ID: 929151436

View in Genome Browser
Species Human (GRCh38)
Location 2:38752045-38752067
Sequence TCACAATTTCAATATAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 263}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929151436_929151442 6 Left 929151436 2:38752045-38752067 CCCCCTTTATATTGAAATTGTGA 0: 1
1: 0
2: 2
3: 33
4: 263
Right 929151442 2:38752074-38752096 CCTGAATGTTTAAAGCATTTTGG 0: 1
1: 0
2: 1
3: 17
4: 240
929151436_929151443 21 Left 929151436 2:38752045-38752067 CCCCCTTTATATTGAAATTGTGA 0: 1
1: 0
2: 2
3: 33
4: 263
Right 929151443 2:38752089-38752111 CATTTTGGCCAGTGACAATTTGG 0: 1
1: 0
2: 1
3: 12
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929151436 Original CRISPR TCACAATTTCAATATAAAGG GGG (reversed) Intronic
900005907 1:51244-51266 TGACAATTTGAATATGAAGTTGG - Intergenic
901748533 1:11390884-11390906 TCAAAATCTCAAAATAAAAGAGG - Intergenic
903398566 1:23021316-23021338 TTACGATTTCAATAGACAGGTGG + Intronic
907147913 1:52253307-52253329 TCACATTTTCAATATATAAATGG + Intronic
907177227 1:52536223-52536245 TGACAATAAAAATATAAAGGAGG + Intronic
908956649 1:69638127-69638149 TCTCAATTTTAATATAAAGATGG + Intronic
909801633 1:79817222-79817244 TCATAATTGCATTAGAAAGGAGG + Intergenic
910504483 1:87934389-87934411 TCATAAATCCAATAAAAAGGGGG + Intergenic
910660822 1:89670755-89670777 TCACAATCTAAATTTAAAGATGG - Intronic
910937791 1:92500066-92500088 ACAAAATTTCAATAAACAGGAGG - Intergenic
914247039 1:145893917-145893939 TCTAAACTTCAATCTAAAGGAGG - Intronic
915465968 1:156098092-156098114 ACACAATTTCAGTACAAAAGGGG + Intronic
917173710 1:172207238-172207260 TCACAATGTCAATATAACACTGG - Intronic
918674694 1:187268549-187268571 TCAAAATTAAAATATAAAGAAGG + Intergenic
918908005 1:190524618-190524640 TCACACTGTCAATATACTGGCGG + Intergenic
919536536 1:198795137-198795159 TCACTCTTTCTATATAAAGTGGG - Intergenic
919600119 1:199611897-199611919 TCAAAATTTCAATGTAAACCAGG - Intergenic
921194899 1:212746256-212746278 TGACAATGACAACATAAAGGGGG + Intronic
922438647 1:225632125-225632147 TAACATTCTCAAAATAAAGGAGG - Intronic
922998672 1:229987524-229987546 TCACAGTGTCATGATAAAGGTGG + Intergenic
923987752 1:239400846-239400868 TAACAATTTCTATTTAAAGAGGG - Intronic
924086250 1:240454838-240454860 TGGCAAATTCAAGATAAAGGTGG + Intronic
924108427 1:240673134-240673156 TCATCATTTCAAAATAATGGGGG + Intergenic
924372412 1:243365741-243365763 TCACAATTTCCAAAGAAAGCTGG - Intronic
924920460 1:248623829-248623851 TCATAAATTCAATGCAAAGGAGG + Intergenic
1062781536 10:214798-214820 TCACATTTTAAGAATAAAGGTGG - Intronic
1063002832 10:1940651-1940673 TCATAATTTCCACAGAAAGGTGG + Intergenic
1063294110 10:4784630-4784652 TCAAAATTTCAATTTGAAAGGGG + Intergenic
1064951496 10:20855983-20856005 TCACAAATGCTAGATAAAGGAGG + Intronic
1065382747 10:25106267-25106289 TCACCATTGCAATCTAGAGGTGG - Intergenic
1067264343 10:44724243-44724265 ACACAAATACAATATAAACGTGG + Intergenic
1068596798 10:58910790-58910812 TCAGAACTTCATTATAAAAGTGG + Intergenic
1068738044 10:60437132-60437154 TCACAATTACTATTTAAATGTGG + Intronic
1068847692 10:61697901-61697923 TTAAAATTTCAATATAAACTAGG + Intronic
1068906569 10:62332154-62332176 TAACAATAACAATATAAAAGGGG - Intergenic
1069393787 10:67966003-67966025 TCAGATTTTTAATATAAATGTGG - Intronic
1070214367 10:74361527-74361549 TCAGAAATTCAAAATGAAGGGGG - Intronic
1070520330 10:77247284-77247306 TCAGAATTTCAAGAGAAAGTTGG - Intronic
1073705913 10:105984188-105984210 ACACATTTTGAATATAAAAGAGG - Intergenic
1078562219 11:12382830-12382852 TCACAACTTCCATGTAAAGAAGG - Intronic
1078710141 11:13783426-13783448 CCATAATTTGATTATAAAGGTGG + Intergenic
1080268142 11:30422927-30422949 TTACAATTTCAAGAGCAAGGGGG - Intronic
1080601579 11:33825984-33826006 CCACAATTTCAAAATAAAGAAGG - Intergenic
1081980719 11:47264927-47264949 TCTTAATTTCTCTATAAAGGGGG + Intronic
1082691442 11:56308932-56308954 TTAAAATATCAATATAGAGGGGG - Intergenic
1087301583 11:96442524-96442546 TCACAATTACAATATCCAAGAGG + Intronic
1087753497 11:102030528-102030550 ACACAATTTCAAAATAAAGAAGG + Intergenic
1088055162 11:105566263-105566285 TTAAAATTTCAATGTAAAGAAGG + Intergenic
1088925708 11:114299378-114299400 TCACATTTTCAGAATACAGGAGG - Intronic
1089839506 11:121402903-121402925 TGACAATAACAACATAAAGGAGG - Intergenic
1089883655 11:121798618-121798640 TAACAATTTCAATAAACTGGTGG + Intergenic
1090199699 11:124845528-124845550 TCACGCTTTCAATGTAAATGGGG - Intergenic
1093420895 12:18973455-18973477 CCACAATTTCCATATTTAGGTGG + Intergenic
1093546589 12:20355978-20356000 TCACACTTTCTCAATAAAGGAGG + Intergenic
1093566266 12:20607564-20607586 CCACATTTTCTATTTAAAGGTGG + Intronic
1094135963 12:27126547-27126569 TCCCATGTTCAATATGAAGGGGG - Intergenic
1094185510 12:27638294-27638316 TCCCATGTTCAATATGAAGGGGG - Intronic
1095148359 12:38759291-38759313 TCACAATTAAAATATAAAATAGG + Intronic
1096537060 12:52281689-52281711 TCACAATTTAGATCTAGAGGAGG - Intronic
1097827540 12:64189441-64189463 TCTAACTTCCAATATAAAGGGGG + Intronic
1098443581 12:70543520-70543542 TCCCAATTTCAAGCTAAAGGGGG - Intronic
1098716284 12:73831129-73831151 TCACAATTACAATACAAACTAGG + Intergenic
1098727455 12:73986252-73986274 TGACAATGACAATATAAAGGAGG - Intergenic
1099098947 12:78412376-78412398 ACACAAGTGCAATATCAAGGAGG + Intergenic
1099632574 12:85168751-85168773 TCACAATTACAATACAAAATAGG - Intronic
1099960076 12:89388400-89388422 TTACATTTTCAATATAAAAGTGG + Intergenic
1100442068 12:94626513-94626535 TCACTATTTCAACAGAAAGCAGG - Intronic
1100462420 12:94814030-94814052 TGGCAATAACAATATAAAGGAGG + Intergenic
1101457252 12:104847223-104847245 TGACTATATCAATATCAAGGGGG + Intronic
1101483935 12:105131920-105131942 TCAAGATTTCAATCTAAAGAAGG - Intronic
1102263529 12:111461158-111461180 TCCCAATTTCAAATTCAAGGAGG - Intronic
1104329414 12:127830434-127830456 TCACAATTTCATTATATAATTGG + Intergenic
1105001165 12:132689677-132689699 TAAAAATTTCCATAAAAAGGTGG - Intronic
1106705672 13:32276689-32276711 TTACAATTCCAATTTAATGGTGG + Intronic
1108559089 13:51625626-51625648 TCAGAAATTCGATACAAAGGTGG + Intronic
1108990070 13:56644155-56644177 ACACAATTTCAATAGAGGGGTGG + Intergenic
1110591991 13:77274201-77274223 TCTCAATTTCATTATTAAAGGGG - Intronic
1111078379 13:83268725-83268747 TCACATTCTCATTTTAAAGGTGG - Intergenic
1111459937 13:88525929-88525951 GCACAGTTTCATTATAAAGGTGG - Intergenic
1111482772 13:88853316-88853338 ACATAAATTCAATAAAAAGGTGG + Intergenic
1111647375 13:91047762-91047784 TGATAATTTCAATGTAAAGAAGG + Intergenic
1113424659 13:110198258-110198280 TTAAAATTTCAAAATAAAGCTGG - Intronic
1114057013 14:18979030-18979052 TCACAATTTCAATATTTGGGTGG - Intronic
1114105533 14:19422716-19422738 TCACAATTTCAATATTTGGGTGG + Intronic
1116621943 14:47216217-47216239 TAACAAGTTAAATATAAAGCGGG - Intronic
1118070637 14:62243488-62243510 TAGTAATTTCAATTTAAAGGGGG - Intergenic
1118742608 14:68751268-68751290 TGTCAATTTCAAAATAAAGGTGG + Intergenic
1124546889 15:30637154-30637176 TGACATTTTCAAGATAACGGTGG - Intronic
1124780491 15:32627150-32627172 TGACATTTTCAAGATAACGGTGG - Intronic
1124949436 15:34303046-34303068 TCACATTTTCATTTTAAAGATGG + Intronic
1126207652 15:46063327-46063349 TAACAATTTCACAATAAAGTAGG - Intergenic
1127406696 15:58656045-58656067 TCACTATATAATTATAAAGGGGG - Intronic
1128833130 15:70787341-70787363 TGACAAGTTCAAGAAAAAGGAGG + Intergenic
1130359940 15:83174055-83174077 TCACAATTTAAATCAAAAGTAGG - Intronic
1132447607 15:101939679-101939701 TGACAATTTGAATATGAAGTTGG + Intergenic
1132645639 16:998114-998136 TCACAGATTTAAAATAAAGGAGG - Intergenic
1135223870 16:20638629-20638651 TTATAATTTCCATTTAAAGGTGG + Intronic
1135932433 16:26749779-26749801 CAACATTTTCAATCTAAAGGTGG + Intergenic
1137315684 16:47319674-47319696 TCACAATTTTAAAATGAAGGAGG - Intronic
1139213510 16:65104748-65104770 TCACAACAGCAATATAAATGGGG - Intronic
1139286807 16:65822613-65822635 CCAAAATTTCAATATCATGGAGG - Intergenic
1148172069 17:45529969-45529991 TGACAATAACAGTATAAAGGAGG + Intergenic
1148277215 17:46315825-46315847 TGACAATAACAGTATAAAGGAGG - Intronic
1148299331 17:46533401-46533423 TGACAATAACAGTATAAAGGAGG - Intronic
1148363949 17:47038599-47038621 TGACAATAACAGTATAAAGGAGG - Intronic
1150403181 17:64875882-64875904 TGACAATAACAGTATAAAGGAGG + Intronic
1154967643 18:21375755-21375777 TCACATTTTCAAGATAACTGAGG - Intronic
1156127811 18:33928362-33928384 TCAAATTTTCCATATAAATGTGG + Intronic
1156580363 18:38368038-38368060 GCAGAATTTCAATAGAAATGGGG + Intergenic
1158435078 18:57429846-57429868 TCACATTTTCTCTTTAAAGGAGG - Intergenic
1158965156 18:62616244-62616266 TGACAAATTCAAGATAAATGAGG + Intergenic
1160637664 19:92850-92872 TGACAATTTGAATATGAAGTTGG - Intergenic
1165604269 19:37086829-37086851 GCACATTTTAAATATAAAGATGG - Intronic
1168008078 19:53507345-53507367 TCAAAATTGGAATATCAAGGTGG - Intergenic
926420863 2:12697024-12697046 TCAGATATTCAATATAAAGAAGG + Intergenic
928074998 2:28256233-28256255 TCACTATTTCAAAATTATGGTGG - Intronic
928967634 2:36993024-36993046 TCACAATTTAAAAATAAAATGGG - Intronic
929151436 2:38752045-38752067 TCACAATTTCAATATAAAGGGGG - Intronic
929375976 2:41287583-41287605 TAACAATTTCAATGTAGAAGAGG - Intergenic
930556303 2:52899900-52899922 TCACTAATTGAATATAATGGAGG + Intergenic
931168504 2:59777172-59777194 TCTTAACTTCAAAATAAAGGTGG + Intergenic
933289631 2:80423855-80423877 TCCCAATAGCAATAAAAAGGTGG + Intronic
934947416 2:98551777-98551799 TCACAATTTCAAATTTTAGGAGG + Intronic
935564122 2:104588934-104588956 TCACAATTTCAATGTCAACTAGG - Intergenic
938285290 2:130109103-130109125 TCACAATTTCAATATTTGGGTGG + Intronic
938335940 2:130497644-130497666 TCACAATTTCAATATTTGGGTGG + Intronic
938353884 2:130623021-130623043 TCACAATTTCAATATTTGGGTGG - Intronic
938430309 2:131229790-131229812 TCACAATTTCAATATTTGGGTGG - Intronic
938475125 2:131602973-131602995 TCACAATTTCAATATTTGGGTGG - Intergenic
939410440 2:141817879-141817901 TTACAAATTAAATGTAAAGGAGG + Intronic
939841612 2:147196025-147196047 TCTCAAGTTCAATATTATGGGGG + Intergenic
940552499 2:155178861-155178883 TCACAATTTCAACATATATAAGG + Intergenic
940584492 2:155628320-155628342 TAACATTTTCATTATTAAGGTGG + Intergenic
940655911 2:156487619-156487641 TCACACTTTCCATAGAAAGGAGG - Intronic
941561669 2:167054170-167054192 TCACAATTTCAACTTAAAAATGG + Intronic
941746285 2:169090161-169090183 TCACAATTTCTATATATAGGAGG + Intronic
942666530 2:178325178-178325200 TCAGAATTTCTCAATAAAGGAGG - Intronic
943393971 2:187308903-187308925 TCACAATGACATTATAAAGTGGG - Intergenic
944822332 2:203443352-203443374 TCACCATTTCAATATGCAAGAGG - Exonic
946064057 2:216971007-216971029 TCACAATTTCCATTAAAAGGTGG - Intergenic
946536441 2:220634949-220634971 TCACAATAGCACTATAAAGTAGG - Intergenic
947061749 2:226174484-226174506 CCACAATTCAAATTTAAAGGAGG + Intergenic
947252669 2:228125311-228125333 ACAGAAATTCAATATAATGGAGG + Intronic
947514797 2:230793471-230793493 TCACAAGTTGAATTTCAAGGAGG - Intronic
947778634 2:232736749-232736771 TTACAAATTCTAGATAAAGGCGG - Intronic
947778675 2:232737250-232737272 TCAGAGTATCAATAAAAAGGAGG - Intronic
948069576 2:235109429-235109451 TACCAATGTCAAAATAAAGGGGG + Intergenic
1169531077 20:6485847-6485869 TCACAATTTGGAGATAAAGAAGG + Intergenic
1169573252 20:6929506-6929528 TCAAAATTTCCTTATATAGGTGG - Intergenic
1169582987 20:7046397-7046419 TCACAATGGGAACATAAAGGAGG + Intergenic
1172218629 20:33255450-33255472 CAACAATTTAAATCTAAAGGAGG + Intergenic
1173160661 20:40649832-40649854 ATACAACTTCATTATAAAGGTGG - Intergenic
1175294746 20:57900528-57900550 CCAAAATCTCCATATAAAGGTGG - Intergenic
1177322574 21:19542334-19542356 TAACATTTTCAATACAAAGTTGG + Intergenic
1177752324 21:25299967-25299989 ACACAATTTCAAAATGAAGCAGG + Intergenic
1177818306 21:26002365-26002387 CCACAATGTCAATACAAATGGGG - Intronic
1180475500 22:15701642-15701664 TCACAATTTCAATATTTGGGTGG - Intronic
1181296552 22:21844622-21844644 TCACAATTTCCTTTTTAAGGTGG - Intronic
949309506 3:2680758-2680780 TGAAAATCTCAATATAAAGTTGG + Intronic
950072231 3:10161919-10161941 TCCCACTTTCAACATCAAGGAGG + Intergenic
950938711 3:16871498-16871520 AGACATTTTAAATATAAAGGAGG - Intronic
950978480 3:17276114-17276136 TCACAATTCCAGGATAAAGGTGG + Intronic
952055540 3:29440573-29440595 TCAGAGTTTCATTTTAAAGGGGG - Intronic
952402453 3:32975553-32975575 TCAAAATTTCTATACAAAGATGG + Intergenic
952965194 3:38616796-38616818 TCACCATCTCAAGATAAGGGAGG - Intronic
953000599 3:38929564-38929586 TCACAATTTTAATAAAAACTGGG + Intronic
954509642 3:51111866-51111888 AAACAACTTCAATATAAAGTAGG + Intronic
955129023 3:56145243-56145265 TTACAAATTCAGAATAAAGGAGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956372413 3:68577643-68577665 TCAAAAATTCAAAATATAGGGGG - Intergenic
957218305 3:77349812-77349834 TCACGATTGCAATATAAAGTGGG - Intronic
957353923 3:79058096-79058118 CCACACTTTCAATATAAACCTGG + Intronic
957397796 3:79665647-79665669 TAAAAATTTCAATAGAAATGTGG + Intronic
957579847 3:82057674-82057696 TAACAATTTCAATAAAGAAGTGG + Intergenic
957619913 3:82583047-82583069 TCACAAGTTCAATATAAAATAGG - Intergenic
957936786 3:86954654-86954676 TCAAAATTTGAATGTCAAGGTGG + Intronic
960447948 3:117770755-117770777 TCACAATTTCCCCATTAAGGTGG + Intergenic
963475806 3:145802289-145802311 TCAAAATGTCAATATAAAACTGG + Intergenic
963798266 3:149652946-149652968 TAACAAATCCAATATACAGGAGG - Intronic
964169923 3:153757815-153757837 GCAAAATTGCAAAATAAAGGTGG - Intergenic
964621085 3:158720749-158720771 CCACCATTTAAAGATAAAGGCGG - Intronic
965902322 3:173657459-173657481 TCACAATAACAAAACAAAGGGGG - Intronic
967336215 3:188347600-188347622 TCTCAAGCTCAATATAATGGGGG - Intronic
971702604 4:29997971-29997993 TCAGAATTTCAATATTAAAGAGG - Intergenic
973047756 4:45555780-45555802 CCATAGTCTCAATATAAAGGTGG - Intergenic
974163081 4:58165636-58165658 TCCCAAATTCAATATAGAAGGGG - Intergenic
975432257 4:74307338-74307360 TCACTATTCAAATATAAATGTGG - Intergenic
978593987 4:110356862-110356884 TGACATTTTCAATTTAAAGGTGG - Intergenic
979106190 4:116690174-116690196 TGACAATTACAACACAAAGGAGG + Intergenic
979580183 4:122349249-122349271 TCACAATTAGATTCTAAAGGAGG + Exonic
980212408 4:129806797-129806819 TCACAGATTTAATATAAATGAGG + Intergenic
980474372 4:133292750-133292772 TCACAACTACTATATTAAGGTGG - Intergenic
981611262 4:146596368-146596390 TCATTATATCAATATAAAGGAGG - Intergenic
983542533 4:168928306-168928328 TTATAAATACAATATAAAGGTGG - Intronic
986258355 5:6120913-6120935 TCACAACTTCAAATTAAAGAGGG + Intergenic
986665957 5:10104327-10104349 TTAAAAGTTAAATATAAAGGTGG - Intergenic
987197189 5:15538211-15538233 TCACAATTTCAATGTGTAGCTGG - Intronic
988319451 5:29673801-29673823 TGACAATAACAGTATAAAGGAGG - Intergenic
989619991 5:43374917-43374939 TCACTATTTCAATCTAAATTGGG - Intergenic
989760899 5:45015022-45015044 TCACACTTACAAAATACAGGGGG + Intergenic
991499366 5:67261428-67261450 TCACAATTTAACAAAAAAGGAGG - Intergenic
992809724 5:80374575-80374597 TAACAATTTAAATTTACAGGTGG + Intergenic
992862786 5:80929038-80929060 CCAAAATTTCAGCATAAAGGGGG + Intergenic
993572885 5:89564427-89564449 GAACAATTTCAATGTAAAAGAGG - Intergenic
994043077 5:95279870-95279892 TCTCACTTTCAATATGAAAGGGG + Intronic
994435576 5:99727012-99727034 CCACAAATTCAATAGAAAGAAGG - Intergenic
994554649 5:101283147-101283169 TGACAATTTTAATATAAATATGG + Intergenic
994839213 5:104899960-104899982 TCAAAATTTACATATAAAGTGGG - Intergenic
997044473 5:130297675-130297697 TGAAAAATTCAATATAAATGTGG + Intergenic
998587369 5:143441298-143441320 ATATAATTTCAATATAAAGTGGG + Intergenic
1000761214 5:165226999-165227021 TCACAATTTCTATAAAAAAGAGG - Intergenic
1001455276 5:171855377-171855399 TCACAGTTTCATTCTAAAGCAGG - Intergenic
1002699938 5:181116316-181116338 GCACAATTTCAATACATAGGTGG + Intergenic
1004957124 6:20740147-20740169 TAACAATTTAAATAGACAGGTGG - Intronic
1007695451 6:43729872-43729894 TAACAATAATAATATAAAGGGGG + Intergenic
1008246524 6:49181410-49181432 TTACAAATTCCTTATAAAGGTGG + Intergenic
1008367788 6:50703240-50703262 TCACAATTTCTCTGTAAAGAAGG + Intergenic
1009226522 6:61024920-61024942 TCTCAATATCAATATCAAAGGGG + Intergenic
1010327122 6:74577463-74577485 TGACTGTGTCAATATAAAGGTGG + Intergenic
1010397540 6:75409290-75409312 TCACATTTGTAATATAAAGGAGG + Intronic
1011108486 6:83810341-83810363 TGACAATATCAATAAAAAGTTGG - Intergenic
1011138363 6:84124746-84124768 TCACATTATCAATAAAAATGTGG + Exonic
1011334578 6:86246063-86246085 ACACAAGTTCAAAGTAAAGGAGG - Intergenic
1011544758 6:88470953-88470975 TCACAATTACAATATCAGGTAGG - Intergenic
1011609592 6:89137942-89137964 TCACATTTTCAATATAATTTTGG + Intergenic
1011959996 6:93076217-93076239 TCACAATGTCTGTATAGAGGAGG - Intergenic
1014350426 6:120336222-120336244 ACAGAATTTCAAAATAAATGAGG + Intergenic
1014365100 6:120530419-120530441 TTAAAATTTGAATATAAATGAGG + Intergenic
1016099869 6:140085898-140085920 TCACATTTTCAAAAGCAAGGGGG - Intergenic
1016697793 6:147017995-147018017 CCACAAGTTCAAAATCAAGGTGG + Intergenic
1020985282 7:15126266-15126288 TAACATTTTAAATATAAATGAGG + Intergenic
1021218558 7:17947520-17947542 TCTCATTTTAAATAGAAAGGTGG - Intergenic
1025749188 7:64277412-64277434 TTACAATTTTATTTTAAAGGTGG - Intergenic
1026789394 7:73321947-73321969 TCAAAATCTCAATAAACAGGAGG + Intronic
1028694090 7:93688358-93688380 TCACAACTTAACTATTAAGGAGG - Intronic
1028704909 7:93830546-93830568 TCACAATGTGAATATAAAAATGG + Intronic
1028789800 7:94841243-94841265 AAACAATATAAATATAAAGGGGG - Intergenic
1029497333 7:100903031-100903053 TAAAAATTTAAAAATAAAGGAGG - Intergenic
1030297834 7:107946731-107946753 TCACAATGGAAATATTAAGGTGG + Intronic
1030591839 7:111491490-111491512 TCACAATTTTAATTTTAAGCAGG + Intronic
1032327935 7:130949760-130949782 TGGCAATTACAATGTAAAGGAGG + Intergenic
1032504076 7:132422785-132422807 TCATAATATCCCTATAAAGGGGG + Intronic
1032925228 7:136596826-136596848 TCATATTTTAAGTATAAAGGAGG - Intergenic
1032965177 7:137088417-137088439 TAAAAAGATCAATATAAAGGAGG + Intergenic
1033753437 7:144377927-144377949 TCACAAGGTCAAAATGAAGGAGG - Intronic
1033867162 7:145705048-145705070 TCATAATTTCAAGATGAAAGTGG + Intergenic
1036193088 8:6689106-6689128 TTACAATTTCAATATTTTGGGGG + Intergenic
1038060126 8:23903367-23903389 TCACATTTTAAATATATATGGGG - Intergenic
1038190940 8:25319757-25319779 TAAAAATTTCAAAATAAAGTAGG - Intronic
1039354200 8:36797175-36797197 ACATAATATGAATATAAAGGAGG + Intronic
1040082623 8:43303559-43303581 TCACAATTTCAATATTTAGGTGG - Intergenic
1040408362 8:47131682-47131704 TCACAATTTCAATATTTAGATGG + Intergenic
1040744400 8:50622618-50622640 TCACAATTTCAACAGAAATATGG - Intronic
1040754136 8:50750095-50750117 TCAAAATATCAATATAAATAGGG + Intronic
1041037812 8:53813169-53813191 TCACAAACTCAATAAAATGGTGG + Intronic
1042009484 8:64225121-64225143 TCATAACTTCAATATACTGGAGG - Intergenic
1042832089 8:73041667-73041689 TCCCCATTTCAAAATAAATGAGG - Intronic
1043094444 8:75948721-75948743 TTAGAATTTCAAAATAATGGGGG + Intergenic
1043281416 8:78471277-78471299 TCAAATTTTCAATTTAAAGGAGG - Intergenic
1043707433 8:83369666-83369688 TGAAAATTAAAATATAAAGGTGG + Intergenic
1043792210 8:84485405-84485427 TCACATTTTTAATAGAAATGGGG - Intronic
1044054451 8:87551167-87551189 CCACAATTTCAAAACTAAGGTGG + Intronic
1047048989 8:121088476-121088498 ACACAACTTGAATGTAAAGGTGG + Intergenic
1047664065 8:127070626-127070648 TCAAAATTTCAATATTAACAGGG + Intergenic
1048415464 8:134223558-134223580 TCACAATTTCTACATAAATGTGG + Intergenic
1048727842 8:137407211-137407233 TGAAAATTTTAATATAAATGGGG + Intergenic
1049895237 9:106429-106451 TAATAATTTCAATATAACAGGGG + Intergenic
1050951111 9:11595551-11595573 TCACAACTTCAACATAATGTTGG - Intergenic
1051055451 9:12979610-12979632 TTAAAATTCCAATATAAAGGTGG + Intergenic
1052191312 9:25666231-25666253 TCACCATTTAACTTTAAAGGAGG - Intergenic
1053023427 9:34711099-34711121 TGACAATAACAATATAAAGAAGG - Intergenic
1053360412 9:37482683-37482705 CCACGATTTGAATATAAAAGAGG + Intergenic
1053738405 9:41116529-41116551 TAATAATTTCAATATAACAGGGG + Intergenic
1053850083 9:42281439-42281461 TCTCATGTTCAAGATAAAGGAGG + Intergenic
1054689945 9:68314786-68314808 TAATAATTTCAATATAACAGGGG - Intergenic
1056347373 9:85711820-85711842 TCACCATTTTAATAGAAAAGTGG + Intronic
1057019039 9:91681531-91681553 TCACAATATCCTTATGAAGGAGG - Intronic
1058849114 9:108993333-108993355 TGACATCTTCAATATAATGGGGG + Intronic
1059056756 9:110990977-110990999 TCACAATTTTAAAATCATGGTGG + Intronic
1059767154 9:117394470-117394492 TCAATATATCAATATAAGGGAGG + Intronic
1060371409 9:123076150-123076172 TCACAATTTCTTTAAAAATGTGG + Intronic
1060473482 9:123968034-123968056 TCACAATTTTTTTAAAAAGGGGG - Intergenic
1185753350 X:2632045-2632067 TCACAATTTCCCTATAAACCGGG - Intergenic
1187655353 X:21465230-21465252 TCACAATTTCATTAAGTAGGAGG - Intronic
1188223499 X:27569225-27569247 TCTCATTTTTAATATAAAAGAGG - Intergenic
1189027367 X:37410006-37410028 ACAAAATTTAAATATTAAGGTGG + Intronic
1189350573 X:40272743-40272765 TCACAACTTAAAATTAAAGGGGG - Intergenic
1189967127 X:46386462-46386484 TCAGGATTTCAATAAAAAAGTGG - Intergenic
1190955852 X:55192686-55192708 ACACAATTTCATGAAAAAGGGGG + Intronic
1191614621 X:63155755-63155777 TCACAATTTCTACACAAAGACGG + Intergenic
1191621675 X:63223171-63223193 TCACAATTTCTACACAAAGACGG - Intergenic
1193118974 X:77803615-77803637 TGACAATAACAATATAAAGGGGG - Intergenic
1195123081 X:101776144-101776166 TCAAAAACTCAATAGAAAGGAGG - Intergenic
1195281273 X:103336263-103336285 TAACAATAACAACATAAAGGGGG + Intergenic
1195505943 X:105657467-105657489 TCACAATATCAAGATACAGATGG - Intronic
1195658910 X:107359596-107359618 TCATAATGTCTATATAAATGGGG - Intergenic
1196063614 X:111438347-111438369 TGACAATAACAACATAAAGGGGG - Intergenic
1196425742 X:115567210-115567232 TCATAATTGCAGTCTAAAGGAGG + Intronic
1197552835 X:127916136-127916158 TTACAATTTTAATAGAGAGGGGG + Intergenic