ID: 929152738

View in Genome Browser
Species Human (GRCh38)
Location 2:38762013-38762035
Sequence AAGAGTCTCTTGAACTCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80713
Summary {0: 2, 1: 20, 2: 673, 3: 10458, 4: 69560}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929152738_929152741 2 Left 929152738 2:38762013-38762035 CCTCCCGAGTTCAAGAGACTCTT 0: 2
1: 20
2: 673
3: 10458
4: 69560
Right 929152741 2:38762038-38762060 TCCTCAGCCTCCCGAGTAGCTGG 0: 1155
1: 106565
2: 292599
3: 226741
4: 125901
929152738_929152748 30 Left 929152738 2:38762013-38762035 CCTCCCGAGTTCAAGAGACTCTT 0: 2
1: 20
2: 673
3: 10458
4: 69560
Right 929152748 2:38762066-38762088 CAGGCACCCGCCACCATGCCTGG 0: 2501
1: 16051
2: 50860
3: 101743
4: 137494
929152738_929152743 3 Left 929152738 2:38762013-38762035 CCTCCCGAGTTCAAGAGACTCTT 0: 2
1: 20
2: 673
3: 10458
4: 69560
Right 929152743 2:38762039-38762061 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
929152738_929152745 11 Left 929152738 2:38762013-38762035 CCTCCCGAGTTCAAGAGACTCTT 0: 2
1: 20
2: 673
3: 10458
4: 69560
Right 929152745 2:38762047-38762069 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929152738 Original CRISPR AAGAGTCTCTTGAACTCGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr