ID: 929139698

View in Genome Browser
Species Human (GRCh38)
Location 2:38656085-38656107
Sequence GGGGGTGTCAGATACACTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929139698_929139706 26 Left 929139698 2:38656085-38656107 CCTGAAGTGTATCTGACACCCCC No data
Right 929139706 2:38656134-38656156 CCAGTACACACCCAAGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929139698 Original CRISPR GGGGGTGTCAGATACACTTC AGG (reversed) Intergenic
No off target data available for this crispr