ID: 929140940

View in Genome Browser
Species Human (GRCh38)
Location 2:38666157-38666179
Sequence TCCCTATGGCTTCGGTGACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929140940 Original CRISPR TCCCTATGGCTTCGGTGACC AGG Exonic
902382920 1:16061068-16061090 ACATTATGGCTTCGGGGACCCGG - Intronic
906588219 1:46999845-46999867 TCCCTATCTCTTTGGTGACAAGG + Intergenic
915458496 1:156055320-156055342 TGGCTATGGCAGCGGTGACCCGG - Exonic
916204700 1:162304696-162304718 TCCCTGTGTTTTCGGTGTCCTGG + Intronic
919759416 1:201087911-201087933 TCCCGATGGCATCATTGACCTGG + Exonic
922628217 1:227075266-227075288 TCCTCATAGCTTCAGTGACCTGG - Intronic
1064250301 10:13701463-13701485 TCCCCAGGGCTTCAGTGACAAGG - Exonic
1065516250 10:26527174-26527196 TACCCATGACTTCGGTGCCCTGG + Intronic
1071615964 10:87076955-87076977 TACCTTTGGTTTGGGTGACCTGG + Intronic
1074347924 10:112706281-112706303 TCCCTATGGCTATGATGACTGGG - Intronic
1075599780 10:123758956-123758978 TGCCTCTGCCTTCAGTGACCAGG - Intronic
1077046716 11:549947-549969 TCGCTGTGGCCTCGCTGACCTGG + Exonic
1082263684 11:50097255-50097277 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1086065988 11:82745373-82745395 CCCCTGTGTCTTCTGTGACCTGG - Intergenic
1086154550 11:83651268-83651290 TACCTATTGCTGGGGTGACCAGG + Intronic
1087175334 11:95090330-95090352 TCCCTACGCCTTCGGTGCCTTGG + Intronic
1090351358 11:126110527-126110549 TCCCTGAGGCTGGGGTGACCTGG + Intergenic
1091128813 11:133126801-133126823 TCCCTATGGCTTCGAATCCCAGG - Intronic
1091141205 11:133236426-133236448 TCTCCATGGCTTCTGTGACTTGG - Intronic
1091841205 12:3622170-3622192 CCCCTAGGGCTTTGGTGAACAGG + Intronic
1102101520 12:110281774-110281796 TCTCCATGGCTTCGGGGGCCCGG - Exonic
1104127371 12:125861253-125861275 ACCCTAGGGATTCGCTGACCCGG - Intergenic
1107809428 13:44186053-44186075 TTCCTAGGGCTTCTGTGACAAGG + Intergenic
1112207390 13:97338158-97338180 GACCTATGGCTTCTGTGATCTGG + Intronic
1122389741 14:101372111-101372133 TCACTGTGTCTTCAGTGACCAGG - Intergenic
1122398796 14:101454839-101454861 GGCCTGTGGCTTCGGTGAACGGG + Intergenic
1125695929 15:41637287-41637309 TGCCTTTGTCTTTGGTGACCTGG + Intronic
1126453439 15:48835220-48835242 TGCCTTTGGCTTCTGTTACCAGG + Intronic
1138317060 16:56079173-56079195 TACCTATGGTTTTGGTGACAAGG - Intergenic
1138654087 16:58480606-58480628 TTCCTATGGCTTCTGTGGACAGG + Intronic
1139165336 16:64558806-64558828 TACCTATAGCTTCTGTGAGCTGG + Intergenic
1140023110 16:71258435-71258457 TCCCTATTGCTTTGTTTACCAGG - Intergenic
1140757975 16:78085832-78085854 TCTCTATGTCTTCTGTAACCTGG - Intergenic
1141039934 16:80664404-80664426 TCCCCAGGGCTCCGGTGTCCTGG + Intronic
1141804985 16:86336447-86336469 TCCCTGTGGCTTGGGGGCCCAGG - Intergenic
1147157770 17:38552848-38552870 TCTCTGTGGCTGCAGTGACCTGG - Exonic
1149461069 17:56830877-56830899 TCCCTATGTCTTCGTTGCCCAGG - Intronic
1153065474 18:1039922-1039944 GCCCTTTGTCTTCAGTGACCAGG - Intergenic
1162059735 19:8087252-8087274 ACCCTATGGCTGTGGGGACCTGG + Intronic
1163054216 19:14706186-14706208 TCCCTCTGGCCTCTGTGTCCAGG - Intronic
1164072511 19:21781194-21781216 TCCCTATGGATTCACTGAGCGGG - Intergenic
1166185502 19:41136392-41136414 CCGCTATGGCTACGGGGACCCGG + Intergenic
1167538112 19:50068354-50068376 TCCCTCTGTCTTAGGTGCCCAGG + Intergenic
926101793 2:10122659-10122681 TCCCATTGGCTTTGGTGCCCCGG - Exonic
929140940 2:38666157-38666179 TCCCTATGGCTTCGGTGACCAGG + Exonic
929865173 2:45711386-45711408 TACCTATGACCTGGGTGACCTGG + Intronic
930701155 2:54457949-54457971 TCCCTATGGCTCAGGTCCCCTGG - Intronic
936554286 2:113479894-113479916 TCCCTATAGCCTCTGTGTCCTGG + Intronic
938124478 2:128662105-128662127 TGCCTTGGGATTCGGTGACCTGG - Intergenic
946871145 2:224086871-224086893 TTCATATGGCTTCAGGGACCAGG + Intergenic
1178059401 21:28835061-28835083 GCCCTTTGTCTTCCGTGACCAGG - Intergenic
1184817802 22:46885241-46885263 TCCCCAGGTCTTCGGTGACTTGG + Intronic
954425682 3:50441839-50441861 TCCTGATGGCTTCTGTGAACAGG + Intronic
969624815 4:8297077-8297099 ACCTTATGGCTTCTGAGACCAGG - Intronic
971497605 4:27283898-27283920 CCCCTCTGGCTGCAGTGACCAGG + Intergenic
978938878 4:114413872-114413894 TCTATATGGCTTCTGTGGCCTGG + Intergenic
979704875 4:123709421-123709443 GCCCTTTGTCTTCAGTGACCAGG - Intergenic
984581118 4:181511289-181511311 TGCCTATGGCTGCTGTGACAAGG - Intergenic
988609817 5:32713373-32713395 TGGCTATGGCTTCGGGGAGCGGG + Intronic
998295944 5:140968572-140968594 TAGCTATGACTTTGGTGACCAGG - Exonic
1003110452 6:3248506-3248528 TCCCACTGGCTTTGGTGACATGG + Intronic
1006189457 6:32198712-32198734 TGCCTTTGGCTTCAGTGCCCTGG + Exonic
1010266173 6:73870871-73870893 TCCCTATGGCTACACAGACCAGG - Intergenic
1015265996 6:131293119-131293141 TCCCTATGTCTTCAGAGACAAGG + Intergenic
1018413936 6:163584842-163584864 TCCCTATGGATTATATGACCTGG + Intergenic
1018704283 6:166451014-166451036 TCCCTGTGGCCTCAGTCACCCGG - Intronic
1020070482 7:5223815-5223837 TCCCTCTGGCTTGGGTGCCAGGG - Intronic
1023665807 7:42522219-42522241 CCCCTCTGGCTTTGGTGACTTGG + Intergenic
1025980341 7:66400076-66400098 TTCCTCTGGCTTCAGTGAACAGG + Intronic
1027205225 7:76092448-76092470 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1035205154 7:157290131-157290153 TCCCCAGGGCTTTGGTGCCCAGG + Intergenic
1035715416 8:1750581-1750603 TCCCTATGGCTTCGTTTAACTGG + Intergenic
1036223042 8:6936893-6936915 TCCTCATGGCTGGGGTGACCTGG + Exonic
1036225145 8:6951593-6951615 TCCTTATGGCTGGGGTCACCTGG + Intergenic
1036229575 8:6988268-6988290 TCCTCATGGCTGGGGTGACCTGG + Intergenic
1036232026 8:7007371-7007393 TCCTCATGGCTGGGGTGACCTGG + Intronic
1041865365 8:62567173-62567195 ACCCTATTACTTAGGTGACCAGG - Intronic
1049898721 9:137284-137306 TCCCTATAGCCTCTGTGTCCTGG - Intronic
1050244857 9:3678068-3678090 TCCCCATGGCTAAGGTGGCCTGG - Intergenic
1053741771 9:41147596-41147618 TCCCTATAGCCTCTGTGTCCTGG - Intronic
1054444765 9:65303743-65303765 TCCCTATAGCCTCTGTGTCCTGG - Intergenic
1054485506 9:65717760-65717782 TCCCTATAGCCTCTGTGTCCTGG + Intronic
1054686570 9:68283704-68283726 TCCCTATAGCCTCTGTGTCCTGG + Intronic
1057221039 9:93257915-93257937 TCCCGAGGGCTTCGGTGACCCGG + Intronic
1057520189 9:95753810-95753832 TCCCTCTGGCTTCCGTCTCCTGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1198055017 X:132985251-132985273 TTCCTATGACTTAGATGACCTGG + Intergenic