ID: 929149316

View in Genome Browser
Species Human (GRCh38)
Location 2:38733489-38733511
Sequence CAGCAGCACAGGAGGGAAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 1, 2: 4, 3: 54, 4: 551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929149316_929149328 26 Left 929149316 2:38733489-38733511 CCCGCTTCCCTCCTGTGCTGCTG 0: 1
1: 1
2: 4
3: 54
4: 551
Right 929149328 2:38733538-38733560 CACCTGGTTCAAGTTTTCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 193
929149316_929149325 10 Left 929149316 2:38733489-38733511 CCCGCTTCCCTCCTGTGCTGCTG 0: 1
1: 1
2: 4
3: 54
4: 551
Right 929149325 2:38733522-38733544 AGGAGTATGACCACACCACCTGG 0: 1
1: 0
2: 0
3: 8
4: 81
929149316_929149323 -10 Left 929149316 2:38733489-38733511 CCCGCTTCCCTCCTGTGCTGCTG 0: 1
1: 1
2: 4
3: 54
4: 551
Right 929149323 2:38733502-38733524 TGTGCTGCTGAGGCCTGGTGAGG 0: 1
1: 0
2: 3
3: 37
4: 425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929149316 Original CRISPR CAGCAGCACAGGAGGGAAGC GGG (reversed) Exonic
900406904 1:2496750-2496772 CAGCAGCATAGCAGGGATGGGGG - Intronic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900808285 1:4782092-4782114 CCGCAGCACAGGAGTGGAGCAGG + Intronic
901215520 1:7552742-7552764 CTGCAGCAAAGCAGGGAGGCTGG + Intronic
901254116 1:7806234-7806256 CAGCAGCACTGCAGGCAAGCAGG + Intronic
901628407 1:10636258-10636280 CAGCAGCCCAGGAGAGGAGAGGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902400038 1:16152598-16152620 CAGCTACACAGGAAGGAATCTGG + Intronic
902554124 1:17236931-17236953 CAGCAGATCAGCAGGGAGGCTGG + Intronic
903560218 1:24221459-24221481 CATGAGCACAGGAGGGGAGATGG + Intergenic
903917326 1:26773893-26773915 CAGCAGGTGAGGAGGGTAGCTGG + Exonic
904442415 1:30540431-30540453 CAGCAGATCAGGAGGCAAGCTGG + Intergenic
904587051 1:31586449-31586471 GAGCAGAAGAGGAGGGAACCTGG - Intronic
904838583 1:33355442-33355464 CTCCAGCAAAGGAGGAAAGCAGG - Intronic
905034571 1:34909178-34909200 CAGCAGCACCTGTGTGAAGCAGG - Intronic
905915923 1:41684226-41684248 AAGCAGCAGAGGAAGGAAGTGGG + Intronic
906511083 1:46410794-46410816 CAGCTGCACAGGACAGACGCAGG - Exonic
906684774 1:47756279-47756301 CAGCAGCACAGGTGGAGGGCTGG - Intergenic
907205588 1:52767850-52767872 CAGCACCCCAGCAGGGAAGCAGG + Intronic
908091073 1:60686114-60686136 CACCAGCCCATGAAGGAAGCTGG + Intergenic
908156111 1:61355235-61355257 CAGAAACACTTGAGGGAAGCAGG - Intronic
908504381 1:64781499-64781521 CAGGAGCACAGAAGGAAACCTGG - Exonic
910237304 1:85048616-85048638 CAGGAGCACAGGTGGGACGCAGG + Intronic
910669282 1:89756965-89756987 GAGTAGCACAGAAGAGAAGCTGG - Intronic
911096428 1:94058878-94058900 CAACAACACAGGAAAGAAGCTGG - Intronic
915242350 1:154532433-154532455 GAGAAGCACAGGTGGGAACCAGG - Intronic
915612430 1:157005157-157005179 CAGTAACACAGGAAGGAAGAAGG - Intronic
916242123 1:162650676-162650698 GACTAGCACAGGAGGGAAGAAGG - Intronic
916262782 1:162859404-162859426 CAGAGGCACAGCAGGGCAGCAGG - Intronic
916822040 1:168409293-168409315 CAGCAGCATAAAAGGGAAGGAGG + Intergenic
917600695 1:176570915-176570937 CAGCAGCAGTGTAGGGAGGCAGG - Intronic
918789938 1:188813088-188813110 GAGAGGCACGGGAGGGAAGCAGG + Intergenic
919554251 1:199031376-199031398 CACCAGCACATGAAAGAAGCTGG - Intergenic
920180362 1:204128670-204128692 GAGGAGCACAGGAGGGATCCTGG + Intergenic
920418119 1:205812470-205812492 CAGGAACACAGGAGGGAGGCGGG - Intronic
920912470 1:210232188-210232210 ACGCAGCTCAGGAGGGAAACGGG + Intergenic
921166918 1:212514393-212514415 CAGCAGCACAGGTGGGCGCCAGG - Intergenic
921317409 1:213905401-213905423 CAGCAGCTGAGGCAGGAAGCAGG + Intergenic
921363435 1:214351617-214351639 CAGCAGCAGGCGAGGGAAGATGG + Exonic
921411156 1:214837558-214837580 CAGAAACATGGGAGGGAAGCAGG + Intergenic
922924414 1:229335831-229335853 CAGCAGCAAAGGAGGACAGCAGG + Intronic
922938595 1:229440504-229440526 CAGCAGCACGGGAGGGAGATGGG + Intergenic
923721819 1:236473425-236473447 GAGCAGCAGAGGAGGTGAGCTGG + Intronic
1062799957 10:371633-371655 GAGCAGCACCCGAGGGAGGCTGG + Intronic
1062799969 10:371676-371698 GAGCAGCACCCGAGGGAGGCTGG + Intronic
1062856283 10:781043-781065 AAGCAGCCCAGGAGGGCAGGTGG - Intergenic
1063087565 10:2833275-2833297 CAGGAGGACAGGAGAGAAGCAGG - Intergenic
1063137570 10:3230479-3230501 TAGCAGCACAGGACAGACGCTGG + Intergenic
1063685280 10:8231136-8231158 CAGCAGCACAGGAAGGAAGCAGG + Intergenic
1063688337 10:8259633-8259655 CCCCAGCACAGAAGAGAAGCAGG + Intergenic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064448558 10:15420164-15420186 CAGCAGCTCAGGATGCAAGGTGG - Intergenic
1065262236 10:23936119-23936141 CCACCTCACAGGAGGGAAGCAGG + Intronic
1065473186 10:26104387-26104409 CAGAAGCAAAGGAATGAAGCTGG - Intronic
1066013587 10:31216176-31216198 CTGCACAACAGGAGGGGAGCAGG - Intergenic
1066301439 10:34101107-34101129 CAGACACACAGCAGGGAAGCGGG + Intergenic
1067558096 10:47286139-47286161 CACCATCACAGTAGGGGAGCAGG + Intergenic
1067575247 10:47404573-47404595 CCTCAGCCCAGGAGGGAAGGAGG - Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067720139 10:48721987-48722009 CAGGAACACAGCAGGGAACCTGG + Intronic
1068527922 10:58152156-58152178 CAAGAGCACAGAAGGGAAGTAGG - Intergenic
1069528978 10:69201197-69201219 GAGGTGCCCAGGAGGGAAGCAGG - Intronic
1069812007 10:71168199-71168221 CAGGAGCACAGTAGGTAAGAAGG - Intergenic
1070759521 10:79015055-79015077 CAGCAGCTCAGGAGGAAGCCTGG + Intergenic
1072190383 10:93073019-93073041 CAGCTGGACAGCAGGGAAGGGGG - Intergenic
1072736778 10:97884376-97884398 CAGCAGCAGAGGAGAGCAGGAGG + Intronic
1074556761 10:114498506-114498528 CAGCAGTCCAGGAGCTAAGCAGG - Intronic
1074921688 10:118020616-118020638 CTGCAGCCCAGCAGGGAGGCAGG - Intronic
1074971731 10:118544598-118544620 CAACAGCCAAGGTGGGAAGCTGG + Intergenic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1075113767 10:119608925-119608947 CAGGAGCACTGAAGGGCAGCTGG + Intergenic
1075115994 10:119627581-119627603 TAGCAACTCAGAAGGGAAGCCGG + Intergenic
1075301113 10:121324960-121324982 CAGGAGCACAGTATGTAAGCAGG + Intergenic
1075519105 10:123133489-123133511 TAGCCGCACAGCAGGGATGCGGG + Intergenic
1076058977 10:127398481-127398503 CAGCAGCACAGGAGCCAGGGAGG - Intronic
1076164122 10:128268375-128268397 CAGCAGCTCAGAAGGGCAGCGGG - Intergenic
1076565844 10:131398437-131398459 CAGCAGCAGAGCAGGGAGCCTGG - Intergenic
1076755245 10:132567163-132567185 CACCTGCACAGGAGGGTGGCCGG - Intronic
1077055000 11:587188-587210 CCGCGGCACTGGAGGCAAGCGGG - Intronic
1077075212 11:697798-697820 AGGCACCACAGGATGGAAGCAGG - Intronic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077088242 11:765399-765421 CAACAGGACAGGAGGGGGGCGGG - Intergenic
1077114420 11:876924-876946 CAGGACCACTGGAGGGGAGCAGG - Intronic
1077145241 11:1041602-1041624 CAGCAGCACAGGAGGGGTCCTGG + Intergenic
1077190338 11:1253390-1253412 GAGAAGCTCAGGATGGAAGCGGG + Intronic
1077282674 11:1752745-1752767 CACCAGCACAGAGGGGAGGCCGG + Exonic
1077480019 11:2809664-2809686 CAGGAGGATAGCAGGGAAGCAGG - Intronic
1077553309 11:3213786-3213808 CAGCAGCAATGCAGGGAAGAGGG - Intergenic
1077553710 11:3215849-3215871 CAGCAGGACAGGAAGGCGGCTGG - Intergenic
1078102076 11:8336045-8336067 CAGCAGGACAGCAGGAAGGCCGG - Intergenic
1078820729 11:14878536-14878558 TTGCAGCATAGGAGGGAAGTGGG - Intronic
1080715714 11:34797910-34797932 CAGCAGCCCATGAAAGAAGCTGG + Intergenic
1080889666 11:36398452-36398474 GAGCAGCACAGGGAGGAAGGAGG - Intronic
1081218912 11:40436538-40436560 AAGCAGGACAGGAGAGAGGCTGG - Intronic
1081433686 11:43004388-43004410 CACCAGCAAAGGAACGAAGCTGG - Intergenic
1082162503 11:48900587-48900609 CAGCGGGACAGGTGGGAGGCCGG + Intergenic
1082636449 11:55599982-55600004 CAGCATCAGGGGAGTGAAGCTGG + Intergenic
1082832937 11:57632928-57632950 CAGCAGCATTTGAGAGAAGCAGG + Intergenic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1082973817 11:59052618-59052640 AAGCGGCAGAGGAGGGAAGCTGG - Intergenic
1082978224 11:59096432-59096454 AAGCGGCAGAGGAGGGAAGCTGG - Intergenic
1083261876 11:61527587-61527609 CAGAGGCCGAGGAGGGAAGCTGG - Intronic
1084203706 11:67578595-67578617 CGGCAGCACAGGAGGGTTCCAGG - Intergenic
1084469586 11:69349150-69349172 CAGCTGCTCAGGAAGGCAGCAGG - Intronic
1084617032 11:70243289-70243311 CTGCAGCAGAGCAGGGAAGTGGG + Intergenic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1088893954 11:114064086-114064108 CAGCATCTCAGGAGGGATGGGGG + Exonic
1089455897 11:118625591-118625613 CAGCTGCACAGGGGGGCAGGAGG + Intronic
1090172524 11:124617240-124617262 GAGCAGCTGAGGAGGGAGGCCGG - Intronic
1090330404 11:125926940-125926962 AGGCAGCACAGGAGGGTGGCAGG - Intergenic
1090636376 11:128692881-128692903 CGGCGGCCCAGGAGGGAGGCGGG + Intronic
1090971774 11:131650010-131650032 CAGTTACACAGGAAGGAAGCAGG + Intronic
1091003559 11:131931766-131931788 CAGGAGCACAGAAGGGACACTGG + Intronic
1093152022 12:15633034-15633056 AGGCAGGACAGGAGGGAAGGAGG + Intronic
1094490994 12:30960514-30960536 CAGCAGACCTGGAGGAAAGCAGG - Intronic
1095444530 12:42270829-42270851 CAGTATCACAGGAAGCAAGCAGG + Intronic
1096101516 12:48972867-48972889 CAGCAGCACAGACTGGAGGCTGG - Intergenic
1096177560 12:49533053-49533075 CAGCAGCACACAGGTGAAGCTGG + Intergenic
1096609547 12:52791817-52791839 CTGCAGAACAGAAGGGAAGATGG + Intronic
1096940266 12:55336466-55336488 CAGCAGCACAGTAAGGCAGGTGG - Intergenic
1099228204 12:79993595-79993617 GAGAAGCACAGGCGGGAACCCGG - Intergenic
1099304237 12:80935758-80935780 CAGTAGCTCAGGAGACAAGCAGG - Intronic
1099935237 12:89117572-89117594 CAGCAGGGCAGCAGGGCAGCAGG - Intergenic
1100211720 12:92405837-92405859 CGCCAGCTCAGGAGTGAAGCTGG + Intergenic
1100257227 12:92896687-92896709 CAGCTACTCAGGAGGGAGGCAGG + Intronic
1100617278 12:96240665-96240687 CAGCAGCTCAGTAAGCAAGCAGG - Intronic
1102035943 12:109770599-109770621 TTGCAGCCCGGGAGGGAAGCAGG + Intergenic
1102531003 12:113546859-113546881 CAACAGCAGAGAAGGGAAGCCGG - Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1103361016 12:120353676-120353698 GATGAGGACAGGAGGGAAGCAGG - Intronic
1103549103 12:121723533-121723555 CAGCAGAACAGGGAGGAGGCAGG + Intronic
1103827409 12:123751031-123751053 CAGCAGCACACGATGAAATCAGG - Intronic
1103932128 12:124456429-124456451 CAGCAGCAGAGCTGGAAAGCAGG - Intronic
1104063475 12:125287171-125287193 CAGAAGCAGAGGAGGGAGGGAGG - Intronic
1104176502 12:126338031-126338053 CAGTAACAAAGGAAGGAAGCTGG + Intergenic
1104188832 12:126458415-126458437 GAGCAGCAGTGCAGGGAAGCGGG - Intergenic
1104649412 12:130520976-130520998 AAGCAGCTCAGCAGGGAAGCCGG + Intronic
1104747702 12:131220390-131220412 CAGCACCCCAGGAGGTGAGCTGG - Intergenic
1105821797 13:24086891-24086913 GAGCAGCCCAGGAGGGAACCAGG + Intronic
1106028260 13:25975222-25975244 CATCAGCACAGCAGGGAAGTTGG - Intronic
1106281387 13:28275748-28275770 CAGAATGGCAGGAGGGAAGCTGG - Intronic
1106555220 13:30803404-30803426 CAGCACCACCGGAGAGAACCAGG - Intergenic
1106595221 13:31129772-31129794 CAGCTCCCAAGGAGGGAAGCAGG - Intergenic
1106714498 13:32373851-32373873 GTGCAGTACAGGAGGGAAACCGG - Intronic
1106999602 13:35527505-35527527 CAGGAGCTCAGGAGGGAGGCTGG - Intronic
1107315164 13:39123177-39123199 CAGGAGCACATAAGGGAAGAGGG + Intergenic
1107579067 13:41762641-41762663 CAGAAGCCCAATAGGGAAGCAGG + Intronic
1108542474 13:51456681-51456703 GATGAGCACAGGAGGGAGGCAGG - Intergenic
1108926407 13:55752052-55752074 CAGCAACACAGGTTGTAAGCTGG - Intergenic
1112369842 13:98784909-98784931 CATCAGCTCAGGAGGAGAGCAGG - Intergenic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113387626 13:109863659-109863681 TAGCACCACAGGAAAGAAGCAGG + Intergenic
1113625148 13:111789491-111789513 CAGGAGCACAGGAGGGTGACAGG - Intergenic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1114984587 14:28210655-28210677 CACCAGCCCATGAGGGCAGCTGG + Intergenic
1115215068 14:31006005-31006027 CAGCTACTCAGGAGGGAGGCAGG + Intronic
1117728212 14:58695048-58695070 CAGCCTCAAGGGAGGGAAGCTGG + Intergenic
1117953866 14:61107934-61107956 CAGCAAAACAGGGAGGAAGCAGG - Intergenic
1118001281 14:61526094-61526116 TAGCAGCGCAGGACGGGAGCAGG - Intronic
1119003629 14:70905497-70905519 CAGCAGGCCAGGAAGGCAGCCGG - Intergenic
1119946290 14:78698233-78698255 TAGTAGCACATGAGGCAAGCAGG - Intronic
1121042310 14:90759114-90759136 CAGAAGAGCAGGAAGGAAGCTGG - Intronic
1121178641 14:91910659-91910681 CAGGAGCACAGGATGGCTGCTGG - Intronic
1121252010 14:92506325-92506347 CAGCACCACACATGGGAAGCTGG - Intergenic
1122462629 14:101908026-101908048 CAGCTGCTCAGGAGGAAGGCAGG - Intronic
1122679304 14:103445355-103445377 AAGCAGGACAGGGAGGAAGCAGG - Intronic
1122892439 14:104739017-104739039 CAGCAGCTAGGGAGGAAAGCCGG + Intronic
1122972838 14:105159292-105159314 TAGGAGCACAGGATGGAAGTGGG + Intronic
1124182632 15:27491118-27491140 CAGTAGCACAGCAAGGAAGGAGG - Intronic
1125327410 15:38549868-38549890 CAGCAGCACAGAAGAGATGGTGG - Intronic
1125497605 15:40211780-40211802 TGGGAGCAGAGGAGGGAAGCTGG + Intronic
1125554554 15:40573507-40573529 CAGCTACATAGGAGGGAAGAGGG - Exonic
1125594136 15:40873672-40873694 CAGCGGGACAGGTGAGAAGCTGG - Exonic
1125608541 15:40956063-40956085 CAGCAGCACTGGGGGGAATCTGG - Exonic
1126638688 15:50803684-50803706 CAGAAGCACAGGTGGCAACCTGG + Intergenic
1126696697 15:51332285-51332307 CAGCAGGAGAGGAGAGAATCTGG - Intronic
1127611246 15:60639690-60639712 CAGCACCTCAGGAGGGGAGGCGG + Intronic
1127815896 15:62608622-62608644 CAGCGACACAGGAGGGAAGCAGG + Intronic
1128264839 15:66256648-66256670 CAGAAGCAGAGTAGGGAACCTGG + Intergenic
1128330089 15:66750078-66750100 CAGCAGCCCACAAGGTAAGCTGG - Intronic
1128457996 15:67843716-67843738 CAGCCCCACCGGAGGGAAGGAGG + Intergenic
1128551533 15:68600904-68600926 CAGCAGGACAGCCGGGAAGGTGG - Intronic
1129190669 15:73935726-73935748 CAGCTGCCCAGGAGGCAGGCTGG - Intronic
1129264502 15:74386626-74386648 CAGCTGCACAGGGGGCAAGTGGG + Intergenic
1129331726 15:74831328-74831350 CAGCTTCACAGGAGGGGAGAAGG + Exonic
1129737640 15:77974982-77975004 CAGAAGCAATGGAGGGAGGCAGG - Intergenic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130632791 15:85585936-85585958 TAACAGCACAAGAGGGAAGGGGG - Intronic
1130791844 15:87163682-87163704 CAGCAGCAGTGCAGGGAACCTGG + Intergenic
1131511005 15:93049453-93049475 CAGCAGCACAGATGGGAAGAGGG + Intronic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132816801 16:1832915-1832937 CAGCCACAGAGGAGGGATGCAGG - Intronic
1132868584 16:2105505-2105527 CAGCAGCGCAGGAGGCCGGCAGG + Intronic
1133507777 16:6429307-6429329 CAGCAGCAGTGGTGGGGAGCTGG - Intronic
1134012987 16:10868920-10868942 TGGCAGCCCTGGAGGGAAGCTGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135523354 16:23194330-23194352 CAGCAGGACAGTGGGGATGCGGG + Intronic
1136617693 16:31408642-31408664 CAGGAGCACAGCAGGGAGGAGGG + Intronic
1137343848 16:47636688-47636710 GATGAGCACAGGAGGGAGGCCGG + Intronic
1137847969 16:51710473-51710495 AGGCAGCACAGGAAGGCAGCAGG + Intergenic
1138147912 16:54628653-54628675 CAGAAGGAAAGAAGGGAAGCAGG + Intergenic
1138244839 16:55459854-55459876 AAGCACTGCAGGAGGGAAGCTGG - Intronic
1138550305 16:57744140-57744162 CAGAAGCACAGCAGGGAAGAGGG + Intronic
1139435132 16:66932508-66932530 CAGCAGCGCAGGAGGCAGCCAGG - Intronic
1140906834 16:79416135-79416157 CCGCGGCACAGGATGGAAGTGGG + Intergenic
1141423359 16:83931151-83931173 CTGCAGCAGAGGACGGGAGCGGG + Intronic
1141806757 16:86347110-86347132 CAGCAGGACAGGAAGGGGGCTGG - Intergenic
1142132237 16:88436357-88436379 CTGGAGCCCAGCAGGGAAGCTGG + Exonic
1142229979 16:88895565-88895587 CAGTGGCACAGGGGGGAGGCCGG + Intronic
1142239056 16:88936815-88936837 CCACAGCACAGGCGGAAAGCCGG + Intronic
1142422431 16:89980282-89980304 AGGCAGGAGAGGAGGGAAGCAGG + Intergenic
1142737977 17:1913643-1913665 CAGCTACTCAGGAGGGAGGCTGG + Intergenic
1143187422 17:5018984-5019006 CAGCAGCAGAGGTGGACAGCAGG - Intronic
1143532761 17:7514663-7514685 CAGCAGCCCAGGCAGGAGGCAGG - Intergenic
1144943153 17:18955254-18955276 CATCAGGACACGAGGGGAGCTGG - Intronic
1145011559 17:19371145-19371167 CAGCAGCACTGGAGGGAGGGAGG + Intronic
1145797994 17:27667068-27667090 GAGCAGCCCAGGAGGGCAGAGGG - Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1146056780 17:29585274-29585296 CAGCAGCCCAGGCAGGAAGCCGG + Intronic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146268714 17:31470493-31470515 CAGAACTACAGTAGGGAAGCAGG + Intronic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146624295 17:34424180-34424202 CAGGAGCAGAGGAGAGAAGCGGG - Intergenic
1146809616 17:35892689-35892711 AAGCAGCATAGTGGGGAAGCAGG - Intergenic
1146902934 17:36600080-36600102 CAGCCCCAGAGGAGGGGAGCAGG + Intronic
1146931080 17:36778493-36778515 GAGGAACACAGGAGGCAAGCTGG - Intergenic
1147047989 17:37768917-37768939 CAGGAGCACAGGAGGAGAGAAGG + Intergenic
1147356926 17:39905651-39905673 CTGCAGGCCAAGAGGGAAGCAGG - Intronic
1147904976 17:43816726-43816748 CAGCATTAGTGGAGGGAAGCGGG + Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148599473 17:48883274-48883296 GAGCAGGACATAAGGGAAGCGGG - Intergenic
1148790385 17:50169309-50169331 AAGCAGCATGGGAGGGAAGGGGG - Intronic
1148847755 17:50539133-50539155 GAGCAGCTCAGGCGGGAATCCGG - Intronic
1150216734 17:63475588-63475610 CTGCAGGTCAGGAGGGAGGCTGG + Intergenic
1151350819 17:73531043-73531065 CAGAACCACAGGAGGAAGGCAGG - Intronic
1151376767 17:73694618-73694640 CCCCAGGACAGGCGGGAAGCAGG - Intergenic
1151699133 17:75733441-75733463 AAACAGCCCAGGAGGAAAGCTGG - Intronic
1152098431 17:78286686-78286708 CAGCAGCCCTGGAGAGAAGGAGG + Intergenic
1152670081 17:81598279-81598301 CAGCAGCACCAGAGGGAGGGTGG - Intronic
1152909326 17:82990112-82990134 CAGAAGCACAGCATGGAAGACGG - Intronic
1154358587 18:13641566-13641588 CTGCAGAACAGGAGGGAGGCCGG + Intronic
1155201154 18:23518938-23518960 CAACAGCACAGGAGCGGAGGTGG + Exonic
1156034878 18:32754960-32754982 CTGCAGCAAGGGAGGGAGGCAGG + Intronic
1156178278 18:34573341-34573363 TGGCAGGAGAGGAGGGAAGCAGG - Intronic
1156391689 18:36656516-36656538 TAGCAGCACAGGATAGATGCGGG + Intronic
1157629012 18:49078603-49078625 GAAAAGCACAGGAGAGAAGCTGG - Intronic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1158028152 18:52928709-52928731 CAGAAGCACAGAAGGCAAGAGGG - Intronic
1158526996 18:58223950-58223972 CAGGAGCACAGGTGGGCAGTGGG + Intronic
1158597369 18:58828040-58828062 TAGAAGCACAGGCGGGAACCGGG - Intergenic
1159404055 18:67977208-67977230 CACACGCACTGGAGGGAAGCGGG + Intergenic
1159632024 18:70760027-70760049 GTGCATCACAGGAGGGAAGGTGG + Intergenic
1160918048 19:1507031-1507053 GAGCATCAGAGGAGGGAGGCTGG - Intronic
1161052723 19:2173337-2173359 AAGCAACACAGGAGGGAGGCTGG - Intronic
1161324518 19:3657017-3657039 CAGCATCTCAGGAGGGAAATAGG - Intronic
1161579564 19:5073369-5073391 CAGCAGCCCCGGTGGGGAGCAGG + Intronic
1162119744 19:8456324-8456346 TAGCAGCACAGGAGGGAAGAAGG - Intronic
1162919997 19:13895387-13895409 CAGCAGCACGGGGAGGAACCAGG - Exonic
1163354658 19:16802168-16802190 CAGCTGTTCAGGAGGGAGGCAGG + Intronic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163646890 19:18494731-18494753 CATCAGCACAGGTGGGGAGGGGG - Intronic
1164522641 19:28990761-28990783 AAGCAGCACAGGCGGAAGGCAGG - Intergenic
1166654491 19:44600206-44600228 CAGGAACACAGGAGGCAAGGAGG + Intergenic
1166975942 19:46605076-46605098 CAGCAGCAGAGGACTGAAGCTGG - Intronic
1167723076 19:51192258-51192280 CAGCAGCTCAGGAAGGAGGGAGG + Intergenic
1167761123 19:51450006-51450028 CAGCAGCTCAGGAGGGACAGAGG - Intergenic
1168126950 19:54289578-54289600 CAGGAGCACAGGATGGGAACAGG - Intergenic
1168147299 19:54426902-54426924 GAGCAGCCCAGGAGGGAGGCGGG + Intronic
1168173501 19:54606882-54606904 CAGGAGCACAGGATGGGAACAGG + Intronic
927110172 2:19858905-19858927 CAGATCCTCAGGAGGGAAGCTGG + Intergenic
927591231 2:24360086-24360108 CGGCAGCAGAGGAAGGAACCCGG + Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
927690169 2:25202557-25202579 CAGCAGCTCAGGAAGGAACACGG - Intergenic
927909974 2:26890516-26890538 CAGCAGCCCACGTGGAAAGCTGG + Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928405451 2:31011051-31011073 CAGAAGCACAGGAAGGAGGGAGG + Intronic
928552061 2:32382481-32382503 CAACAGCACAGGAAGGAAACTGG - Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929959810 2:46488023-46488045 CAGCAGCTCAGGAAGGGAGTGGG - Intergenic
930031486 2:47060786-47060808 CAGCAGCACCTCAAGGAAGCAGG + Exonic
930229499 2:48828342-48828364 CAGCAGCAGAGGAAGGGACCTGG - Intergenic
930381946 2:50641302-50641324 CAGCAGCAAATGAGGGAAATGGG - Intronic
930930442 2:56875381-56875403 TAGCAGCACAGGAGCAGAGCTGG - Intergenic
931065025 2:58576187-58576209 CAGAAGCTCCCGAGGGAAGCTGG + Intergenic
931434373 2:62234507-62234529 GAACAGCAGAGGAGGGAGGCTGG - Intergenic
932003658 2:67906981-67907003 CAGGAACAAAGGAGAGAAGCAGG + Intergenic
932195164 2:69776917-69776939 CAGAAGCACAGGTGACAAGCTGG - Intronic
932343056 2:70978805-70978827 AAGCAGCCCAGGTGGGTAGCGGG + Exonic
932405527 2:71510545-71510567 GAGCAGCACTGGTGGAAAGCAGG - Intronic
933656206 2:84888981-84889003 CAGCAGCACGGAAGGGAAGCTGG + Intronic
934080122 2:88460468-88460490 CAGGAACAAAGGAGGAAAGCAGG - Intergenic
934789538 2:97046936-97046958 AAGCAGCACATGTGGGCAGCTGG - Intergenic
934816934 2:97335604-97335626 AAGCAGCACATGTGGGCAGCTGG + Intergenic
934820762 2:97372880-97372902 AAGCAGCACATGTGGGCAGCTGG - Intergenic
935203788 2:100880844-100880866 CAGGAGCACAGCAGGGAGGAGGG + Intronic
935398296 2:102633515-102633537 CAGAATCACACGAAGGAAGCCGG - Intronic
936039704 2:109140946-109140968 CAGCAGCCCCGGATGGAAGGTGG - Intronic
936058800 2:109281205-109281227 CAGCAGCCCAGGGCAGAAGCTGG - Intronic
936115596 2:109700456-109700478 CAGGAGGACTGGAAGGAAGCGGG + Intergenic
936519198 2:113201236-113201258 GAGCAGCTGGGGAGGGAAGCTGG + Exonic
936985849 2:118310869-118310891 CAACATCAAAGGAGGGATGCTGG - Intergenic
937862773 2:126723909-126723931 CAGAAGCAGAGGAGGGGAGCAGG + Intergenic
937896097 2:126977662-126977684 CAGCAGCAAAGGAAGGCAGGAGG - Intergenic
938252609 2:129827501-129827523 CACCAGCACAGCAGTGAAGTAGG + Intergenic
938421922 2:131153280-131153302 CAGCACCACAGGAGGGGAGGAGG - Intronic
939000521 2:136728659-136728681 AAGCAGCATAGGAGTGAAGATGG - Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
940089197 2:149897048-149897070 CAGCAGCACAGGAGGGACTGTGG - Intergenic
940089412 2:149898993-149899015 CAGCAGCACAGGAGGGACTGTGG - Intergenic
940936934 2:159506296-159506318 CAGGATGACAGGAGGGAAACTGG + Intronic
941521356 2:166548255-166548277 AAGCAGCAAAAGAGAGAAGCTGG - Intergenic
941753757 2:169162830-169162852 CAGCAGCACAGGAGACACGGAGG - Intronic
941949877 2:171143763-171143785 CAGCAGTAGAGGAGGGAAAGAGG + Intronic
942181873 2:173387943-173387965 CAGCAGAGCAGAAGGGAGGCTGG + Intergenic
942791821 2:179769491-179769513 CAGCAGCACAGGTAGGAGGCAGG - Exonic
943081796 2:183265281-183265303 CAGCTGCTCGGGAGGGAGGCTGG + Intergenic
943827463 2:192414204-192414226 GAAAAGCACAGGAGGGAGGCCGG + Intergenic
945025687 2:205617737-205617759 CAGCAGGTCAGCAGGGAAACCGG - Intronic
945075164 2:206031581-206031603 GCGCAGCACAGGAGGCAGGCAGG - Intronic
947435316 2:230068021-230068043 CAGCAGCCCACCGGGGAAGCTGG + Intronic
947491926 2:230602754-230602776 CAGCAACACAGACAGGAAGCAGG + Intergenic
948042749 2:234916765-234916787 GACCAACAGAGGAGGGAAGCTGG - Intergenic
948183837 2:236003543-236003565 CAGCAGCGCAGGGGGGCTGCGGG - Intronic
948514376 2:238494503-238494525 GGGCCGCACAGGAGGGAGGCTGG + Intergenic
948610604 2:239163972-239163994 CAGCAGCAATGCAGGGCAGCGGG + Intronic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
948838410 2:240637204-240637226 CTGTAACACAGGAGGGAAACCGG - Intergenic
948878171 2:240841229-240841251 CAGAAGCCCAGCTGGGAAGCTGG - Intergenic
948912644 2:241012085-241012107 CAGCGGCTCAGGAGCCAAGCAGG + Intronic
1169289130 20:4333529-4333551 CAGCAGGAGAGGAGGGACCCAGG - Intergenic
1170798555 20:19571160-19571182 CAGCCTCACAGGTGGGAACCTGG - Intronic
1171299712 20:24049898-24049920 CAGCAGCAGATGAGGGATCCTGG - Intergenic
1172127991 20:32636643-32636665 CAGCAGCACATGGGGGGCGCAGG - Intergenic
1172853497 20:37983525-37983547 CAGCTGCACAGGGTGGAGGCTGG + Exonic
1172974590 20:38896281-38896303 AAGCAGAAAAGGAGGGAAGGAGG - Intronic
1173249750 20:41358204-41358226 CAGAACCACAGCAGGGAAGGGGG - Intronic
1173252295 20:41370358-41370380 CAGAAGCAGAGGAGGAAAGGAGG + Intergenic
1173425216 20:42936688-42936710 CAGCAGCACAGGAGGTGGGTAGG + Intronic
1173449794 20:43152985-43153007 CAACAGCATAAGAGGGAAACAGG - Intronic
1175179225 20:57133460-57133482 AAGCAGCTCAGGTGGGGAGCAGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175516188 20:59571781-59571803 CGGCAGCACTGGGGAGAAGCGGG - Intergenic
1175523730 20:59619306-59619328 TGGAAGCACAGGATGGAAGCGGG + Intronic
1175709320 20:61206453-61206475 CAGAAGAACAGGAAGGAAGGAGG + Intergenic
1175983467 20:62752880-62752902 CAGGAGAACAGGAGGGACGCGGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176151782 20:63595233-63595255 CGCCAGGTCAGGAGGGAAGCGGG + Intronic
1176372750 21:6072286-6072308 CAGCTACTCAGGAGGGAGGCAGG - Intergenic
1176673921 21:9759203-9759225 CAGGAGCACCGGAGGGAGCCTGG - Intergenic
1177593093 21:23198975-23198997 AAGCAGCAAAGGAAGGAAGAAGG - Intergenic
1178882558 21:36460943-36460965 CAGCAGCCCAGGGGAGAAGCAGG + Exonic
1179450689 21:41466553-41466575 AGGCAGGGCAGGAGGGAAGCTGG - Intronic
1179719021 21:43305095-43305117 CAGCAGCCCATGGGGGAAGCAGG - Intergenic
1179750727 21:43465957-43465979 CAGCTACTCAGGAGGGAGGCAGG + Intergenic
1180256141 21:46628976-46628998 CAGCAGCCCAGCACGCAAGCTGG - Intergenic
1180751314 22:18126418-18126440 CATCAGCAGAGAAGTGAAGCCGG - Exonic
1181012841 22:20052508-20052530 CATCAGCACACGTGGCAAGCTGG + Exonic
1181615177 22:24049436-24049458 CAGCAGGAGAGGCGGGCAGCAGG - Intronic
1181622385 22:24099902-24099924 AAGCAGGAAAGGAGGGAGGCAGG + Intronic
1182228443 22:28818293-28818315 CAGCATCAAAGCAGGGAAGTAGG - Intergenic
1184092896 22:42301668-42301690 GAGCAGCAAGGGAGGGAAGGTGG + Intronic
1184844226 22:47071293-47071315 CAGCAGCACAGGCTGTAAGGCGG - Intronic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
1185133245 22:49052434-49052456 CAGCACCACGGGAGGGAGGGCGG + Intergenic
1185172041 22:49299804-49299826 GGGCAGCACAGGAGTGAAGCGGG + Intergenic
1185317093 22:50183947-50183969 CATCCTCACAGGAGGGCAGCGGG - Intergenic
949927757 3:9055548-9055570 CAGCTGCAGGGGAGGGAGGCTGG + Intronic
950201945 3:11050720-11050742 CATCAGGGCATGAGGGAAGCAGG - Intergenic
953621467 3:44536357-44536379 CAGCAGCGAAGGAGTGAAGCAGG - Intergenic
954024601 3:47772730-47772752 CAGCAGCAAAGGAAAAAAGCTGG + Intronic
954043898 3:47912312-47912334 CAGCAGCTCAGGAGGGACCCTGG + Intronic
954197843 3:49006965-49006987 CAGCAGGACAGAAGGACAGCCGG - Exonic
954430292 3:50467218-50467240 CAGCAGCAGTGGAGAGGAGCTGG - Intronic
960118241 3:113919675-113919697 CATCAGGACAGGTGGCAAGCTGG - Intronic
960345272 3:116522647-116522669 CAGAAGCAAGGGAGGGGAGCAGG - Intronic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
961046493 3:123712115-123712137 CAGCAGCACCAGAGAGCAGCAGG - Intronic
961463764 3:127069129-127069151 GAGCAGCCCAGGAGAGGAGCAGG + Intergenic
961580973 3:127882035-127882057 GAGCAGCAGGGAAGGGAAGCTGG - Intergenic
961740879 3:129032606-129032628 GACCAGCCCAGGAGTGAAGCTGG - Intronic
962162881 3:133018195-133018217 CAGCAGCACAGGGTGAAAGATGG + Intergenic
962367768 3:134797167-134797189 CAGCAGTCCCTGAGGGAAGCAGG - Intronic
962372356 3:134831238-134831260 CTGGAGCAGAGGAGGGCAGCTGG + Intronic
962485642 3:135839703-135839725 CAGCATCTCAGGAGGCAACCTGG - Intergenic
963442637 3:145358525-145358547 CTGAAGCCCAGGAGTGAAGCAGG + Intergenic
964636242 3:158860625-158860647 CAGCAGCCAGGGAGGGAAGAGGG - Intergenic
965074015 3:163953604-163953626 GACCAGCATAGGAGGGAGGCTGG - Intergenic
965165677 3:165192902-165192924 AGGAAGCACAGGAGGGAGGCAGG + Intronic
965551147 3:169966634-169966656 CAGCAGGAGCGGAGGGAAGAGGG + Intronic
965705061 3:171497959-171497981 CAGCATCCCAGTAGGGAATCTGG - Intergenic
965776849 3:172240780-172240802 GAGCAGCACAGGATGGGAGATGG - Intronic
965784329 3:172320050-172320072 GAGCAGCTCAGGAAGGCAGCAGG + Intronic
966831446 3:184013365-184013387 CAGCTACTCAGGAGGGAGGCAGG - Intronic
967311457 3:188110264-188110286 CAGCATTACAGGAAGGAAGGAGG + Intergenic
967909389 3:194528547-194528569 CAGCTGCTCGGGAGGGAGGCAGG - Intergenic
968205329 3:196794643-196794665 CAGAGGCAGAGGAGGGAGGCGGG + Intronic
968457362 4:706336-706358 CAGCAGCCCAGGCAGGACGCAGG + Intronic
968549935 4:1216962-1216984 CCGCTACACAGGAAGGAAGCAGG + Intronic
968659609 4:1793633-1793655 CAGCAGCCAGGGAGGGAAGGGGG + Intronic
968947738 4:3674543-3674565 CAGGAGCACAGGAGGGCTGTGGG + Intergenic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969227889 4:5811091-5811113 CAGCACTGCAGGAGGGAAGGTGG - Exonic
969363537 4:6680768-6680790 CAGCAGGACAGATGGGATGCAGG + Intergenic
969831880 4:9804567-9804589 CAGCATCACAGTAGGCAGGCAGG - Intronic
969890281 4:10253808-10253830 CAGCAGCACAGGAGTGGGACTGG - Intergenic
970343472 4:15130705-15130727 CAGGAGCAGAGGAGGAGAGCTGG + Intergenic
973622656 4:52742802-52742824 CAGCTACTCAGGAGGGAGGCAGG + Exonic
974607661 4:64173892-64173914 AAGGAGCACAAGAGGGATGCTGG + Intergenic
975523363 4:75323832-75323854 GAGTAGCCCAGGAAGGAAGCAGG + Intergenic
977124465 4:93147649-93147671 CAGCAGAACAGAAGGGGAGGTGG + Intronic
977798613 4:101198530-101198552 CAGGAGCACAGAAGGGAAGGAGG + Intronic
978375892 4:108075289-108075311 CATGTGAACAGGAGGGAAGCAGG - Intronic
978474725 4:109113196-109113218 CAACAGCACAGGAAGAAAACTGG + Intronic
978557243 4:109993888-109993910 CAGCACCCCAGAAGGGGAGCTGG + Intronic
980884469 4:138747234-138747256 CAGCAGGACAGAGAGGAAGCTGG + Intergenic
981000178 4:139821651-139821673 CAGGAGAACACCAGGGAAGCTGG + Intronic
982030005 4:151291330-151291352 CAAAGGCACAGGAGGGACGCAGG - Exonic
982116625 4:152103748-152103770 CCCCAGCACAGCAGGGAACCCGG + Intergenic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
982750108 4:159150886-159150908 CAGCAGCAAAGCAGAGAAGGAGG - Intronic
983080534 4:163380090-163380112 CAGCTGCTCGGGAGGGAGGCAGG + Intergenic
983382072 4:167008838-167008860 CAGCAAGAAGGGAGGGAAGCAGG + Intronic
983651373 4:170040160-170040182 GAGCAGCACAACAGGGGAGCAGG + Intergenic
983685341 4:170401946-170401968 CAGCTACTCAGGAGGGAGGCAGG - Intergenic
984853357 4:184172537-184172559 GAGCAGGTCAGGATGGAAGCAGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985552505 5:540787-540809 CAGCAGGCCAGGAGGGAGACGGG - Intergenic
985573049 5:660775-660797 CAGCAGCCCAGGATGGGGGCTGG + Exonic
985580934 5:694714-694736 CACCCGAGCAGGAGGGAAGCAGG - Intergenic
985595559 5:786046-786068 CACCCGAGCAGGAGGGAAGCAGG - Intergenic
985970773 5:3376852-3376874 CAGCAGCCACGCAGGGAAGCTGG - Intergenic
986179316 5:5378598-5378620 CACAAGCACAGGAGGGAAGAAGG + Intergenic
986269357 5:6217757-6217779 CCGCAGCATAAGAGGGAAGAAGG - Intergenic
986360750 5:6975776-6975798 CACCAGCTCATGAGGGCAGCTGG + Intergenic
986445222 5:7815421-7815443 CAGCAGCCCAGCAGGCAGGCTGG + Intronic
986583956 5:9295037-9295059 CAGAAGCACTGGAGAGTAGCAGG - Intronic
987355877 5:17062477-17062499 CCGCAGCGCAGGAGCGGAGCGGG - Intergenic
988487341 5:31677878-31677900 CAGCAGCAGAGGAGGAAGGGGGG + Intronic
988527001 5:31995844-31995866 CTGGAGCACAGGAGGAAACCAGG + Intronic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
989797898 5:45498604-45498626 CACCAGCAACGGAAGGAAGCTGG - Intronic
990241840 5:53823815-53823837 CAGCAACCCAGGAGCGAAGTCGG - Intergenic
991379776 5:66007858-66007880 CAGCAGCTAAGGAGGGAGGTGGG + Intronic
991666759 5:69006981-69007003 GAGGGGCACAGGAGGGAAGAAGG + Intergenic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
994692422 5:103034877-103034899 AATGAGCACAGGAGGGAGGCTGG - Intergenic
995281424 5:110339962-110339984 CATCACCACAGGAAGGGAGCAGG - Intronic
996387733 5:122926377-122926399 CTGCAGGGCAGGAGTGAAGCAGG + Intronic
996531643 5:124533548-124533570 CAGCCACTCAGGAGGGAAGAAGG - Intergenic
997670745 5:135669848-135669870 CCTCAGCATAGGAGGGGAGCAGG - Intergenic
998353537 5:141516214-141516236 CCACAGCACAGCAGGGAAACTGG + Exonic
998400078 5:141844135-141844157 CAGCAGAACAGGTGGGAATGAGG - Intergenic
999117100 5:149173685-149173707 TGGCAGTACAGGAGAGAAGCTGG + Intronic
999153116 5:149439999-149440021 AAGGAGCACAGGAAGGAAGGTGG - Intergenic
999255351 5:150206897-150206919 CAGCAGGGCAGCAGGGCAGCGGG - Intronic
999406913 5:151314677-151314699 CAGCAGGACAGAATGGAAGAAGG + Intergenic
999644474 5:153704244-153704266 CAACAGCCCAGAAGTGAAGCTGG - Intronic
1001130315 5:169058303-169058325 AAGCAGCACAGTAAGCAAGCAGG - Intronic
1001311039 5:170611175-170611197 CAGCTGGGCAGGAAGGAAGCAGG + Intronic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001771428 5:174300002-174300024 CAGCAGTAAAGGAGGGCAGCTGG + Intergenic
1001790871 5:174456726-174456748 CAGCTACTCAGGAGGGAGGCAGG + Intergenic
1002121558 5:177008334-177008356 CAGCAGCTGAGGAAGGATGCAGG - Intronic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002453397 5:179331987-179332009 CAGAGGCACAGGTGGAAAGCTGG - Intronic
1002671967 5:180874959-180874981 CAGCCACACAGGAGTGAAGAGGG - Intergenic
1003081480 6:3024989-3025011 CAGCAGCTCAGGAGAGTGGCTGG + Intergenic
1003438939 6:6121937-6121959 GAGGAGCACAGGAGGGAGGCTGG + Intergenic
1003552199 6:7109051-7109073 CACGAGCACAGGAAGGAGGCCGG + Intronic
1003873872 6:10420658-10420680 CAGCAGCCCGGGAGGGTAACTGG - Intergenic
1005494200 6:26374635-26374657 GAGCTGTAGAGGAGGGAAGCTGG + Intronic
1005813199 6:29531498-29531520 CAGCAGCCCTGGAGAGCAGCAGG + Intergenic
1006373770 6:33660458-33660480 AAGCAGCCCAGGAGGTAAGAAGG - Intronic
1006418863 6:33921069-33921091 GAGCAGCCCAGGATGGAAGAAGG + Intergenic
1006669380 6:35720212-35720234 CAGCAGCAGAGCAGGGAGCCAGG + Intronic
1007370598 6:41424586-41424608 AAACAGCACAGAAAGGAAGCAGG - Intergenic
1007470514 6:42087157-42087179 CAAGAGCTCAGGAGGGATGCAGG - Intronic
1007898793 6:45390778-45390800 GAACATCACAGGAGAGAAGCTGG + Intronic
1009588582 6:65637793-65637815 AACAAGCACAGGAGGGAGGCTGG + Intronic
1009739251 6:67723055-67723077 GAGAAGCGCAGGAGGGAACCGGG + Intergenic
1011884383 6:92076049-92076071 CAGCAGCTCTGTGGGGAAGCAGG - Intergenic
1013192975 6:107819497-107819519 CAGAAGCAGAGGAGTGGAGCAGG - Intronic
1014790506 6:125666806-125666828 CAGCAACTCAGGAGAGATGCAGG - Intergenic
1015276274 6:131386171-131386193 TAGCAGAACAGGTGGGGAGCAGG + Intergenic
1015499960 6:133921463-133921485 CAGCTGCAAAGGAGAGATGCTGG + Intergenic
1015744048 6:136490743-136490765 AAGCAGCACAGGTAGGTAGCTGG - Intronic
1016393336 6:143597010-143597032 CAGAAACGCAGGAGGGAAGGAGG - Intronic
1016653720 6:146493655-146493677 AAGCAGTACAGGAGGAAATCAGG - Intergenic
1017065868 6:150528539-150528561 CAGCTACTCAGGAGGGAGGCAGG + Intergenic
1017663423 6:156695787-156695809 CAGAAGAACAAGAGAGAAGCAGG - Intergenic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1019016399 6:168883561-168883583 CAGGGACTCAGGAGGGAAGCTGG + Intergenic
1019155865 6:170038506-170038528 CCCCAGCACAGCTGGGAAGCAGG - Intergenic
1019325899 7:438144-438166 CAGCTGCACGGAAGCGAAGCCGG + Intergenic
1019351741 7:557183-557205 CAGCAGCCAAGGAGGGAAAGAGG + Intronic
1019668198 7:2263319-2263341 GAGCGGCCCAGGAGGGCAGCGGG + Exonic
1019928901 7:4210578-4210600 CAGCATCCTAGGAGGGATGCTGG + Intronic
1019931651 7:4227238-4227260 AAGCAGCACATGAGGGGACCGGG - Intronic
1019994987 7:4718184-4718206 CAGCATCACAGCCGGGAAGTTGG + Intronic
1020016465 7:4834695-4834717 CAGAGGCACAGGAGGAAGGCGGG + Exonic
1020087149 7:5316668-5316690 CCACAGCAAAGGAGGGACGCAGG + Intronic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022048584 7:26643560-26643582 CAGAAGCACAGGTGAGAACCTGG + Intronic
1022391841 7:29950341-29950363 AATGAGCACAGGAGGGAGGCTGG + Intronic
1022423566 7:30246469-30246491 CAGCAGCACCGGAGGAAAGCAGG + Intergenic
1022999496 7:35793408-35793430 CACCAGCCAAGGAGGGAAGGGGG - Intergenic
1023105980 7:36763688-36763710 CAGCAGCAGAGGATGGATGCTGG + Intergenic
1024537601 7:50450770-50450792 CTGCAGCACAGGATGGCGGCTGG - Intronic
1026631188 7:72039651-72039673 CAGCTGCACAGTGGGGAAGGAGG - Intronic
1026896493 7:74012888-74012910 CTGGAGTGCAGGAGGGAAGCTGG + Intergenic
1028167592 7:87556431-87556453 TAGCAGTGCAGGAGGGAAGCTGG - Intronic
1029017281 7:97327518-97327540 CAGCAGGACAGATGGGGAGCTGG - Intergenic
1029367927 7:100128024-100128046 CCGCAGCCCAGGAGCGGAGCCGG + Exonic
1029455276 7:100667300-100667322 CAGCTACTCAGGAGGGAGGCGGG - Intergenic
1030796809 7:113798793-113798815 AAGGAGAACAGGAGGGAAGGAGG + Intergenic
1031080362 7:117251762-117251784 CAGCAGCTCAGCAGGGATGGGGG - Intergenic
1032087904 7:128893313-128893335 CGCCAGCCTAGGAGGGAAGCAGG + Exonic
1032458948 7:132095143-132095165 CAGCTCCACAGAAGGGATGCTGG - Intergenic
1032530862 7:132618543-132618565 AGGCAGAACTGGAGGGAAGCAGG - Intronic
1034441725 7:151089042-151089064 CAGCAGGGCAGCAGGGCAGCAGG - Intronic
1035130638 7:156650182-156650204 CGGCAGCACCGGAAGGAGGCTGG - Intronic
1035392315 7:158513074-158513096 CAGCAGGGAAAGAGGGAAGCGGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1037921599 8:22810204-22810226 CAGCAGCAGCGGAAGGAAGTAGG - Intronic
1038485641 8:27933135-27933157 CTGCAGCCCAAGAGGGCAGCAGG - Intronic
1040468194 8:47714597-47714619 CGCCAGCACAGGCAGGAAGCCGG - Intronic
1040964618 8:53071496-53071518 GAGAAGCACAGGTGGGAACCAGG - Intergenic
1043777080 8:84283456-84283478 CAGCATCACAGGAAGAAAGAGGG - Intronic
1044328961 8:90893710-90893732 CAGCAGTGCAGGAGGCAATCAGG + Intronic
1044927611 8:97222922-97222944 CAGCAGAAAAGAAGGGACGCGGG - Intergenic
1046818793 8:118614649-118614671 CGGCAGCAAGGGAGGGTAGCAGG + Intronic
1047004775 8:120609286-120609308 CATTAACACAGGAGGGAAGGGGG - Intronic
1048260888 8:132944160-132944182 CAGCTTCACAGAAGGGAAGAGGG - Intronic
1048413488 8:134200273-134200295 CAGCTGCTCAGTAGTGAAGCTGG - Intergenic
1048846789 8:138609857-138609879 CTGCAGCCCAGGAGGGAACCAGG - Intronic
1048972979 8:139655532-139655554 CACCATCCCAGGAGGGAGGCAGG + Intronic
1049237487 8:141519339-141519361 CAGCCCCACACGGGGGAAGCAGG - Intergenic
1049300412 8:141866715-141866737 CAGCAGGACAGCAGAGAACCAGG + Intergenic
1049310646 8:141931962-141931984 CAGAACCACAGGAGGGGTGCAGG + Intergenic
1049345612 8:142136973-142136995 CGGAAGCACAGGAAGGAGGCCGG - Intergenic
1049358032 8:142198383-142198405 CAGCCGGACAGGAGAGAGGCAGG - Intergenic
1049449732 8:142654262-142654284 CAGCACCCCAGGAGGGCAGCAGG - Intergenic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049548268 8:143244912-143244934 CTGCAGGACAGGCGTGAAGCTGG + Intergenic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049799059 8:144509401-144509423 CAGCAGCACTGGCAGGAGGCCGG - Exonic
1050651662 9:7783504-7783526 CAGCAACCCAGGAGAGAAGGTGG - Intergenic
1050808856 9:9718807-9718829 AACAAGCACAGGAGGGAGGCTGG + Intronic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056629483 9:88281407-88281429 CAGCAGCGGAGCAGGGATGCGGG - Intergenic
1056759747 9:89406004-89406026 CAGCCACACAGGAAGGAAGCTGG - Intronic
1056790761 9:89623984-89624006 CAGGAACCCAGGAGGGGAGCAGG + Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057179180 9:93020680-93020702 CAGCAGCACAGGAGGCTCTCTGG - Intronic
1057242414 9:93423211-93423233 CAGCAGCAGGATAGGGAAGCTGG + Intergenic
1057641959 9:96833062-96833084 CAGCAGCAGAAGAGAGAAGACGG - Intronic
1057752159 9:97802029-97802051 CAGCTGCAGAGTTGGGAAGCTGG - Intergenic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058760306 9:108124341-108124363 CAGGACCACAGAAGGAAAGCCGG + Intergenic
1058846367 9:108963677-108963699 CATCAGCCCAGTAGGGAGGCTGG - Intronic
1059326342 9:113506167-113506189 CAGCAGTAGGGGAGGCAAGCAGG + Intronic
1060293343 9:122324731-122324753 CTCCAGCACAGGAGAGAATCTGG - Intergenic
1061420743 9:130471865-130471887 CAGCAGCACAGCCTGGGAGCTGG - Intronic
1061454279 9:130686016-130686038 CTGCAAGGCAGGAGGGAAGCTGG - Intergenic
1061594327 9:131619191-131619213 AAGCAGCACAGGAGGCCTGCTGG + Intronic
1062252407 9:135604948-135604970 AAGGAGGAAAGGAGGGAAGCAGG + Intergenic
1062340971 9:136093924-136093946 CTGGAGAACAGGAGGGAAGGAGG + Intronic
1062591663 9:137277324-137277346 CAGCAGCACAGGGGGCGGGCAGG - Intergenic
1062709952 9:137969863-137969885 CAGTAGGGCAGGAGGGAGGCAGG - Intronic
1203781836 EBV:105215-105237 CACTAGCACAGGTGAGAAGCGGG - Intergenic
1187871284 X:23767088-23767110 GAGAAGCACAGGAGAGAGGCTGG - Intergenic
1189364766 X:40380064-40380086 GGGCAGCACAGGAGGGAGGTGGG - Intergenic
1190074924 X:47309969-47309991 CAGCAGCACCAGATGGAACCAGG - Intergenic
1191678473 X:63816324-63816346 CAGCTCCACAGCTGGGAAGCAGG + Intergenic
1191808623 X:65162786-65162808 CACCAGCAAAGGAGCAAAGCTGG - Intergenic
1192399278 X:70818173-70818195 CAGCTACACAGGAGGGAGGTGGG + Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1192436812 X:71148237-71148259 CAGCAGGGCAGGCGGGAGGCAGG - Intronic
1195028633 X:100904550-100904572 CAGCACCAGAGCAGGAAAGCAGG - Intergenic
1197140726 X:123114818-123114840 CTCCAGCACAGGAGAGAATCTGG + Intergenic
1197526847 X:127575050-127575072 CACGAGCTCAGGAGGGAGGCTGG + Intergenic
1197720684 X:129742567-129742589 GAGAAGCACAGAAGGGAAGAGGG + Intronic
1197774237 X:130109748-130109770 CGGCGGCCCAGGAGGGAACCCGG + Intronic
1199211849 X:145221605-145221627 AAGCAGGACAGGAGAAAAGCAGG + Intergenic
1199701587 X:150381513-150381535 GAGCAGATCAGGAGGGAAGTGGG - Intronic
1200064501 X:153497994-153498016 GAGCTGCGCAGGTGGGAAGCTGG - Intronic
1200228498 X:154432414-154432436 GAGCAGCAGAGCAGGGAGGCTGG - Exonic
1200244044 X:154513292-154513314 CCTCAGAACAGGAGGAAAGCAGG - Intronic
1201626734 Y:16023453-16023475 CACCAGCAACGGAAGGAAGCTGG - Intergenic