ID: 929160085

View in Genome Browser
Species Human (GRCh38)
Location 2:38822928-38822950
Sequence ATGGTCCCCTTAGAGACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 979
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 965}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929160080_929160085 -9 Left 929160080 2:38822914-38822936 CCTTGATTTCCCCCATGGTCCCC 0: 1
1: 0
2: 1
3: 17
4: 267
Right 929160085 2:38822928-38822950 ATGGTCCCCTTAGAGACCTATGG 0: 1
1: 0
2: 0
3: 13
4: 965
929160079_929160085 -8 Left 929160079 2:38822913-38822935 CCCTTGATTTCCCCCATGGTCCC 0: 1
1: 0
2: 1
3: 9
4: 138
Right 929160085 2:38822928-38822950 ATGGTCCCCTTAGAGACCTATGG 0: 1
1: 0
2: 0
3: 13
4: 965

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929160085 Original CRISPR ATGGTCCCCTTAGAGACCTA TGG Intronic
900490983 1:2949056-2949078 ATCTTCCCCTTGGAGACCTCAGG + Intergenic
913737808 1:121805496-121805518 TTGGACCGCTTTGAGACCTATGG - Intergenic
913737970 1:121807357-121807379 TTGGACCGCTTTGAGACCTATGG - Intergenic
913747076 1:121918228-121918250 TTGGACCGCTTTGAGACCTATGG - Intergenic
913753413 1:122044895-122044917 TTGGACCGCTTTGAGACCTATGG + Intergenic
913760078 1:122122811-122122833 TTGGACCGCTTTGAGACCTATGG + Intergenic
913922434 1:124848902-124848924 TTGGTCCGCTTTGAGGCCTATGG + Intergenic
917585998 1:176426650-176426672 ACGGACTCCTTAGAGACCTAAGG + Intergenic
920535119 1:206732149-206732171 AAGGTCCCATTAGAGACCCAGGG - Intronic
923287162 1:232507382-232507404 ATGGTGACCTTGGTGACCTAGGG + Intronic
1077309974 11:1883965-1883987 ATGGTCCCCTCCAAGACCAAGGG - Exonic
1082154684 11:48792579-48792601 TTGGAGCCCTTTGAGACCTATGG - Intergenic
1082320931 11:50810369-50810391 TTGGTGCCCTTCGAGGCCTATGG + Intergenic
1082551910 11:54409663-54409685 ATGGACTGCTTTGAGACCTATGG + Intergenic
1082590970 11:55009111-55009133 TTGGAGCCCTTAGAGGCCTATGG - Intergenic
1082607120 11:55252692-55252714 TTGGTGCGCTTTGAGACCTACGG - Intergenic
1087231996 11:95676433-95676455 GTGTTACCCCTAGAGACCTAGGG + Intergenic
1088287260 11:108201642-108201664 ATGGTCACCTTAGTGGCCTCTGG - Intronic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1103311249 12:120010573-120010595 AGGCACCTCTTAGAGACCTATGG - Intronic
1105480585 13:20772362-20772384 ATGTTCCCCTTAGCGACAAAAGG - Intronic
1113617402 13:111690831-111690853 ATGGCCTCCTTGGGGACCTAAGG - Intergenic
1123387644 15:19831836-19831858 TTGGTGCCCTTTGAGGCCTATGG - Intergenic
1133730599 16:8575472-8575494 CTGGTCCCTGTAGACACCTATGG - Intronic
1136917706 16:34224194-34224216 TTGGAACCCTTTGAGACCTATGG + Intergenic
1136918114 16:34232539-34232561 TTGGAGCCCTTTGAGACCTATGG + Intergenic
1136918150 16:34233218-34233240 TTGGAGCCCTTTGAGACCTATGG + Intergenic
1136918328 16:34235798-34235820 TTGGAGCCCTTTGAGACCTATGG + Intergenic
1136918444 16:34238357-34238379 TTGGAGCCCTTTGAGACCTATGG + Intergenic
1138240636 16:55424525-55424547 TTGGTCTCCTTAAAGACCTAGGG - Intronic
1138459249 16:57138319-57138341 AGGGTCCACTGAGAGACCTGTGG - Intronic
1145418596 17:22746503-22746525 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145418769 17:22748882-22748904 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145418939 17:22751258-22751280 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145419103 17:22753637-22753659 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145419273 17:22756016-22756038 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145419448 17:22758394-22758416 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145419621 17:22760773-22760795 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145419790 17:22763150-22763172 ATGGACCGCTTTGAGGCCTACGG + Intergenic
1145419943 17:22815349-22815371 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145420115 17:22817728-22817750 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145420284 17:22820108-22820130 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145420368 17:22821301-22821323 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145420538 17:22823680-22823702 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145420709 17:22826060-22826082 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145420883 17:22828439-22828461 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145421402 17:22835576-22835598 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145421579 17:22837955-22837977 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145421756 17:22840334-22840356 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145421924 17:22842713-22842735 ATGGACCTCTTTGAGGCCTATGG + Intergenic
1145422098 17:22845093-22845115 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145422624 17:22852229-22852251 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145422800 17:22854608-22854630 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145422975 17:22856986-22857008 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145423147 17:22859365-22859387 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145423323 17:22861744-22861766 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145423494 17:22864123-22864145 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145423665 17:22866502-22866524 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145423833 17:22868881-22868903 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145424008 17:22871260-22871282 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145424175 17:22873639-22873661 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145424348 17:22876018-22876040 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145424527 17:22878397-22878419 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145424703 17:22880776-22880798 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145424878 17:22883155-22883177 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145425213 17:22887913-22887935 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145425387 17:22890292-22890314 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145425561 17:22892671-22892693 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145425734 17:22895049-22895071 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145425907 17:22897427-22897449 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145426253 17:22902186-22902208 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145426423 17:22904564-22904586 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145426593 17:22906942-22906964 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145426761 17:22909321-22909343 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145426933 17:22911701-22911723 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145427267 17:22916462-22916484 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145427438 17:22918841-22918863 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145427616 17:22921220-22921242 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145427789 17:22923599-22923621 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145427960 17:22925978-22926000 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145428131 17:22928357-22928379 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145428303 17:22930736-22930758 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145428479 17:22933115-22933137 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145428651 17:22935495-22935517 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145428821 17:22937875-22937897 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145428995 17:22940255-22940277 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145429167 17:22942634-22942656 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145429343 17:22945013-22945035 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145429515 17:22947392-22947414 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145429687 17:22949771-22949793 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145429861 17:22952149-22952171 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145430033 17:22954528-22954550 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145430200 17:22956906-22956928 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145430378 17:22959285-22959307 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145430557 17:22961665-22961687 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145430732 17:22964045-22964067 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145430903 17:22966426-22966448 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145431077 17:22968806-22968828 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145431430 17:22973566-22973588 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145431603 17:22975946-22975968 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145431774 17:22978325-22978347 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145431946 17:22980704-22980726 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145432120 17:22983083-22983105 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145432295 17:22985463-22985485 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145432466 17:22987843-22987865 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145432637 17:22990226-22990248 ATGGAGCCCTTTGAGGCCTATGG + Intergenic
1145432815 17:22992609-22992631 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145433160 17:22997367-22997389 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145433587 17:23003303-23003325 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145433758 17:23005683-23005705 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145433936 17:23008062-23008084 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145434110 17:23010441-23010463 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145434461 17:23015201-23015223 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145434634 17:23017581-23017603 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145434805 17:23019960-23019982 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145434976 17:23022339-23022361 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145435147 17:23024719-23024741 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145435316 17:23027098-23027120 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145435492 17:23029478-23029500 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145435660 17:23031857-23031879 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145435825 17:23034236-23034258 ATGGACCGCTTTGAGACCTATGG + Intergenic
1145435993 17:23036615-23036637 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145436166 17:23038994-23039016 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145436340 17:23041374-23041396 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145436517 17:23043754-23043776 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145436686 17:23046134-23046156 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145436856 17:23048513-23048535 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145437025 17:23050893-23050915 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145437200 17:23053274-23053296 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145437373 17:23055653-23055675 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145437551 17:23058032-23058054 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145437726 17:23060412-23060434 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145437894 17:23062788-23062810 ATGGAGCCCTTTGAGGCCTATGG + Intergenic
1145438234 17:23067546-23067568 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145438398 17:23069925-23069947 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145438574 17:23072305-23072327 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145438748 17:23074685-23074707 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145439084 17:23079448-23079470 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145439256 17:23081827-23081849 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145439424 17:23084206-23084228 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145439595 17:23086585-23086607 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145439853 17:23090156-23090178 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145440019 17:23092535-23092557 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145440361 17:23097291-23097313 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145440535 17:23099670-23099692 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145440711 17:23102052-23102074 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145440880 17:23104431-23104453 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145441053 17:23106810-23106832 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145441225 17:23109189-23109211 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145441748 17:23116329-23116351 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145441924 17:23118709-23118731 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145442277 17:23123468-23123490 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145442451 17:23125849-23125871 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145442621 17:23128230-23128252 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145442792 17:23130612-23130634 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145442964 17:23132992-23133014 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145443213 17:23136565-23136587 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145443384 17:23138944-23138966 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145443557 17:23141323-23141345 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145443730 17:23143702-23143724 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145444074 17:23148464-23148486 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145444248 17:23150842-23150864 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145444423 17:23153222-23153244 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145444598 17:23155602-23155624 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145444770 17:23157981-23158003 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145444950 17:23160361-23160383 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145445126 17:23162740-23162762 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145445300 17:23165121-23165143 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145445471 17:23167500-23167522 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145445649 17:23169880-23169902 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145445822 17:23172260-23172282 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145445991 17:23174640-23174662 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145446162 17:23177019-23177041 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145446340 17:23179398-23179420 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145446681 17:23184156-23184178 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145446848 17:23186532-23186554 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145447020 17:23188913-23188935 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145447191 17:23191291-23191313 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145447366 17:23193672-23193694 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145448313 17:23207526-23207548 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145448683 17:23212960-23212982 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145449000 17:23217713-23217735 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145449477 17:23224838-23224860 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145449666 17:23227554-23227576 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145449847 17:23230105-23230127 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145450024 17:23232819-23232841 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145450200 17:23235365-23235387 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145450872 17:23245200-23245222 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145451056 17:23247915-23247937 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145453430 17:23282520-23282542 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145453603 17:23285068-23285090 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145453791 17:23287786-23287808 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145453973 17:23290500-23290522 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145454163 17:23293216-23293238 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145454341 17:23295767-23295789 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145454670 17:23300687-23300709 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145455011 17:23305608-23305630 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145455795 17:23316970-23316992 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145455977 17:23319683-23319705 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145456328 17:23324950-23324972 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145456667 17:23329870-23329892 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145456852 17:23332586-23332608 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145457039 17:23335302-23335324 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145457380 17:23340218-23340240 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145458024 17:23349547-23349569 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145458198 17:23352094-23352116 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145458380 17:23354810-23354832 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145458565 17:23357527-23357549 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145458937 17:23362960-23362982 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145459606 17:23372794-23372816 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145460445 17:23384834-23384856 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145460630 17:23387549-23387571 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145460813 17:23390262-23390284 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145461333 17:23397729-23397751 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145461505 17:23400276-23400298 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145462150 17:23409604-23409626 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145462536 17:23415202-23415224 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145462724 17:23417919-23417941 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145463067 17:23422840-23422862 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145463705 17:23432169-23432191 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145464048 17:23437090-23437112 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145464227 17:23439804-23439826 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145464391 17:23442183-23442205 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145464731 17:23447100-23447122 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145465680 17:23460831-23460853 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145465868 17:23463548-23463570 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145466055 17:23466264-23466286 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145466394 17:23471185-23471207 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145466569 17:23473733-23473755 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145467054 17:23480688-23480710 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145467240 17:23483404-23483426 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145467423 17:23486121-23486143 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145467915 17:23493243-23493265 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145468099 17:23495958-23495980 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145468442 17:23500875-23500897 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145469678 17:23518849-23518871 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145470018 17:23523769-23523791 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145470818 17:23535300-23535322 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145471168 17:23540388-23540410 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145471353 17:23543105-23543127 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145471536 17:23545824-23545846 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145471720 17:23548539-23548561 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145472525 17:23560072-23560094 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145472852 17:23564824-23564846 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145473041 17:23567541-23567563 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145473400 17:23572807-23572829 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145473893 17:23579931-23579953 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145474589 17:23589941-23589963 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145474775 17:23592656-23592678 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145474949 17:23595202-23595224 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145475130 17:23597916-23597938 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145475622 17:23605042-23605064 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145475962 17:23609960-23609982 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145476150 17:23612677-23612699 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145476329 17:23615394-23615416 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145476965 17:23624724-23624746 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145477149 17:23627442-23627464 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145477480 17:23632361-23632383 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145477669 17:23635076-23635098 ATGGACCTCTTTGAGGCCTATGG + Intergenic
1145477857 17:23637793-23637815 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145478538 17:23647629-23647651 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145478725 17:23650346-23650368 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145478912 17:23653062-23653084 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145479861 17:23666798-23666820 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145481326 17:23687836-23687858 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145481661 17:23692755-23692777 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145483544 17:23720052-23720074 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145484330 17:23731416-23731438 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145484528 17:23734299-23734321 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145485007 17:23741252-23741274 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145485180 17:23743801-23743823 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145485363 17:23746516-23746538 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145485547 17:23749231-23749253 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145485726 17:23751949-23751971 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145486062 17:23756867-23756889 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145486557 17:23763989-23764011 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145486747 17:23766704-23766726 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145486929 17:23769420-23769442 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145487274 17:23774339-23774361 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145487645 17:23779770-23779792 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145487985 17:23784689-23784711 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145488322 17:23789611-23789633 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145488507 17:23792326-23792348 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145489340 17:23804367-23804389 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145490109 17:23815560-23815582 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145490297 17:23818276-23818298 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145490485 17:23820991-23821013 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145490672 17:23823706-23823728 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145491001 17:23828463-23828485 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145491322 17:23833213-23833235 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145492461 17:23849661-23849683 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145493004 17:23857810-23857832 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145493192 17:23860524-23860546 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145493712 17:23868157-23868179 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145493898 17:23870872-23870894 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145494085 17:23873588-23873610 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145494425 17:23878506-23878528 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145495097 17:23888182-23888204 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145495439 17:23893103-23893125 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145495767 17:23898021-23898043 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145496105 17:23902940-23902962 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145496293 17:23905653-23905675 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145496636 17:23910752-23910774 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145496820 17:23913466-23913488 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145497004 17:23916180-23916202 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145497345 17:23921099-23921121 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145498955 17:23944681-23944703 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145499444 17:23951803-23951825 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145499629 17:23954520-23954542 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145499818 17:23957236-23957258 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145500002 17:23959950-23959972 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145500185 17:23962667-23962689 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145500679 17:23969788-23969810 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145500862 17:23972503-23972525 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145501047 17:23975218-23975240 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145501721 17:23985054-23985076 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145501903 17:23987769-23987791 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145502393 17:23994890-23994912 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145502582 17:23997607-23997629 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145502767 17:24000322-24000344 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145502954 17:24003038-24003060 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145503603 17:24012362-24012384 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145503931 17:24017113-24017135 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145505025 17:24033063-24033085 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145505210 17:24035778-24035800 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145505544 17:24040697-24040719 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145505715 17:24043244-24043266 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145505898 17:24045961-24045983 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145506272 17:24051391-24051413 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145507213 17:24064954-24064976 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145507414 17:24067837-24067859 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145508096 17:24077837-24077859 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145508282 17:24080552-24080574 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145508620 17:24085470-24085492 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145508803 17:24088184-24088206 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145508993 17:24090901-24090923 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145509520 17:24098534-24098556 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145510317 17:24110062-24110084 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145510510 17:24112777-24112799 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145510692 17:24115490-24115512 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145511200 17:24122960-24122982 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145511541 17:24127877-24127899 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145511883 17:24132796-24132818 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145512068 17:24135512-24135534 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145512409 17:24140430-24140452 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145512748 17:24145349-24145371 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145514075 17:24164516-24164538 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145514411 17:24169435-24169457 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145514879 17:24176224-24176246 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145515219 17:24181144-24181166 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145515394 17:24183695-24183717 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145515579 17:24186410-24186432 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145515978 17:24192183-24192205 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145516165 17:24194898-24194920 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145516350 17:24197614-24197636 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145516668 17:24202195-24202217 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145516856 17:24204912-24204934 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145517021 17:24207289-24207311 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145517210 17:24210005-24210027 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145517396 17:24212720-24212742 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145517582 17:24215436-24215458 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145517773 17:24218152-24218174 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145518110 17:24223073-24223095 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145518284 17:24225621-24225643 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145518468 17:24228336-24228358 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145519231 17:24239357-24239379 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145519717 17:24246478-24246500 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145520074 17:24251742-24251764 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145520259 17:24254457-24254479 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145520456 17:24257342-24257364 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145520798 17:24262262-24262284 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145520987 17:24264983-24265005 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145521176 17:24267699-24267721 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145521815 17:24277021-24277043 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145521989 17:24279572-24279594 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145522161 17:24282119-24282141 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145522347 17:24284834-24284856 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145522841 17:24291959-24291981 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145523360 17:24299427-24299449 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145523544 17:24302143-24302165 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145523726 17:24304859-24304881 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145523911 17:24307576-24307598 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145524097 17:24310293-24310315 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145524592 17:24317418-24317440 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145525085 17:24324544-24324566 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145525412 17:24329467-24329489 ATGGACCGCTTTGAGGCCTACGG + Intergenic
1145525600 17:24332182-24332204 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145525938 17:24337101-24337123 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145526249 17:24341680-24341702 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145526586 17:24346599-24346621 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145526778 17:24349315-24349337 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145527109 17:24354233-24354255 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145527522 17:24360338-24360360 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145527720 17:24363225-24363247 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145528478 17:24374244-24374266 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145528966 17:24381367-24381389 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145529488 17:24388998-24389020 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145529668 17:24391714-24391736 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145530166 17:24398840-24398862 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145530952 17:24410200-24410222 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145531759 17:24421907-24421929 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145531948 17:24424623-24424645 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145532131 17:24427339-24427361 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145532925 17:24438868-24438890 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145533113 17:24441583-24441605 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145533609 17:24448710-24448732 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145533946 17:24453628-24453650 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145534059 17:24455323-24455345 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145534393 17:24460241-24460263 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145534580 17:24462956-24462978 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145535238 17:24472448-24472470 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145535581 17:24477366-24477388 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145536103 17:24485002-24485024 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145536278 17:24487551-24487573 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145536628 17:24492640-24492662 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145536971 17:24497731-24497753 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145537157 17:24500447-24500469 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145537645 17:24507569-24507591 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145539039 17:24527742-24527764 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145539374 17:24532658-24532680 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145539534 17:24535032-24535054 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145539722 17:24537746-24537768 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145540212 17:24544868-24544890 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145540400 17:24547582-24547604 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145540582 17:24550298-24550320 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145540922 17:24555219-24555241 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145541109 17:24557935-24557957 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145541725 17:24566919-24566941 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145541914 17:24569636-24569658 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145542102 17:24572353-24572375 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145542446 17:24577272-24577294 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145542784 17:24582188-24582210 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145542975 17:24584902-24584924 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145543194 17:24588122-24588144 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145543378 17:24590837-24590859 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145544497 17:24607116-24607138 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145544989 17:24614237-24614259 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145545178 17:24616956-24616978 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145546297 17:24633233-24633255 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145546490 17:24636116-24636138 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145546673 17:24638831-24638853 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145546856 17:24641547-24641569 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145547042 17:24644265-24644287 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145547383 17:24649185-24649207 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145547752 17:24654615-24654637 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145547926 17:24657163-24657185 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145548112 17:24659878-24659900 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145548447 17:24664796-24664818 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145548784 17:24669715-24669737 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145549095 17:24674295-24674317 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145549584 17:24681417-24681439 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145550374 17:24692953-24692975 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145550560 17:24695669-24695691 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145550899 17:24700591-24700613 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145551088 17:24703307-24703329 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145551428 17:24708223-24708245 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145551786 17:24713486-24713508 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145552138 17:24718572-24718594 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145552490 17:24723658-24723680 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145552985 17:24730779-24730801 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145553173 17:24733495-24733517 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145553357 17:24736210-24736232 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145554165 17:24747914-24747936 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145554634 17:24754697-24754719 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145554947 17:24759277-24759299 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145555438 17:24766397-24766419 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145555778 17:24771312-24771334 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145555957 17:24773861-24773883 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145556506 17:24781843-24781865 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145556691 17:24784558-24784580 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145558457 17:24810166-24810188 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145558642 17:24812881-24812903 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145558738 17:24814241-24814263 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145558921 17:24816955-24816977 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145559977 17:24832391-24832413 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145560300 17:24837143-24837165 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145560641 17:24842062-24842084 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145561129 17:24849182-24849204 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145561939 17:24860890-24860912 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145562141 17:24863772-24863794 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145562482 17:24868692-24868714 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145562967 17:24875811-24875833 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145563465 17:24883106-24883128 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145563652 17:24885822-24885844 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145563842 17:24888537-24888559 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145564024 17:24891252-24891274 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145564206 17:24893970-24893992 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145565798 17:24916864-24916886 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145566148 17:24921950-24921972 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145566648 17:24929239-24929261 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145566975 17:24933991-24934013 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145567157 17:24936706-24936728 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145567645 17:24943828-24943850 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145568769 17:24960108-24960130 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145569110 17:24965028-24965050 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145569295 17:24967743-24967765 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145570263 17:24981641-24981663 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145570448 17:24984356-24984378 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145571118 17:24994191-24994213 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145571490 17:24999621-24999643 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145571676 17:25002336-25002358 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145571861 17:25005051-25005073 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145572966 17:25021159-25021181 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145573605 17:25030486-25030508 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145573970 17:25035917-25035939 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145574173 17:25038802-25038824 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145574805 17:25047961-25047983 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145575629 17:25060004-25060026 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145575813 17:25062719-25062741 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145576459 17:25072043-25072065 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145576663 17:25075094-25075116 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145576828 17:25077468-25077490 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145577020 17:25080184-25080206 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145577385 17:25085613-25085635 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145578500 17:25101722-25101744 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145578685 17:25104438-25104460 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145578869 17:25107153-25107175 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145579488 17:25115989-25116011 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145579676 17:25118706-25118728 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145580181 17:25125996-25126018 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145580508 17:25130748-25130770 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145580692 17:25133462-25133484 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145580874 17:25136181-25136203 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145581765 17:25149073-25149095 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145581950 17:25151789-25151811 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145582131 17:25154335-25154357 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145582317 17:25157051-25157073 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145583103 17:25168412-25168434 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145583459 17:25173682-25173704 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145583799 17:25178601-25178623 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145584369 17:25186918-25186940 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145584694 17:25191669-25191691 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145585057 17:25196934-25196956 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145585243 17:25199648-25199670 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145585581 17:25204566-25204588 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145585920 17:25209487-25209509 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145586726 17:25221022-25221044 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145587223 17:25228149-25228171 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145587574 17:25233237-25233259 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145587893 17:25237826-25237848 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145588079 17:25240541-25240563 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145588630 17:25248511-25248533 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145588942 17:25253081-25253103 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145589303 17:25258344-25258366 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145589869 17:25266491-25266513 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145590053 17:25269206-25269228 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145590238 17:25271922-25271944 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145590926 17:25281927-25281949 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145591113 17:25284643-25284665 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145591450 17:25289560-25289582 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145591771 17:25294314-25294336 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145592413 17:25303639-25303661 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145592912 17:25310927-25310949 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145593254 17:25315849-25315871 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145593438 17:25318564-25318586 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145593919 17:25325521-25325543 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145594102 17:25328238-25328260 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145594473 17:25333668-25333690 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145594804 17:25338587-25338609 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145594983 17:25341304-25341326 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145595166 17:25344019-25344041 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145595359 17:25346734-25346756 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145595542 17:25349451-25349473 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145595723 17:25352166-25352188 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145596455 17:25362851-25362873 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145596643 17:25365567-25365589 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145596828 17:25368282-25368304 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145597165 17:25373203-25373225 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145597352 17:25375921-25375943 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145597535 17:25378636-25378658 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145597848 17:25383213-25383235 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145598701 17:25395600-25395622 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145598855 17:25397975-25397997 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145599375 17:25405609-25405631 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145599536 17:25407988-25408010 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145599902 17:25413419-25413441 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145600085 17:25416134-25416156 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145600270 17:25418850-25418872 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145600455 17:25421567-25421589 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145600909 17:25428184-25428206 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145601244 17:25433103-25433125 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145601736 17:25440225-25440247 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145601924 17:25442943-25442965 ATGGACCGCTTTGAGACCTATGG + Intergenic
1145602111 17:25445659-25445681 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145602448 17:25450577-25450599 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145602826 17:25456173-25456195 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145603127 17:25460416-25460438 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145603312 17:25463131-25463153 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145603496 17:25465847-25465869 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145603679 17:25468562-25468584 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145603862 17:25471278-25471300 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145604048 17:25473995-25474017 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145604237 17:25476708-25476730 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145604577 17:25481625-25481647 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145604754 17:25484171-25484193 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145604944 17:25486890-25486912 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145605128 17:25489605-25489627 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145605481 17:25494693-25494715 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145605653 17:25497241-25497263 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145606316 17:25506912-25506934 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145606499 17:25509628-25509650 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145606698 17:25512510-25512532 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145607217 17:25520144-25520166 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145607554 17:25525063-25525085 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145607720 17:25527443-25527465 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145607913 17:25530158-25530180 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145608103 17:25532875-25532897 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145608742 17:25542041-25542063 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145608929 17:25544756-25544778 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145609245 17:25549339-25549361 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145609733 17:25556461-25556483 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145609921 17:25559178-25559200 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145610260 17:25564095-25564117 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145610579 17:25568668-25568690 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145610787 17:25571725-25571747 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145611024 17:25575124-25575146 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145611214 17:25577840-25577862 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145611399 17:25580555-25580577 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145611885 17:25587681-25587703 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145612218 17:25592605-25592627 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145612405 17:25595320-25595342 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145612593 17:25598036-25598058 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145613094 17:25605326-25605348 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145613275 17:25608042-25608064 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145613461 17:25610760-25610782 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145614227 17:25621954-25621976 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145614414 17:25624670-25624692 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145614601 17:25627385-25627407 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145614924 17:25632136-25632158 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145615108 17:25634851-25634873 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145615478 17:25640285-25640307 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145615667 17:25643001-25643023 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145615878 17:25646051-25646073 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145616055 17:25648600-25648622 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145616377 17:25653352-25653374 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145616562 17:25656067-25656089 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145616742 17:25658786-25658808 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145617097 17:25663884-25663906 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145617464 17:25669310-25669332 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145617797 17:25674228-25674250 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145617969 17:25676768-25676790 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145618157 17:25679484-25679506 ATGGACCGCTTTGAGGCCTACGG + Intergenic
1145618354 17:25682368-25682390 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145618759 17:25688186-25688208 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145619079 17:25692941-25692963 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145619409 17:25697696-25697718 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145619769 17:25702962-25702984 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145620248 17:25709920-25709942 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145620434 17:25712636-25712658 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145620623 17:25715354-25715376 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145620821 17:25718239-25718261 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145621352 17:25726042-25726064 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145621537 17:25728757-25728779 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145621724 17:25731472-25731494 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145622313 17:25739884-25739906 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145622499 17:25742600-25742622 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145622834 17:25747519-25747541 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145623003 17:25750068-25750090 ATGGACCGCTTTGAGACCTATGG + Intergenic
1145624000 17:25764497-25764519 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145624194 17:25767211-25767233 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145624516 17:25771793-25771815 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145625164 17:25781289-25781311 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145625528 17:25786724-25786746 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145625720 17:25789435-25789457 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145626063 17:25794354-25794376 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145626232 17:25796736-25796758 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145626419 17:25799452-25799474 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145626761 17:25804371-25804393 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145627243 17:25811491-25811513 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145627572 17:25816245-25816267 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145627760 17:25818960-25818982 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145628090 17:25823711-25823733 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145628275 17:25826427-25826449 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145628645 17:25831856-25831878 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145628819 17:25834404-25834426 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145629183 17:25839670-25839692 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145629355 17:25842218-25842240 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145629726 17:25847644-25847666 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145629907 17:25850362-25850384 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145630097 17:25853077-25853099 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145630638 17:25861052-25861074 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145630828 17:25863768-25863790 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145631016 17:25866483-25866505 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145631397 17:25871915-25871937 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145631580 17:25874632-25874654 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145631768 17:25877345-25877367 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145632090 17:25882097-25882119 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145632264 17:25884645-25884667 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145632452 17:25887361-25887383 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145632636 17:25890077-25890099 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145632835 17:25892960-25892982 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145633022 17:25895676-25895698 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145633343 17:25900429-25900451 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145633534 17:25903142-25903164 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145633732 17:25906027-25906049 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145633915 17:25908742-25908764 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145634089 17:25911293-25911315 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145634532 17:25917741-25917763 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145635138 17:25925741-25925763 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145635475 17:25930660-25930682 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145636007 17:25938297-25938319 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145636184 17:25940845-25940867 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145636383 17:25943727-25943749 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145636550 17:25946103-25946125 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145636724 17:25948650-25948672 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145636913 17:25951367-25951389 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145637097 17:25954086-25954108 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145637286 17:25956800-25956822 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145637462 17:25959347-25959369 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145637651 17:25962061-25962083 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145637850 17:25964944-25964966 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145638033 17:25967659-25967681 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145638409 17:25973093-25973115 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145638598 17:25975810-25975832 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145638791 17:25978526-25978548 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145638962 17:25981073-25981095 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145639151 17:25983788-25983810 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145639520 17:25989219-25989241 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145639707 17:25991936-25991958 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145639898 17:25994650-25994672 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145640084 17:25997366-25997388 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145640576 17:26004487-26004509 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145640764 17:26007203-26007225 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145640950 17:26009920-26009942 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145641123 17:26012463-26012485 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145641310 17:26015180-26015202 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145641494 17:26017891-26017913 ATGGACCGCTTTGAGACCTATGG + Intergenic
1145641678 17:26020606-26020628 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145641861 17:26023318-26023340 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145642046 17:26026031-26026053 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145642382 17:26030950-26030972 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145642754 17:26036385-26036407 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145642920 17:26038763-26038785 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145643120 17:26041647-26041669 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145643304 17:26044359-26044381 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145643483 17:26046910-26046932 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145643851 17:26052344-26052366 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145644414 17:26060491-26060513 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145644746 17:26065408-26065430 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145645090 17:26070327-26070349 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145645771 17:26080166-26080188 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145645954 17:26082882-26082904 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145646139 17:26085597-26085619 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145646845 17:26095942-26095964 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145647032 17:26098658-26098680 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145647215 17:26101376-26101398 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145647403 17:26104090-26104112 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145647964 17:26112236-26112258 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145648150 17:26114947-26114969 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145648334 17:26117662-26117684 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145648706 17:26123093-26123115 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145649253 17:26131069-26131091 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145649447 17:26133783-26133805 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145649632 17:26136483-26136505 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145650070 17:26142767-26142789 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145650260 17:26145481-26145503 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145650830 17:26153795-26153817 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145651022 17:26156510-26156532 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145651216 17:26159224-26159246 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145651400 17:26161941-26161963 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145651590 17:26164656-26164678 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145651777 17:26167373-26167395 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145652152 17:26172804-26172826 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145652332 17:26175349-26175371 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145652715 17:26180783-26180805 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145652897 17:26183496-26183518 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145653090 17:26186211-26186233 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145653278 17:26188925-26188947 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145653460 17:26191638-26191660 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145653651 17:26194353-26194375 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145653836 17:26197067-26197089 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145654021 17:26199782-26199804 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145654207 17:26202497-26202519 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145654397 17:26205213-26205235 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145654772 17:26210643-26210665 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145655144 17:26216072-26216094 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145655331 17:26218790-26218812 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145655521 17:26221504-26221526 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145655884 17:26226764-26226786 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145656255 17:26232194-26232216 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145656442 17:26234906-26234928 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145656631 17:26237618-26237640 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145656818 17:26240335-26240357 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145657190 17:26245764-26245786 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145657365 17:26248310-26248332 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145657554 17:26251022-26251044 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145657741 17:26253739-26253761 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145658111 17:26259171-26259193 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145658482 17:26264600-26264622 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145658669 17:26267315-26267337 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145658857 17:26270028-26270050 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145659419 17:26278171-26278193 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145659608 17:26280883-26280905 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145659792 17:26283598-26283620 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145659979 17:26286313-26286335 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145660166 17:26289030-26289052 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145660349 17:26291745-26291767 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145660531 17:26294458-26294480 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145660717 17:26297175-26297197 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145661097 17:26302637-26302659 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145661285 17:26305352-26305374 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145661477 17:26308065-26308087 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145661835 17:26313324-26313346 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145662023 17:26316040-26316062 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145662210 17:26318754-26318776 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145662400 17:26321469-26321491 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145662752 17:26326562-26326584 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145662940 17:26329276-26329298 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145663126 17:26331989-26332011 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145663314 17:26334704-26334726 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145663650 17:26339624-26339646 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145664016 17:26345060-26345082 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145664205 17:26347774-26347796 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145664578 17:26353208-26353230 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145664949 17:26358641-26358663 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145665318 17:26364071-26364093 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145665507 17:26366787-26366809 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145665696 17:26369502-26369524 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145665872 17:26372049-26372071 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145666060 17:26374766-26374788 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145666248 17:26377482-26377504 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145666436 17:26380196-26380218 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145666808 17:26385628-26385650 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145666994 17:26388341-26388363 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145667169 17:26390888-26390910 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145667353 17:26393604-26393626 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145667539 17:26396319-26396341 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145667726 17:26399034-26399056 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145668087 17:26404300-26404322 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145668275 17:26407013-26407035 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145668462 17:26409725-26409747 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145668827 17:26415155-26415177 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145669013 17:26417871-26417893 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145669180 17:26420250-26420272 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145669359 17:26422798-26422820 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145669545 17:26425513-26425535 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145669732 17:26428227-26428249 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145669921 17:26430944-26430966 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145670112 17:26433660-26433682 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145670296 17:26436372-26436394 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145670485 17:26439090-26439112 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145670673 17:26441807-26441829 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145670867 17:26444523-26444545 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145671041 17:26447075-26447097 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145671226 17:26449791-26449813 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145671415 17:26452505-26452527 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145671600 17:26455222-26455244 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145671786 17:26457938-26457960 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145671973 17:26460653-26460675 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145672713 17:26471511-26471533 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145672892 17:26474225-26474247 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145673077 17:26476937-26476959 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145673267 17:26479652-26479674 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145673450 17:26482369-26482391 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145673820 17:26487801-26487823 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145674007 17:26490517-26490539 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145674194 17:26493234-26493256 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145674380 17:26495949-26495971 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145674565 17:26498664-26498686 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145674749 17:26501380-26501402 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145675125 17:26506808-26506830 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145675487 17:26512072-26512094 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145675665 17:26514622-26514644 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145675848 17:26517337-26517359 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145676035 17:26520055-26520077 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145676220 17:26522771-26522793 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145676412 17:26525486-26525508 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145676594 17:26528204-26528226 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145676776 17:26530920-26530942 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145677146 17:26536354-26536376 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145677339 17:26539070-26539092 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145677526 17:26541787-26541809 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145677709 17:26544502-26544524 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145677898 17:26547216-26547238 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145678087 17:26549930-26549952 ATGGACCCCTTTGAGGCCTATGG + Intergenic
1145678278 17:26552649-26552671 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145678641 17:26557916-26557938 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145678827 17:26560630-26560652 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145679008 17:26563345-26563367 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145679200 17:26566063-26566085 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145679339 17:26568209-26568231 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145679519 17:26570810-26570832 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145679687 17:26573193-26573215 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145679845 17:26575574-26575596 ATGGACCACTTTGAGGCCTATGG + Intergenic
1145680012 17:26577957-26577979 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145680177 17:26580339-26580361 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145680341 17:26582719-26582741 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145680509 17:26585101-26585123 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145680745 17:26588498-26588520 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145680913 17:26590880-26590902 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145681100 17:26593482-26593504 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145681261 17:26595864-26595886 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145681433 17:26598244-26598266 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145681599 17:26600627-26600649 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145681763 17:26603009-26603031 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145681927 17:26605389-26605411 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145682095 17:26607773-26607795 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145682265 17:26610155-26610177 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145682431 17:26612537-26612559 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145682593 17:26614917-26614939 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145682799 17:26617922-26617944 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145682970 17:26620300-26620322 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145683141 17:26622682-26622704 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145683307 17:26625057-26625079 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145683493 17:26628093-26628115 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145683715 17:26631493-26631515 ATGGACCGCTTTGAGGCCTATGG + Intergenic
1145707202 17:26882578-26882600 ATGGACCACTTTGAGGCCTATGG - Intergenic
1145707359 17:26884786-26884808 ATGGACCGCTTTGAGGCCTATGG - Intergenic
1146583307 17:34059344-34059366 ATGGGCTGCTTAGAGACCCAGGG - Intronic
1147308283 17:39578564-39578586 ATGGTCCCTGCAGAGACCCAGGG + Intergenic
1160073915 18:75653757-75653779 GTGGACCCCTTATAGACATAAGG + Intergenic
1160593089 18:79955036-79955058 ATGGGCCCATCAGAGAACTAAGG + Intergenic
1164329511 19:24240044-24240066 ATGGAGCCCTTTGAGGCCTAGGG - Intergenic
1164331345 19:24260859-24260881 TTGGAGCCCTTAGAGGCCTATGG - Intergenic
1164349091 19:27311257-27311279 ATGGAGCCCTTAGAGGCCTGTGG + Intergenic
1164354020 19:27394536-27394558 TTGGACCTCTTTGAGACCTATGG - Intergenic
1164366087 19:27583351-27583373 TTGGAGCCCTTAGAGGCCTATGG + Intergenic
1165829174 19:38722049-38722071 CTGGTTCCCTCAGGGACCTATGG - Intronic
1167869551 19:52356315-52356337 ATGTTCCCCATGGGGACCTAGGG - Intronic
929160085 2:38822928-38822950 ATGGTCCCCTTAGAGACCTATGG + Intronic
930303106 2:49642014-49642036 ATGGTCTAATCAGAGACCTAAGG - Intergenic
944101985 2:196036831-196036853 ATGCTCTGCCTAGAGACCTAAGG + Intronic
945178095 2:207064020-207064042 AAGGTCCCCTTAGAGAGAGATGG + Intergenic
1171826110 20:29908657-29908679 ATGGAGCCCTTTGAGGCCTATGG + Intergenic
1171826135 20:29909170-29909192 ATGGAGCCCTTTGAGGCCTATGG + Intergenic
1174141769 20:48419619-48419641 ATGGTCCCCTTTGGGAGCTTAGG - Intergenic
1176318644 21:5282235-5282257 ATGGAGCCCTTGGAGGCCTACGG - Intergenic
1176323251 21:5355254-5355276 ATGGAACCCTTTGTGACCTATGG + Intergenic
1176476620 21:7221572-7221594 ATGGAGCCCTTGGAGGCCTACGG - Intergenic
1176480902 21:7286874-7286896 ATGGAGCCCTTTGTGACCTATGG + Intergenic
1180396413 22:12348319-12348341 ATGGAGCCCTTGGAGTCCTACGG - Intergenic
1180403300 22:12515809-12515831 ATGGAGCCCTTGGAGTCCTACGG + Intergenic
955277549 3:57560794-57560816 TAGGTGACCTTAGAGACCTAAGG + Exonic
961312819 3:126014654-126014676 ATGGTCCCCTAAGGGAGCAAGGG + Intronic
969334145 4:6497050-6497072 ATTGTCCCCTTAAAGGCCTATGG - Intronic
974298629 4:60036312-60036334 TTGGTCTCCTTACAGACGTAAGG + Intergenic
989858709 5:46336656-46336678 TTGGTTCCCTTTGAGGCCTATGG - Intergenic
989862229 5:46391478-46391500 TTGGTTCCCTTTGAGGCCTACGG + Intergenic
990283939 5:54280825-54280847 ATTTTCCCTTTAGAGGCCTAGGG - Intronic
1002187391 5:177460695-177460717 ATGGTCACCCTAGAAACCAAAGG + Exonic
1007576608 6:42929276-42929298 ATGGTGGCCTCAGCGACCTATGG - Exonic
1014808054 6:125853771-125853793 AAGATCCTGTTAGAGACCTAAGG + Intronic
1015903766 6:138095450-138095472 ATAGACCCCTTAGAGTCATAAGG + Intronic
1019055941 6:169223337-169223359 ATGGTCCCCTTGGATCCCAAAGG - Exonic
1022048017 7:26638791-26638813 ATGGTCCCCTCATAGGCCCAGGG + Exonic
1022594808 7:31703074-31703096 ATGGTCCCCTTTTAGATTTATGG - Intronic
1025308622 7:57895378-57895400 TTGGTGCGCTTTGAGACCTACGG + Intergenic
1025311653 7:57951802-57951824 TTGGAGCCCTTTGAGACCTATGG - Intergenic
1025569629 7:62544189-62544211 TTGGTTCCCTTTGAGGCCTAGGG + Intergenic
1027652433 7:80886002-80886024 GTTGTCCCCTTTGAGACCTTAGG + Intronic
1029022414 7:97378549-97378571 ATGGTCCTTTAAGAAACCTAGGG + Intergenic
1038337505 8:26657240-26657262 ATGGCCCCCTTAGAGACCACAGG + Exonic
1038745310 8:30249629-30249651 ATGGTTCCCTAAGAAACCCAAGG - Intergenic
1040118448 8:43652383-43652405 TTGGAGCCCTTTGAGACCTATGG + Intergenic
1040125692 8:43734946-43734968 TTGGTGCCCATAGAGGCCTATGG + Intergenic
1043972526 8:86547880-86547902 ATAGTCCTCTTAGAGTCCTCAGG + Intronic
1045160861 8:99542497-99542519 ATGGTACACTTAGAGACATGAGG + Intronic
1045795905 8:106043876-106043898 ATGGTCCCCTTATAGGCCAAAGG + Intergenic
1048770737 8:137891903-137891925 ATGGTCCACATAGAGACAGAAGG + Intergenic
1049391989 8:142376463-142376485 ATGGACCCCTGAGAGAGCTCCGG + Intronic
1049421619 8:142519093-142519115 ATGGTCCCCCTAGAGCCCAGTGG - Intronic
1056770687 9:89475963-89475985 ATGGTCCCCAGAGGCACCTAAGG + Intronic
1057941850 9:99292008-99292030 ATGGTCCCCTGAGAGGCAGATGG + Intergenic
1203356052 Un_KI270442v1:146275-146297 ATGGAGCCCTTTGAGGCCTATGG - Intergenic
1203400677 Un_KI270519v1:91439-91461 ATGGAACGCTTTGAGACCTATGG + Intergenic
1203412054 Un_KI270579v1:24258-24280 ATGGAGCCCTTGGAGGCCTACGG - Intergenic
1203414965 Un_KI270590v1:4575-4597 TTGGTGCCCTTAGAGGCCTATGG - Intergenic
1186215085 X:7291014-7291036 ATTGTGCCCTAAGAGAGCTATGG - Intronic
1187110803 X:16297783-16297805 CTGGTCCCCCAAGAGACCTGAGG - Intergenic
1188949763 X:36356460-36356482 ATTGTCTCCTTAAAGACATATGG + Intronic
1189346753 X:40247752-40247774 ATGATGGCCTGAGAGACCTAAGG - Intergenic
1191570788 X:62615560-62615582 ATGGTTCCCTTAGAGGACTCTGG + Intergenic
1191571673 X:62632565-62632587 TTGGTTCCCTTAGTGGCCTATGG + Intergenic
1191571852 X:62635971-62635993 TTGGTTCCCTTTGAGGCCTATGG + Intergenic
1191696398 X:63995047-63995069 AGGGTCCCCTAAGAAAGCTAAGG - Intergenic
1191697327 X:64003528-64003550 ATGTTCCCCTTTCTGACCTATGG - Intergenic
1191940297 X:66472390-66472412 ATGGGCCTTTTAGAGAGCTAAGG - Intergenic
1195550594 X:106165212-106165234 ATGGTCTCCACAGAGACCTATGG - Intergenic
1196838949 X:119839993-119840015 ATGAGCCCCGTAGAGACTTAGGG + Intronic