ID: 929153253

View in Genome Browser
Species Human (GRCh38)
Location 2:38767329-38767351
Sequence ACTACATTGTTCTGCAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929153253 Original CRISPR ACTACATTGTTCTGCAGTGG AGG Intronic
904397176 1:30229795-30229817 ACAGCATTGATCAGCAGTGGTGG - Intergenic
909029880 1:70527105-70527127 AATACATTGCTCTGCACTTGAGG + Intergenic
911137659 1:94458623-94458645 ACCTCATTGTTCTGTAATGGTGG - Exonic
915837031 1:159185411-159185433 AATACATGCTTCTGCAGAGGGGG + Intronic
915955374 1:160216349-160216371 ACCACAATAGTCTGCAGTGGTGG + Exonic
918681671 1:187362809-187362831 ACTACATCTTTCTCCAGTGCTGG + Intergenic
920020191 1:202949886-202949908 ACTATATTCAGCTGCAGTGGAGG - Intronic
1063564619 10:7162033-7162055 ACTACAGTGTTCCGCTGTGGTGG - Exonic
1065149311 10:22805966-22805988 ACTGCAATGTTCTGCTCTGGAGG - Intergenic
1065168740 10:23007161-23007183 AGTGCATTGATTTGCAGTGGTGG - Intronic
1068277686 10:54823725-54823747 ACTTCATTTTTCTGCAATGAAGG + Intronic
1069973580 10:72194587-72194609 AATACATTTTTCTGCACTAGTGG - Intronic
1076801317 10:132831252-132831274 TGTACATTCTTCTGCCGTGGGGG + Intronic
1078347894 11:10567252-10567274 ACTACTTTATTCTGCAGTCATGG + Intronic
1078764542 11:14281878-14281900 TCTGCATTGTTCTGCAGAGGTGG - Intronic
1079163873 11:18018708-18018730 ATTCCATTGTTCTGAAGTTGTGG + Exonic
1079315316 11:19403277-19403299 AATACACTTTTCTGGAGTGGAGG + Intronic
1079619038 11:22530591-22530613 ACTATAATGTTCTACAGTGAAGG - Intergenic
1081378623 11:42388487-42388509 CCTACATCTTTCTGCCGTGGTGG + Intergenic
1085770351 11:79320007-79320029 CCTACCTTCTACTGCAGTGGAGG + Intronic
1085900976 11:80699566-80699588 ACAACAGTGCTCAGCAGTGGTGG + Intergenic
1089826622 11:121283702-121283724 GCTTCATTGCTCTGCAGTGTTGG + Intergenic
1100011852 12:89962951-89962973 ATTCCATTGTTCTCCAGTAGAGG - Intergenic
1102704453 12:114869155-114869177 AATACATTGTTTTGCAGGGATGG - Intergenic
1112100343 13:96181867-96181889 TCTACAATATCCTGCAGTGGGGG - Intronic
1113553481 13:111212199-111212221 ACTGCTTTGCACTGCAGTGGAGG + Intronic
1116523476 14:45876850-45876872 ACTATATTGTTATGCAGAGAAGG - Intergenic
1116774962 14:49168317-49168339 ACTGCATGGTGCTGAAGTGGAGG - Intergenic
1117065629 14:52010994-52011016 AGTACATTGTTCTGCGGATGTGG + Exonic
1120350456 14:83351089-83351111 AGTACATTGTTATGCAATGCGGG - Intergenic
1120498088 14:85261008-85261030 CCTACATTTTTCTCCAGTGCTGG - Intergenic
1122605954 14:102947899-102947921 ACCACCGTGTTCTGCAGTGGAGG + Intronic
1123206987 14:106723484-106723506 ACTATCCTGTTCTGCAGAGGTGG + Intergenic
1123212006 14:106770487-106770509 ACTATCCTGTTCTGCAGAGGTGG + Intergenic
1129638565 15:77349789-77349811 ACTGCATTGTTTTGCAGCTGAGG + Intronic
1130859873 15:87876307-87876329 AGAACATTGTCCTGAAGTGGAGG + Intronic
1131927268 15:97399343-97399365 ACTACTCTGCTCTGTAGTGGTGG + Intergenic
1133629291 16:7603997-7604019 AATGCCTTGGTCTGCAGTGGTGG + Intronic
1138192926 16:55031302-55031324 AATTCATTCTTCTGCAGGGGAGG - Intergenic
1138535361 16:57657202-57657224 AGTGCATTTTTCTGGAGTGGGGG - Intronic
1139367240 16:66441013-66441035 TCTAGATTGATCTGAAGTGGGGG - Intronic
1140998925 16:80289660-80289682 ACTTCATGGTTTTGCAGTGTGGG - Intergenic
1142424238 16:89992524-89992546 ACCACATGGTGCTGGAGTGGAGG - Intergenic
1143854313 17:9837400-9837422 ACTAAATTTGGCTGCAGTGGGGG + Intronic
1145305024 17:21669222-21669244 CTTACATGGTTATGCAGTGGGGG + Intergenic
1146541375 17:33698728-33698750 GCTGCATTGTTCTGCTGGGGAGG + Intronic
1148320838 17:46751018-46751040 ACTGAGTTGTTCAGCAGTGGTGG + Intronic
1148622450 17:49044627-49044649 CCTTGATTGTTCTCCAGTGGAGG + Intronic
1152707383 17:81851649-81851671 GAGACATTGTTCTGCAGGGGTGG - Intronic
1155532595 18:26782278-26782300 ACTCCTTTGTTTTCCAGTGGAGG + Intergenic
1155884227 18:31187599-31187621 ACTACTGTGTTCTGCAGCAGAGG - Intergenic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1163723817 19:18911201-18911223 TCCACAGTGTACTGCAGTGGAGG - Intronic
1165886927 19:39084960-39084982 ACGACATTGCTATGAAGTGGTGG - Intronic
929153253 2:38767329-38767351 ACTACATTGTTCTGCAGTGGAGG + Intronic
938832953 2:135071731-135071753 TCATCATTGTTCTGCTGTGGGGG - Intronic
940156048 2:150658331-150658353 AATACATTTTTCTGTGGTGGAGG + Intergenic
943459563 2:188155029-188155051 ACTCCGTTGTTTTACAGTGGGGG + Intergenic
948099977 2:235365685-235365707 ACTTCTTTGTTCTGCGCTGGTGG - Intergenic
948237351 2:236400880-236400902 ACCCCACTGTTCTGCCGTGGAGG + Intronic
1170188572 20:13620134-13620156 ACATCATTTGTCTGCAGTGGTGG + Intronic
1171522539 20:25786696-25786718 CTTACATGGTTTTGCAGTGGGGG + Intronic
1171530288 20:25848656-25848678 CTTACATGGTTATGCAGTGGGGG + Intronic
1171554288 20:26069187-26069209 CTTACATGGTTTTGCAGTGGGGG - Intergenic
1174324777 20:49770575-49770597 AATACTTGGTTCTCCAGTGGAGG - Intergenic
1176656341 21:9591672-9591694 TTTACATGGTTATGCAGTGGTGG + Intergenic
951675446 3:25235088-25235110 ACTACATTGTTCTCCAGCACAGG + Intronic
955096447 3:55803030-55803052 ACTCCATTGTTCTGAAGCTGGGG + Intronic
959523428 3:107346667-107346689 AATACATTGTTCAGCAGTCTGGG + Intergenic
962054164 3:131851014-131851036 AATAGATGGTTCTGCAGTGAAGG - Intronic
962834671 3:139177955-139177977 ACTACATTGATTAGAAGTGGTGG + Intronic
963275031 3:143321281-143321303 ACTGCCTTGCTCCGCAGTGGAGG - Intronic
963436025 3:145267315-145267337 ACTACATTGTTCTCCACTTTTGG - Intergenic
964980020 3:162667059-162667081 ACGACAGTGATCAGCAGTGGTGG + Intergenic
976292989 4:83440325-83440347 ACTTTTTTGTTCTGCTGTGGTGG - Intronic
977734237 4:100393347-100393369 TCAACATTGTTCTGGCGTGGTGG - Intergenic
978181900 4:105808271-105808293 CATATATTGTTTTGCAGTGGAGG - Intronic
978852895 4:113358963-113358985 ACTACATCTTCCTGCAGGGGGGG + Exonic
979486341 4:121275069-121275091 ACTACACTGATCTGGAGTTGAGG - Intergenic
980601750 4:135036166-135036188 ACTACATCTTTCTCCAGTGCTGG + Intergenic
982887890 4:160806340-160806362 ACTACTTTGTTATGCATTAGGGG + Intergenic
985870830 5:2555108-2555130 AGCACATTGTTCTGCAATTGTGG + Intergenic
987907389 5:24094386-24094408 CCTACATCGTTCTGCTGTGCTGG - Intronic
994263375 5:97685934-97685956 CCTACATAGATGTGCAGTGGGGG - Intergenic
996183040 5:120443357-120443379 AATAGAATGTTCTGTAGTGGTGG + Intergenic
999530573 5:152458781-152458803 TCTACATGGTACTGGAGTGGTGG - Intergenic
1000450733 5:161383674-161383696 AATAAATTGTTCCGCAGTGATGG - Intronic
1000863209 5:166481554-166481576 ACTAAATAGTTCTTCTGTGGAGG + Intergenic
1001707445 5:173751642-173751664 CCTAGATGGTTCTGCTGTGGCGG - Intergenic
1003546337 6:7062499-7062521 AATACATTGTTCTACAGTGGCGG + Intergenic
1006494523 6:34412375-34412397 CCTACAGTATTCTGCAGTGTGGG + Intronic
1010048319 6:71473362-71473384 AGAACATTCTTCTGCTGTGGAGG + Intergenic
1010157748 6:72814259-72814281 ATTACATTGCACTGCGGTGGAGG - Intronic
1010443086 6:75920498-75920520 ACGACATTGTTCATCTGTGGTGG + Intergenic
1012965383 6:105667881-105667903 ACTAAATTCTTCTGCAGAAGGGG - Intergenic
1016552320 6:145295567-145295589 ATTTCATTGTATTGCAGTGGTGG + Intergenic
1020982190 7:15084833-15084855 ACCACATTTTCCTGCAGAGGTGG + Intergenic
1021721206 7:23506261-23506283 TTTACATTTTTCTGCAGTAGTGG - Exonic
1023370451 7:39507780-39507802 ACTACAGTGTGCTGATGTGGTGG + Intergenic
1023555801 7:41421739-41421761 ACTACATTTTTCTGCCTTGAGGG + Intergenic
1024971597 7:55076684-55076706 ACTACAGTATTCCTCAGTGGGGG - Intronic
1025283023 7:57641899-57641921 CTTACATGGTTATGCAGTGGGGG + Intergenic
1031262870 7:119544840-119544862 ACTACATTGTTGGTCAGTGTTGG + Intergenic
1031653379 7:124320212-124320234 ACTACATTGAGCAGAAGTGGTGG - Intergenic
1035009692 7:155703108-155703130 ACATCCTTGTTCTGCAGTGATGG + Intronic
1038918468 8:32054252-32054274 AATACCATGTTGTGCAGTGGTGG + Intronic
1039240196 8:35547983-35548005 CCTACATTGTTCTCCCGTGCTGG - Intronic
1044197412 8:89394548-89394570 ACTACACTCATCTGCAGTGCAGG + Intergenic
1045256604 8:100529827-100529849 ACGACATTGTTCTGATGTGGTGG + Exonic
1045421183 8:102016567-102016589 ACTCCAAAGTTCTCCAGTGGTGG - Intronic
1048431443 8:134375306-134375328 AGTACAATGTTCTGCAGCCGTGG + Intergenic
1050966205 9:11806357-11806379 ACTACTATGTTCTGTGGTGGAGG + Intergenic
1052030596 9:23623899-23623921 ACTAAATTGATCTACAGTGCTGG - Intergenic
1054874423 9:70080565-70080587 AGTGCCTTGCTCTGCAGTGGTGG + Intronic
1057100270 9:92352683-92352705 CCTACATTTTTCTCCTGTGGTGG - Intronic
1057815681 9:98292379-98292401 ACCACATTGTTTTGTGGTGGAGG + Intronic
1058902065 9:109450824-109450846 ATTACATTTTTCTGAAGTTGAGG - Intronic
1061474789 9:130857770-130857792 ACTAAAGAATTCTGCAGTGGTGG - Intronic
1203634057 Un_KI270750v1:95154-95176 TTTACATGGTTATGCAGTGGTGG + Intergenic
1185709591 X:2292551-2292573 ACTTCCTTCTTCTGCAGTAGAGG + Intronic
1185822898 X:3221777-3221799 ACTAAATGATTCTCCAGTGGTGG - Intergenic
1188447743 X:30274008-30274030 ACCACAAAATTCTGCAGTGGAGG - Intergenic
1190755740 X:53400285-53400307 ACTACATTATGTTGCAGTGGTGG - Intronic
1195505083 X:105647233-105647255 ACAACAGTGATCAGCAGTGGTGG + Intronic
1197287192 X:124609676-124609698 ACTACATTTTACTCCAGTGGGGG - Intronic
1199761403 X:150907034-150907056 ACTAGATCTTTCAGCAGTGGTGG + Intergenic
1200258092 X:154596375-154596397 ATTACCTTGTTTTGTAGTGGAGG - Intergenic
1200651246 Y:5844267-5844289 CCTACATCTTTCTTCAGTGGTGG + Intergenic