ID: 929148757

View in Genome Browser
Species Human (GRCh38)
Location 2:38729496-38729518
Sequence CTCTATATAAAGATGAGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929148755_929148757 -3 Left 929148755 2:38729476-38729498 CCAGTGAGCCTTTGTGGAGGCTC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 929148757 2:38729496-38729518 CTCTATATAAAGATGAGACTTGG 0: 1
1: 0
2: 0
3: 10
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929148757 Original CRISPR CTCTATATAAAGATGAGACT TGG Intronic
901869885 1:12132085-12132107 CTATTTTTAAAAATGAGACTGGG - Intronic
901885772 1:12221964-12221986 CTATAATTAAAGATGAGATTTGG + Intergenic
906139397 1:43524796-43524818 CTCTCTATAAAGATGTGGCAAGG + Intergenic
908018254 1:59870086-59870108 ATCTATAAAATGGTGAGACTGGG + Intronic
908519278 1:64925736-64925758 CTTTATATAACAATGAGACATGG + Intronic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
909461355 1:75918564-75918586 CTATATGCAAACATGAGACTTGG - Intergenic
909927396 1:81454414-81454436 ATCAATACAAAGATGATACTTGG - Intronic
910372100 1:86527096-86527118 CACTATATGAAGATGATAGTAGG + Intergenic
911274795 1:95848397-95848419 CTCTAATTCAAGATGAGATTTGG - Intergenic
911830886 1:102550373-102550395 CTACAGATAAAGATGAGATTTGG + Intergenic
912281361 1:108317968-108317990 ATCTATAAAATGATGACACTAGG - Intergenic
914924647 1:151873681-151873703 CCTTATAAAAAGAGGAGACTTGG + Exonic
916007248 1:160673922-160673944 CTCTATATAAACAGAGGACTAGG - Intergenic
918822624 1:189275184-189275206 CTGTATTTAAAGCTGAGAGTAGG - Intergenic
918901497 1:190426209-190426231 GTCTACATAAAGGTGAGACTGGG - Intronic
920335589 1:205243081-205243103 CTCAATATAAAGAGTAGATTGGG + Intronic
922554046 1:226519585-226519607 CTCTCTATAAAGAGGAGCCTTGG + Intergenic
1063063297 10:2580674-2580696 TTCTACATAAAGATGAGAGCAGG - Intergenic
1063144299 10:3282964-3282986 CTCTCTTTAAAAATGAGCCTGGG + Intergenic
1063875060 10:10466884-10466906 CTCAATATTAAGATGACACATGG - Intergenic
1064635993 10:17367460-17367482 CTGTAATTCAAGATGAGACTTGG + Intronic
1065438601 10:25726605-25726627 CTATAATTCAAGATGAGACTTGG - Intergenic
1065740064 10:28789352-28789374 ATTTATATAAATATGATACTTGG - Intergenic
1065797783 10:29323037-29323059 CACTATTTTTAGATGAGACTGGG - Intergenic
1065799023 10:29334104-29334126 CTCTAAATTAAGATGACCCTTGG + Intergenic
1066426788 10:35314495-35314517 CTCTAATTCAAGATGAGATTTGG + Intronic
1068782376 10:60934752-60934774 CTCTAAATAGGGATGAGATTTGG - Intronic
1068793204 10:61049473-61049495 CTTTATATAAAAATTAGAATTGG + Intergenic
1069473037 10:68709966-68709988 CTCTTTGAAAAGATCAGACTGGG + Intergenic
1070456119 10:76619270-76619292 CTATAATTCAAGATGAGACTTGG + Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1076048725 10:127315399-127315421 CTTTATAGCAAGAAGAGACTAGG + Intronic
1076528760 10:131130341-131130363 CTATAATTCAAGATGAGACTTGG + Intronic
1077278377 11:1729029-1729051 GTCTATAAAAAGATGCCACTAGG + Intergenic
1079736425 11:24002504-24002526 CTACATATCAAGATGAGATTTGG - Intergenic
1080216230 11:29844418-29844440 CGCAATAAAGAGATGAGACTTGG + Intergenic
1083062117 11:59884802-59884824 CTCTATTTAAAGATGACATGAGG - Intergenic
1083363528 11:62127952-62127974 CTCTTTGTAGAGATGAGGCTAGG + Intronic
1084317176 11:68352274-68352296 TTCGATAAAAAGATGAGACAAGG + Intronic
1085798489 11:79565592-79565614 CTTTATAAGAAGAGGAGACTAGG + Intergenic
1088052768 11:105538391-105538413 GTCTATATAAAGGGGAAACTTGG - Intergenic
1088212428 11:107471623-107471645 CTATATTTCAAGATGAGATTTGG + Intergenic
1091469562 12:715039-715061 CTCAATTCAAGGATGAGACTTGG + Intergenic
1096222226 12:49838063-49838085 TTATTTATAAAGATCAGACTAGG - Exonic
1096924823 12:55132418-55132440 CCCTATAGAAAGAGGAGATTAGG + Intergenic
1097610661 12:61815705-61815727 CTCAATATAAAGGTAAGAGTTGG + Intronic
1098246469 12:68523969-68523991 CTTTATATAAACAGGAGAGTAGG + Intergenic
1099014481 12:77327791-77327813 CTCTGTATAAAAATATGACTTGG - Intergenic
1100955720 12:99905754-99905776 CTCTATAAGAAGAGGAGATTAGG - Intronic
1103626095 12:122221204-122221226 CTTTAAATAGAGGTGAGACTTGG + Intronic
1106553688 13:30792346-30792368 CTGTACATAAAGATGACACTGGG + Intergenic
1109528735 13:63611237-63611259 CTCTATGCAAAGATGATACAGGG - Intergenic
1109685980 13:65819921-65819943 CTATAAATAAAGATGAGATTTGG - Intergenic
1109821782 13:67666523-67666545 GTTTATATAAAGTTGAGGCTGGG - Intergenic
1110086011 13:71380535-71380557 CTATAATTCAAGATGAGACTTGG + Intergenic
1110687720 13:78395090-78395112 CTTTATATGAAGAGGAGATTAGG - Intergenic
1114538297 14:23436731-23436753 CTCTGGATAAAGCTGAGGCTGGG - Intergenic
1115724405 14:36197389-36197411 CTCTATCTAAAGCTGAGATTAGG - Intergenic
1116356289 14:43935956-43935978 CTCTAATTCAAGATGAGATTTGG + Intergenic
1117102222 14:52361564-52361586 CTTTATAGTAAGATAAGACTTGG - Intergenic
1117506163 14:56405163-56405185 CTATAGTTAAAGATGAGATTTGG + Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1119573118 14:75693935-75693957 CTCATTTTAAAGATAAGACTAGG + Intronic
1120261782 14:82194549-82194571 CTCCAATTAAAGATGAGATTTGG - Intergenic
1120496064 14:85237497-85237519 CTATCTATAAAGAGGACACTGGG - Intergenic
1120649028 14:87108910-87108932 CTCTGTATAAAGATGACTCATGG - Intergenic
1124070992 15:26393153-26393175 CTCTGTATAAAGGGCAGACTTGG + Intergenic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125375133 15:39020770-39020792 CTCAAAATAAATATGAAACTAGG - Intergenic
1126341444 15:47645387-47645409 GTCTATATAAAGAGAAGGCTAGG - Intronic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127719440 15:61685422-61685444 GTCTCTAAAAAGATGAGACATGG - Intergenic
1129539552 15:76339301-76339323 CCCTATAGAAAGAGGAAACTGGG + Intronic
1131789255 15:95946582-95946604 AATTATATAAAGATGAGACTAGG - Intergenic
1131950547 15:97676386-97676408 GTCTATATAAAGACTAAACTAGG + Intergenic
1137811044 16:51352737-51352759 CTATAATTAAAGATGAGATTTGG + Intergenic
1140667358 16:77239848-77239870 GTTTGCATAAAGATGAGACTAGG + Intergenic
1141069646 16:80942108-80942130 CTCTATAAAAAGAAGAGGTTGGG - Intergenic
1143144577 17:4766070-4766092 CTTTAAAAAAAAATGAGACTGGG + Intergenic
1143224552 17:5289481-5289503 CTTTAAATAAACATGAGAGTTGG - Intronic
1146467783 17:33100276-33100298 CTGTATCTAAGGATGAGACCTGG - Intronic
1148633336 17:49128925-49128947 CTCTTTATAAAGAGGATTCTGGG - Intergenic
1149115905 17:53096531-53096553 CTATAAATCAAGATGAGATTTGG - Intergenic
1149164063 17:53728232-53728254 CTCCAAATCAAGATGAGATTTGG + Intergenic
1150503692 17:65676527-65676549 TTCTATATAAATTTTAGACTTGG - Intronic
1153195836 18:2595229-2595251 TTATATATATATATGAGACTTGG + Intronic
1153366921 18:4266900-4266922 ATTTATATAAAGATTACACTTGG - Intronic
1154043288 18:10879792-10879814 CTGTCCATAAAGAGGAGACTAGG + Intronic
1154929278 18:20975475-20975497 TTCTAAATAGAGATGAGAATAGG - Intronic
1159191134 18:65044027-65044049 CTCTATAAGAAGAGGAGATTAGG - Intergenic
1159268045 18:66110460-66110482 ATCTGTATAAAGATGTAACTTGG + Intergenic
1159877538 18:73828969-73828991 ATCTTTATAAATATGAGATTTGG + Intergenic
1162502930 19:11064813-11064835 TTCTAAATAAAAATGAGAATTGG - Intronic
1163055930 19:14717763-14717785 CTCTATAGTAGGATGAGTCTGGG + Intronic
1164072750 19:21783736-21783758 CTCTCTATGTAGATGAGTCTAGG + Intergenic
929148757 2:38729496-38729518 CTCTATATAAAGATGAGACTTGG + Intronic
933491431 2:82989923-82989945 CTCTTTAAAAAGATGATAGTTGG - Intergenic
935105915 2:100043432-100043454 CTATATATAAGGACGGGACTTGG + Intronic
935193490 2:100796674-100796696 GTCTCTAGAAAGATGACACTGGG - Intergenic
935239646 2:101167385-101167407 CTATAAAGAAATATGAGACTGGG - Intronic
936100106 2:109569959-109569981 CACTACATAAAGATGAGAGGTGG - Intronic
936674954 2:114704167-114704189 ATCTAGATAAAGATGGGATTAGG + Intronic
938972219 2:136443062-136443084 CCATATAGACAGATGAGACTAGG + Intergenic
941177688 2:162219488-162219510 CTCTAAATAAAGATTAGATCTGG - Intronic
943077604 2:183215037-183215059 ATTTATATAAAAAGGAGACTGGG + Intergenic
943148084 2:184071515-184071537 CTCAATATAAAGATCAAGCTTGG - Intergenic
944786654 2:203077507-203077529 CTCCATATAAGGATGATATTTGG - Intronic
945216331 2:207438026-207438048 CTCCGTATAAAGATGAGATAAGG + Intergenic
947888672 2:233596389-233596411 CTCAAATTAAAGATGAGATTTGG - Intergenic
1170005660 20:11666200-11666222 CTCTTCATAAAGAGGAGAATTGG + Intergenic
1172700122 20:36848147-36848169 CTCTAAATAAAAATGAGAGAGGG + Intronic
1172734081 20:37112773-37112795 CTCTGTTTAAAAATGAGGCTGGG - Intronic
1174925953 20:54760087-54760109 TTCTGTATAAATATGAGGCTTGG - Intergenic
1177278729 21:18950680-18950702 CTCAATATAAAAATGAGAAAAGG - Intergenic
949317537 3:2773552-2773574 TTCTAGAGGAAGATGAGACTAGG + Intronic
949542643 3:5045852-5045874 CTTTATAAAAAGAGGAGATTAGG + Intergenic
952457451 3:33486910-33486932 CTATAATTCAAGATGAGACTTGG + Intergenic
956346241 3:68282219-68282241 CTATAAATCAAGATGAGATTTGG + Intronic
958076177 3:88681835-88681857 TGCTATATAAAGATGAGAGCTGG + Intergenic
958668197 3:97167737-97167759 CGCTATATAAAAATATGACTTGG - Intronic
958781812 3:98551908-98551930 CTGAATAGAAAGATTAGACTGGG + Intronic
959189459 3:103091818-103091840 CTCTATAGAAAAATAAAACTAGG - Intergenic
959381994 3:105652464-105652486 CTATATTTCAAGATGAGATTTGG + Intergenic
959784703 3:110281662-110281684 ATGTATATATAGATGAGTCTTGG + Intergenic
960617140 3:119606328-119606350 CTTTATATAAAGAGGAAATTTGG - Intronic
961401769 3:126652043-126652065 CTATAAAGAAATATGAGACTGGG + Intronic
962399163 3:135042224-135042246 CCCTATAAAAAGATGAGGCCGGG - Intronic
962774149 3:138642927-138642949 CTATAAATAAACCTGAGACTGGG - Intergenic
962931226 3:140038803-140038825 CTCTATCTAATGAGAAGACTAGG - Intronic
963666595 3:148195951-148195973 ATCTAAAAAACGATGAGACTTGG + Intergenic
964099626 3:152973166-152973188 CTCTATATGAAGAAAAGTCTGGG - Intergenic
964117242 3:153148993-153149015 CTATAATTCAAGATGAGACTTGG + Intergenic
966099259 3:176246168-176246190 CTCTAAGTAAAGAAGATACTGGG + Intergenic
968226328 3:196974624-196974646 CTATATCTAAAAATGAGCCTTGG - Intergenic
969943532 4:10759453-10759475 CTCTATAAGAAGAGGAGATTAGG + Intergenic
971587980 4:28430387-28430409 ATCTGTATAATGCTGAGACTAGG + Intergenic
971919770 4:32922626-32922648 CTACAAATAAAGATGAGATTTGG + Intergenic
972046093 4:34666352-34666374 CTATAATTCAAGATGAGACTTGG - Intergenic
975780503 4:77834394-77834416 ATATATATAAAGAAGAAACTAGG + Intergenic
975923486 4:79421279-79421301 CCCTATAGAAAGAGGAGATTAGG - Intergenic
976126914 4:81843174-81843196 CTTTCTATAAGGAAGAGACTTGG + Intronic
976374267 4:84326104-84326126 CTCTATCAAAAGATGATCCTGGG - Intergenic
976963265 4:91004262-91004284 CTTTCCATTAAGATGAGACTTGG - Intronic
977100377 4:92804653-92804675 CTCTAGATATAAATGAGAATTGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979972294 4:127150428-127150450 CTTTCTATTAGGATGAGACTAGG + Intergenic
980966971 4:139531373-139531395 CTCTACATAGAGATGAGTATAGG - Intronic
981204941 4:142029426-142029448 TCCTTTATAAAGCTGAGACTTGG - Intronic
981443985 4:144813566-144813588 ATCTGTATAAAGCTGAGAGTGGG - Intergenic
982477115 4:155867548-155867570 CTATAATTAAAGATGAGATTTGG + Intronic
984440386 4:179762253-179762275 ATGCATAGAAAGATGAGACTTGG - Intergenic
984781519 4:183530544-183530566 CTCAATATAAAGAACTGACTTGG + Intergenic
986424474 5:7616884-7616906 CTCTATAAGAAGAGGAGATTAGG + Intronic
987542009 5:19268219-19268241 GTCTATTAAAAGATTAGACTGGG + Intergenic
989075433 5:37560660-37560682 TTCTTTATAAAAAAGAGACTAGG + Intronic
989464400 5:41738298-41738320 CTCCAAATCAAGATGAGATTTGG - Intronic
992709275 5:79433049-79433071 CTGTATGTAAAGCTGGGACTTGG - Intronic
993033629 5:82732798-82732820 CTACATTTAAAGATGAGATTTGG + Intergenic
994490343 5:100434928-100434950 CTCTAAATAGAGATGGGGCTGGG - Intergenic
995299759 5:110565578-110565600 CTCTTTATTCAGATGGGACTTGG - Intronic
995599862 5:113783632-113783654 CTCTTTAAAAAAATCAGACTAGG + Intergenic
996250911 5:121330963-121330985 CTATAAATCAAGATGAGATTTGG - Intergenic
996514746 5:124357325-124357347 CTCTTTATAAAGATGTGACGGGG - Intergenic
998827884 5:146123336-146123358 CTATATATAAAGTTGTGAGTGGG + Intronic
999893308 5:156002204-156002226 CTGTATAAGAAGATGAGATTAGG + Intronic
1001216128 5:169857614-169857636 TTCTATAAAGAGCTGAGACTAGG + Intronic
1003147119 6:3517947-3517969 CTCTCTCTAAAGAGGAGACAGGG - Intergenic
1007204282 6:40135898-40135920 CTACAACTAAAGATGAGACTTGG - Intergenic
1007260138 6:40557574-40557596 CTACAAATAAAGATGAGAGTGGG + Intronic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1009342900 6:62579928-62579950 CTATATTTCAAGATGAGATTTGG - Intergenic
1010027360 6:71235012-71235034 CTCCAATTAAAGATGAGATTTGG + Intergenic
1010923875 6:81719751-81719773 TTCTATATAAATATGAGAAATGG + Intronic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1013312610 6:108910163-108910185 GCATATATAAATATGAGACTTGG + Intronic
1013534733 6:111053521-111053543 CCCTATAAAAAGAGGAGATTAGG - Intergenic
1014838377 6:126185992-126186014 CTCTAATTCAAGATGAGATTCGG + Intergenic
1015243152 6:131048608-131048630 TTCAAAATAAAGATGAGAGTGGG + Intronic
1016677133 6:146783944-146783966 CTCTTCATAAAAATGAGAGTAGG - Intronic
1017048810 6:150371671-150371693 CTCTGTATAAAGATAAGACAAGG - Intronic
1018194789 6:161345815-161345837 CACTATATCAAGAGGTGACTGGG - Intergenic
1019363650 7:619112-619134 CCTTATAAAAAGAGGAGACTTGG + Intronic
1020838659 7:13186350-13186372 CTTTAAAAAAAGATGAGGCTGGG + Intergenic
1025166962 7:56720944-56720966 TTCTATTTAAAGTTGAGCCTTGG - Intergenic
1026280567 7:68918434-68918456 CTCTCTCTAAAGGTGAGAGTTGG + Intergenic
1029047641 7:97646575-97646597 CTGTAAATACAGATGATACTTGG + Intergenic
1029783191 7:102756355-102756377 CTCTAAAAAAAAATCAGACTAGG + Intronic
1029952043 7:104596314-104596336 CTCTCTATTAAGATGGGTCTTGG - Intronic
1030302094 7:107984547-107984569 TTCCATTTAAAGATGAGACATGG - Intronic
1030638431 7:111976305-111976327 ATATATATATATATGAGACTCGG + Intronic
1032773124 7:135079758-135079780 ATGTATAAAAAGATGAGGCTGGG - Intronic
1033249117 7:139743588-139743610 ATCTAGAAAAAAATGAGACTTGG + Intronic
1034713177 7:153215015-153215037 CTATATAAAAAAATAAGACTGGG - Intergenic
1035843639 8:2839818-2839840 GACTATATAAAGATCAGACCAGG - Intergenic
1036960399 8:13239069-13239091 CTTTATATAAAAAGGAGATTGGG + Intronic
1037333951 8:17773923-17773945 CACTATATAAAAATAAGACTAGG + Intronic
1038058567 8:23886244-23886266 CCCTATTTATAAATGAGACTCGG - Intergenic
1038458738 8:27697616-27697638 CTATATTTCAAGATGAGATTTGG - Intergenic
1039072490 8:33659535-33659557 CTATATTTCAAGATGAGATTTGG - Intergenic
1042230955 8:66553996-66554018 CTTTATATACAAATGAAACTAGG + Intergenic
1042795735 8:72661464-72661486 CTCTTGCTAAAGATGAGACTGGG - Intronic
1045321765 8:101087124-101087146 CTCTATAAAAAGAGGACATTTGG - Intergenic
1045685136 8:104703751-104703773 CTCCCTTCAAAGATGAGACTGGG + Intronic
1046229004 8:111328388-111328410 TTCAATATAAATTTGAGACTTGG + Intergenic
1046977592 8:120299167-120299189 AACTATATCAAGATGAGATTTGG + Intronic
1047281090 8:123446304-123446326 CTCTAGAAAAAGAAGAGAATGGG - Intronic
1048134430 8:131734443-131734465 TTCCATATAAACATGAGAGTCGG - Intergenic
1048821355 8:138383508-138383530 ATTTATATAAAAATGAGAATGGG + Intronic
1050001248 9:1078942-1078964 CTCAAGATGAAGAGGAGACTTGG + Intergenic
1050849425 9:10264802-10264824 CTATAATTCAAGATGAGACTTGG - Intronic
1051577860 9:18637827-18637849 CTCTAATTAAAGATGAGCCAAGG - Intronic
1052742546 9:32407170-32407192 CTCTATATAAAGTTGATATGAGG - Intronic
1052755943 9:32541294-32541316 GTCTATTTAAAGATGACATTTGG - Exonic
1055611446 9:78030310-78030332 TTCTAGATAAAGATGAGGGTAGG - Intronic
1056742866 9:89275287-89275309 CTACAAATAAAGATGAGATTTGG + Intergenic
1059671555 9:116496962-116496984 CTATAATTCAAGATGAGACTTGG + Intronic
1185884596 X:3771196-3771218 GTCTACATAAAAATGTGACTGGG + Intergenic
1185891043 X:3822363-3822385 CTCCATTTACAGGTGAGACTGGG - Intronic
1185896147 X:3860779-3860801 CTCCATTTACAGGTGAGACTGGG - Intergenic
1185901266 X:3899205-3899227 CTCCATTTACAGGTGAGACTGGG - Intergenic
1185906378 X:3937641-3937663 CTCCATTTACAGGTGAGACTGGG - Intergenic
1187720564 X:22146519-22146541 CTATATTAAAAGATGAGTCTGGG + Intronic
1189378901 X:40487599-40487621 CTATAATTCAAGATGAGACTTGG + Intergenic
1189522268 X:41782396-41782418 CTGTATATCGAGATGAGACCTGG - Intronic
1191710153 X:64141097-64141119 ATCTATATTTAGATGAGATTGGG - Intergenic
1194000257 X:88420075-88420097 CTGTAATTAAAGATGAGATTTGG - Intergenic
1194509140 X:94770827-94770849 CCCTAGAAAAAGATGAGGCTTGG - Intergenic
1198155580 X:133956978-133957000 GTTTATAAAATGATGAGACTTGG - Intronic
1199134646 X:144235696-144235718 CTATATAAATACATGAGACTGGG - Intergenic
1199355267 X:146855235-146855257 CTATAAATCAAGATGAGATTGGG - Intergenic
1199461927 X:148094339-148094361 CTATACTTAAAGATGAGATTTGG + Intergenic
1199691237 X:150310458-150310480 CTCCAAATGAAGATGAGGCTTGG - Intergenic
1200135862 X:153874296-153874318 CTCTACAGAAAGATGGGAGTGGG - Intronic
1200883342 Y:8243479-8243501 CTCTGTAGAAAGGTGAAACTGGG + Intergenic