ID: 929156679

View in Genome Browser
Species Human (GRCh38)
Location 2:38794570-38794592
Sequence GCTTATTTTCCCCCACATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929156676_929156679 12 Left 929156676 2:38794535-38794557 CCTAAATCACATGGGAATTAAGC No data
Right 929156679 2:38794570-38794592 GCTTATTTTCCCCCACATGCAGG No data
929156675_929156679 15 Left 929156675 2:38794532-38794554 CCTCCTAAATCACATGGGAATTA No data
Right 929156679 2:38794570-38794592 GCTTATTTTCCCCCACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929156679 Original CRISPR GCTTATTTTCCCCCACATGC AGG Intergenic
No off target data available for this crispr