ID: 929151335

View in Genome Browser
Species Human (GRCh38)
Location 2:38751541-38751563
Sequence CGATCTCTCCAGTAAACCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929151335 Original CRISPR CGATCTCTCCAGTAAACCTG AGG Intronic
903331033 1:22597415-22597437 CGATCTCCCGAGTGAAACTGCGG - Exonic
905381033 1:37561765-37561787 CCATCTCTTCTGTAAACCTCAGG + Intronic
906637289 1:47417615-47417637 GGAACTCACCAGGAAACCTGGGG - Exonic
910917989 1:92312017-92312039 CGATCAGTGCAGCAAACCTGGGG - Intronic
912043326 1:105419367-105419389 CTATCTCTGGTGTAAACCTGAGG - Intergenic
1063385551 10:5614156-5614178 CCATCTCATCAGTAACCCTGTGG + Intergenic
1068799448 10:61123084-61123106 AACTCTCTCCAGTAAACTTGAGG + Intergenic
1074408507 10:113201954-113201976 AGATCTCTCCAGTCAGCTTGTGG - Intergenic
1074669533 10:115773965-115773987 GGACCTCTCCCTTAAACCTGAGG + Intronic
1076887658 10:133269958-133269980 CGTCCTTTCCAGCAAACCTGGGG + Exonic
1080901599 11:36498205-36498227 CTTTATCTGCAGTAAACCTGAGG - Intronic
1085461613 11:76697293-76697315 CATTCTTTCCAGTAAACCTTTGG - Intergenic
1096539108 12:52294181-52294203 TGATGTCCCCAGTAAACCAGCGG + Intronic
1110764514 13:79267605-79267627 AAATCTCTCCAGAGAACCTGTGG + Intergenic
1117149971 14:52876415-52876437 GGATCTCTGGAGTAAACCTAAGG - Intronic
1118017506 14:61675111-61675133 AGATCTCTCCAATAAATCTTTGG - Intergenic
1123765874 15:23477988-23478010 CTATCTCACCAGCACACCTGTGG - Intergenic
1124479971 15:30069830-30069852 CAATCTCTCCAGTTAAACTCTGG + Intergenic
1132007981 15:98248181-98248203 CAATCTCTCTAGCAAAGCTGGGG + Intergenic
1141933869 16:87223257-87223279 AGTTTTCTCCAGCAAACCTGGGG - Intronic
1152420302 17:80189217-80189239 CCCTCTCTCCAGTGCACCTGAGG - Intronic
1162567697 19:11453323-11453345 AGATCTCTGCAGAGAACCTGGGG + Exonic
1164388530 19:27796064-27796086 AGACGTGTCCAGTAAACCTGAGG + Intergenic
926720457 2:15956556-15956578 CCATGCCTCCAGTAAAGCTGGGG - Intergenic
927146496 2:20169617-20169639 CGCCCTCTCCAGGAAACCTGTGG + Intergenic
928497428 2:31848257-31848279 GGATGTCTACAGAAAACCTGTGG - Intergenic
929151335 2:38751541-38751563 CGATCTCTCCAGTAAACCTGAGG + Intronic
942692340 2:178599272-178599294 CCATGTCTCCAGTGAACCTAAGG - Exonic
944659797 2:201911978-201912000 AGAGCTCCCCAATAAACCTGTGG - Intergenic
946741958 2:222811632-222811654 CTATCACTCCAGCAACCCTGAGG + Intergenic
1170242247 20:14180288-14180310 CACTCTCTGCATTAAACCTGTGG - Intronic
1172993297 20:39051363-39051385 TGATTTCTCCAGTCAAGCTGGGG - Intergenic
1175460149 20:59146316-59146338 CGCTCTCTCCCGAAAACCGGTGG - Intergenic
1181033223 22:20158060-20158082 CCATGTCCCCAGTAAACCTCTGG - Intergenic
1183934591 22:41255033-41255055 CTGTCTCTCCATGAAACCTGGGG - Intronic
949229015 3:1728787-1728809 TGATCACTCTAGTAAATCTGGGG + Intergenic
968427741 4:534633-534655 CGTTCCCTCCAGTGAGCCTGAGG + Intronic
968728098 4:2257501-2257523 CGAGCTCTTGAGTAAAGCTGCGG - Intronic
971959979 4:33472771-33472793 CAATCTCTGCATTAAACTTGGGG + Intergenic
972207817 4:36798971-36798993 AGATCTCTTCAGTCAGCCTGTGG - Intergenic
977725056 4:100286907-100286929 CTATTTCTTCAGTAAAACTGGGG - Intergenic
983315099 4:166122066-166122088 AGCTCTCTCCAGTAAGCCTCAGG + Intergenic
986119995 5:4826244-4826266 CGATCTCATCAGTAAGCTTGTGG + Intergenic
997665777 5:135628523-135628545 TGATCTCTCCAGAAGACCTCTGG - Intergenic
1015924607 6:138296420-138296442 TGATCTCATCTGTAAACCTGGGG - Intronic
1018677238 6:166233653-166233675 TGAACTCTTCAGTAACCCTGTGG + Intergenic
1021638440 7:22714369-22714391 CCATCTCTCCAGAAAATCTTAGG + Intergenic
1021998243 7:26201298-26201320 CGAACTCTCCTGTACACCAGGGG - Exonic
1022112887 7:27242212-27242234 CAAGCTCTCCAGTCAACTTGGGG + Intergenic
1035121104 7:156567751-156567773 AGATCTCTCCACCAAACCAGAGG + Intergenic
1036795694 8:11754925-11754947 CAATCTCTCCACAAAGCCTGGGG - Intronic
1038152866 8:24957925-24957947 CAATCCCTCCATGAAACCTGGGG - Intergenic
1044223465 8:89697647-89697669 CGACCTCTCTAGTGAAGCTGGGG + Intergenic
1056815273 9:89796595-89796617 TGAACTCTCCAGAAAACTTGGGG - Intergenic
1185945549 X:4371893-4371915 TAATCTCCCCGGTAAACCTGTGG + Intergenic
1187178199 X:16915978-16916000 AAATCTCTCCAGGTAACCTGGGG - Intergenic
1198536718 X:137593936-137593958 CGCTCTCTCCAGTCACCCTTGGG - Intergenic
1200943049 Y:8805259-8805281 GGTTCTTTCCAGTAAACATGAGG - Intergenic
1201732681 Y:17222042-17222064 TAATCTCCCCAGTAAACCTGTGG + Intergenic