-33176693 GGGTCACAGTCGGACCGAGGCGG + Intergenic
1166366847 19:42282128-42282150 GGGGCTGCATAGGAAGGAGGGGG + Intronic
1167134650 19:47609458-47609480 GGGTCCCCATAGGATCGGGGCGG - Intronic
1167648540 19:50718286-50718308 GGGTCTCCGCAGGGACGAGGTGG - Intronic
1167717638 19:51154193-51154215 GGGTCTCCATAGGGCCTGTGAGG - Intergenic
1168290399 19:55354560-55354582 GGGACTCCGTGGGGCCGAGGGGG + Intronic
926409126 2:12583384-12583406 GGGTCTCCACAGGACGGTGAGGG + Intergenic
929133459 2:38601963-38601985 GGGTCTCCATAGGACCGAGGCGG + Intronic
933616637 2:84488631-84488653 GGGTCTACATAAGAGGGAGGAGG - Intergenic
934538837 2:95158748-95158770 GGGTCTCTAGATGACCGTGGCGG - Intronic
948217628 2:236243557-236243579 GAGGCTCCATAGGACAGATGCGG + Intronic
1170799482 20:19579178-19579200 GGGTCTCCTTAGGAAAGAGTGGG + Intronic
1173385610 20:42584552-42584574 GGCTCTCCAGAGGGCTGAGGTGG - Intronic
1175635669 20:60580622-60580644 GGGTCTCCACGGGTCCCAGGAGG - Intergenic
1177264200 21:18762964-18762986 GGGTCCCTTTAGGACCCAGGCGG + Intergenic
1178582957 21:33851264-33851286 GGGTCTCCATATGGCTGGGGAGG - Intronic
1181560060 22:23694793-23694815 GGGGCTCCAGAGGACCAGGGTGG - Intronic
1184089637 22:42285409-42285431 GGGGGTCCCAAGGACCGAGGCGG - Intronic
954995022 3:54873263-54873285 GGGTCCCCTGAGGACTGAGGAGG - Intronic
960256055 3:115512663-115512685 GGGTCTCCATAGAAACCAGGAGG - Intergenic
966194621 3:177300644-177300666 TGGTCTACATAGTACCGAGAAGG + Intergenic
967768789 3:193311629-193311651 GGGTCTGCCTGGGACCGAGAAGG + Intronic
967841171 3:194005817-194005839 GTATCTCCATAGGAGCGTGGGGG - Intergenic
968129851 3:196186708-196186730 GTCTCTCCCAAGGACCGAGGGGG - Intergenic
969150343 4:5163966-5163988 GGGTCTCCATGGGACAGAGTGGG - Intronic
971239071 4:24871210-24871232 GGGTAACCATAGGACTGAGTTGG + Intronic
971800668 4:31285950-31285972 GGGTGTCCATTGGACCCAGATGG - Intergenic
973855936 4:55009785-55009807 GAGTGTCCATAGGAATGAGGAGG - Intergenic
980102080 4:128551846-128551868 GGGTCTACATAGGGACCAGGAGG - Intergenic
980689846 4:136281273-136281295 GGGTCTCCAAAGCACAGAGCGGG + Intergenic
999448734 5:151662806-151662828 GGTTCTCCAAAAGACAGAGGAGG + Exonic
1006153391 6:32001255-32001277 GGGGCTCCCTGGGACTGAGGAGG + Intronic
1006159699 6:32033992-32034014 GGGGCTCCCTGGGACTGAGGAGG + Intronic
1006406918 6:33850851-33850873 GGGTCTCCAGAGGTCCTGGGAGG - Intergenic
1007512165 6:42381879-42381901 GGGTTTCCACAGGACTGAAGAGG + Intronic
1014428269 6:121335177-121335199 GGGTCTCCACAGCACCGACTTGG - Intergenic
1015718222 6:136213772-136213794 GGCTCTCCATAGGACAGGGCAGG + Intergenic
1015812832 6:137178214-137178236 GAGTCTCCATAGGTCCCAGGAGG + Intergenic
1019337893 7:493924-493946 GGGTCCCCAGAGCGCCGAGGCGG - Intergenic
1020256738 7:6506628-6506650 AGGTCTCCAGGGGACCCAGGAGG + Intronic
1024337830 7:48227264-48227286 GGATCTCAATAAGACCGAGGAGG + Exonic
1025004701 7:55344770-55344792 GGGTATCCACAGCACGGAGGTGG + Intergenic
1044748482 8:95394265-95394287 GGCTCTACATAGGACCGTGGAGG - Intergenic
1044781785 8:95751017-95751039 GAGTCTCCATAGCACAGTGGTGG + Intergenic
1047941956 8:129835271-129835293 ATGTCTCCACAGGACAGAGGAGG - Intergenic
1049536658 8:143185772-143185794 GGGTCTCCTGAGCACCGAGTGGG - Intergenic
1049777206 8:144412253-144412275 GGGTCTCCATATCAAAGAGGGGG + Intronic
1051266581 9:15315145-15315167 AGGTCTCCTCAGGACAGAGGCGG - Intergenic
1052864666 9:33457681-33457703 GGGTCTCCCCAGGACTGAAGAGG - Intergenic
1056446203 9:86668232-86668254 GGGTCTCCATTGGAAGGTGGAGG + Intergenic
1061753974 9:132799931-132799953 GGATCCCAATAGGACCCAGGAGG + Intronic
1062280968 9:135751449-135751471 GGGACTCCTTGGGACCCAGGAGG - Intronic
1185633675 X:1535981-1536003 GGGTCTCCCTGGCACCGAGGGGG + Intronic
1197939921 X:131778822-131778844 AGGTCTCAATTGGGCCGAGGTGG + Intergenic
1199380658 X:147168492-147168514 GGCTCTCCACAGGACGGATGGGG - Intergenic
1199382031 X:147182361-147182383 GGGTCTCCAAAGGACTGTGCAGG + Intergenic