ID: 929162567

View in Genome Browser
Species Human (GRCh38)
Location 2:38847316-38847338
Sequence GAGGGTATGAAAGGTGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929162567_929162577 9 Left 929162567 2:38847316-38847338 CCTGTTACACCTTTCATACCCTC 0: 1
1: 0
2: 0
3: 3
4: 129
Right 929162577 2:38847348-38847370 CCCCGCCACTTCCACCATAGAGG 0: 1
1: 0
2: 0
3: 13
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929162567 Original CRISPR GAGGGTATGAAAGGTGTAAC AGG (reversed) Intronic
900889863 1:5441909-5441931 GAGGCTAAGAAAGGTGGAGCTGG + Intergenic
902676755 1:18014132-18014154 GAGGGCAAGAAAGGAGTGACTGG + Intergenic
907332815 1:53682324-53682346 GGGGGGATGAAAGGTGCATCAGG + Intronic
909268015 1:73587022-73587044 GACCGTATGAAAGGGGTAAATGG - Intergenic
910214674 1:84831100-84831122 AAGGGTAAAAAAGGTTTAACTGG - Intronic
912179778 1:107205766-107205788 GAGGGCATGAGAGGTGTTCCTGG - Intronic
915642585 1:157240575-157240597 GAGGTTATGCAATGTGTAAAAGG - Intergenic
917453574 1:175167097-175167119 GATGCTATGAAAGGGGAAACAGG + Intronic
918164031 1:181927282-181927304 GAGGGGAGGAAAGGTAGAACAGG - Intergenic
921888246 1:220327786-220327808 GAGGGTATGAAAATGGTGACAGG + Intergenic
924003718 1:239583291-239583313 GAGTGTATGAAATGTGGAAATGG + Intronic
1062884453 10:1005502-1005524 GAGGGCATCACAGGAGTAACAGG - Intronic
1063695999 10:8335508-8335530 GAGGCTGTCAAAGGTTTAACTGG + Intergenic
1067958510 10:50820556-50820578 GAGGCTATGAAAGCTTTAAATGG - Exonic
1070071778 10:73096878-73096900 GAGGTTATAAAAGGGCTAACGGG - Exonic
1070874426 10:79789363-79789385 GAGGGAAGGCAAGGTGGAACTGG + Intergenic
1071641350 10:87311521-87311543 GAGGGAAGGCAAGGTGGAACTGG + Intergenic
1073364223 10:102924793-102924815 AAAGGTATGAATGGTGTCACCGG + Intronic
1077286390 11:1767865-1767887 AAGGGTGTGAAAGGTGAAAAAGG - Intergenic
1080020783 11:27557672-27557694 GGGGGAAAGAAAGGTGTATCAGG - Intergenic
1080537655 11:33237883-33237905 GTGGAAATGAAAAGTGTAACTGG - Intergenic
1082618165 11:55388198-55388220 GAGGTTATGAAAGGTATGAATGG + Intergenic
1087887263 11:103495230-103495252 GAGGGAATGAATGCTGGAACTGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089387428 11:118077458-118077480 GTGGGTATGAGACGTGTACCGGG - Intronic
1090418152 11:126555197-126555219 GAGGGAATGAACGCTGGAACCGG - Intronic
1090499487 11:127247623-127247645 GAGTGTATGAAAGGTGGAGAAGG - Intergenic
1090657194 11:128855217-128855239 GAGGGTAAGAAAAGTGAATCAGG - Intronic
1092213559 12:6664452-6664474 GAGGGTACGAAAAGTGTGAGGGG - Intergenic
1092343244 12:7694134-7694156 GAGGGTGTAAAAGGTGAGACTGG + Intronic
1093052941 12:14524154-14524176 GAGGGTAGGCAAGGTGGAAAGGG + Intronic
1095342369 12:41106661-41106683 GATGGGATGAAATGAGTAACAGG - Intergenic
1097778809 12:63679842-63679864 AAGTGAATGAAAGGTGTAAATGG + Intergenic
1098185832 12:67895209-67895231 GAGGGAATGAAAGATGCAATAGG + Intergenic
1101345310 12:103880778-103880800 GAGGGGATGAGAGTTGAAACTGG - Intergenic
1101377998 12:104187650-104187672 GAGGGAATGAAGGCTGGAACTGG + Intergenic
1101665728 12:106811769-106811791 GAAGGTATGAAAGGTGTTTGAGG + Intronic
1101868845 12:108545552-108545574 GAGAGTAAGAAGGGGGTAACAGG + Intronic
1105469225 13:20677064-20677086 GAGGATATGAGAGGTGAAGCTGG - Intronic
1106027753 13:25971481-25971503 GAGGGTAGGAAAGAAGGAACAGG - Intronic
1108765710 13:53626613-53626635 GAGGCTATGAAAGGTAAAAATGG + Intergenic
1110147491 13:72209414-72209436 TTGGGTGTGAAAGGTGTAACTGG - Intergenic
1110844501 13:80178750-80178772 GAAGGTAAGAAAAGTGTAACTGG - Intergenic
1113871895 13:113564854-113564876 GAGGGTCTGAGGGGTGTATCTGG - Intergenic
1114036282 14:18631711-18631733 CAGGGGATGAAAGAGGTAACAGG - Intergenic
1114122355 14:19683323-19683345 CAGGGGATGAAAGAGGTAACAGG + Intergenic
1117157471 14:52955001-52955023 GTGGGTGTGAAATGTGTAAGGGG + Intergenic
1120977297 14:90260279-90260301 TAGAGTCTGAAAGGGGTAACAGG + Intronic
1131149153 15:90036197-90036219 GAGGGGAAGAAAGGAGGAACGGG - Intronic
1140545967 16:75809526-75809548 GAGGGTATAAAGTGTGTAAGCGG + Intergenic
1142534718 17:606191-606213 GAGGGAATGAAAGGAGTGAAGGG + Intronic
1147159163 17:38560593-38560615 GAGGGAATGAAAGGTGAGATGGG - Intronic
1151104682 17:71598797-71598819 GACTGAATGAAAGGTGTAAAAGG - Intergenic
1151726952 17:75890893-75890915 GAGGGCATGGAAGGTGTACAGGG + Exonic
1153130566 18:1851329-1851351 GAGGGTTTGACAGGTGGGACTGG + Intergenic
1157901444 18:51522370-51522392 GAGGGTCTGAAATGTGTGGCTGG - Intergenic
1160055604 18:75476941-75476963 CTGGGTAATAAAGGTGTAACAGG - Intergenic
1165429756 19:35765944-35765966 GAGGGAACGACAGGTGTAAAAGG + Intronic
1165884621 19:39069092-39069114 GAGGGGAGGAAAGGTGCAGCAGG - Intergenic
1165896673 19:39145652-39145674 GAGCTTATGTAAGGTGTAATGGG + Intronic
1166457737 19:42957725-42957747 TAGGGTATGAAAGGAGTATTAGG + Intronic
1166468213 19:43053715-43053737 TAGGGTATGAAAGGAGTATTAGG + Intronic
1166488658 19:43238037-43238059 TAGGGTATGAAAGGAGTATTAGG + Intronic
1167683904 19:50943558-50943580 GAGGGTCTGAAAGGAGTGTCAGG + Exonic
1168375691 19:55877477-55877499 TTGGGGATGACAGGTGTAACTGG + Intronic
1168627850 19:57933249-57933271 GAGGGCATGAAAGGGGAATCAGG - Intronic
926003303 2:9351821-9351843 GAGGGTATGAGAAGGGGAACAGG - Intronic
927013006 2:18926144-18926166 GAGGGGATGAAGGAAGTAACTGG - Intergenic
929162567 2:38847316-38847338 GAGGGTATGAAAGGTGTAACAGG - Intronic
930247546 2:49000570-49000592 GAGGTTAAGAATTGTGTAACTGG - Intronic
930274326 2:49294064-49294086 GAGGTGATGAAAAGAGTAACAGG - Intergenic
932432118 2:71682366-71682388 GAGGGAATGCAAGGTGCAAAGGG + Intronic
937971207 2:127550745-127550767 GAGGGTATGAAAGCTGGATGGGG + Intronic
939362032 2:141184814-141184836 AAGGGTATGTAAGGTGTAGGAGG - Intronic
947165072 2:227253558-227253580 TAGGGTGTGAAAGGGTTAACAGG + Exonic
948082880 2:235220747-235220769 TTGGGTTAGAAAGGTGTAACTGG + Intergenic
1170011995 20:11734210-11734232 GAGTGTATGCAATGTGTAAAAGG - Intergenic
1175548744 20:59801868-59801890 GAGGGAAGGAAAGGTAAAACCGG - Intronic
1180460408 22:15558771-15558793 CAGGGGATGAAAGAGGTAACAGG - Intergenic
1181406003 22:22685625-22685647 GAGGGTAGGCAGGGTGTATCTGG - Intergenic
1182799432 22:33019350-33019372 GAGGCCATGAAACCTGTAACTGG + Intronic
1185151692 22:49167473-49167495 GAGGGTGTGAAAGGTGGGAGGGG - Intergenic
952187827 3:30989511-30989533 GTGGGTATGAAGGGTGTGAAAGG - Intergenic
953027185 3:39152118-39152140 GAGGGTCTGAAGGGTGGGACAGG + Intronic
955138926 3:56249633-56249655 GAGGGTTAGAAAGGTTAAACAGG - Intronic
959757476 3:109916145-109916167 GAGGCTATGAAAGGAGAAAAGGG - Intergenic
962350069 3:134650281-134650303 GAAGGCATGAAAGGCGTAAAAGG - Intronic
963598622 3:147358528-147358550 AAGGGTCTGGAAGGTGTAAAAGG + Intergenic
964887704 3:161503283-161503305 GGGGGTATGAAAGGGGAAAAAGG + Exonic
965103613 3:164333449-164333471 GAGGGAATGAATGCTGGAACCGG + Intergenic
967650610 3:191981239-191981261 GAGTGCAGGAAAGGGGTAACAGG + Intergenic
971547488 4:27904924-27904946 GAGGGTATGAAAGATGGAGGAGG - Intergenic
974961422 4:68705836-68705858 GAGGGGATAAAGGGTGTAAAGGG - Intergenic
980541521 4:134201842-134201864 GAGGGTGGGAAACGTGTAATAGG - Intergenic
981001737 4:139834873-139834895 GAGGGTATGAACCGTGAAATAGG + Intronic
981048024 4:140283339-140283361 GAGGGTATGACTGGTGTTACTGG + Intronic
982933187 4:161435414-161435436 CAGAGGCTGAAAGGTGTAACTGG + Intronic
983469060 4:168134783-168134805 AATGGTCTGAAAGCTGTAACAGG - Intronic
987972088 5:24959801-24959823 GAGGGGATAAAAGGTGTCTCTGG + Intergenic
990485041 5:56249868-56249890 AAATGTATGAAAGCTGTAACTGG - Intergenic
991244462 5:64494901-64494923 GAGGGTATGCAAGATGTATAAGG - Intergenic
993463459 5:88215335-88215357 TAGGGTATGAAAGGAAAAACAGG + Intronic
995122011 5:108546246-108546268 GAGGGTATGGAAGCTGGAAGGGG + Intergenic
999953338 5:156673480-156673502 GCGGCAATGAAAGGTATAACTGG - Intronic
1001425980 5:171622987-171623009 GAGGGTATGAAACCTGGACCTGG - Intergenic
1003128102 6:3372289-3372311 TAGGGTATGAATGCAGTAACAGG + Intronic
1003458021 6:6301817-6301839 CAAGGTATAAAAGGTATAACAGG + Intronic
1003568710 6:7241794-7241816 GAGGGTATGAAAGGGTAAGCTGG + Intronic
1005188191 6:23186479-23186501 GTGTGCATGAAAAGTGTAACTGG - Intergenic
1007071576 6:39041919-39041941 GAGGGTGTGAAAGGTCTTATGGG + Intergenic
1008356183 6:50556089-50556111 GAGGGTATGAAAAGTGATATAGG + Intergenic
1009925836 6:70119662-70119684 GAGGGTTGGAAATGTTTAACTGG - Intronic
1012208442 6:96490329-96490351 GGGGGTAAGGAAGGTGTGACTGG + Intergenic
1012985911 6:105876211-105876233 GAGGCTATGAAAGGATAAACAGG + Intergenic
1013335481 6:109154912-109154934 AAGGGTACTAAAGGTGTAGCAGG - Intronic
1014203782 6:118632693-118632715 TAGGGTATAAAAGGTATAAAAGG + Intronic
1015705691 6:136085161-136085183 GAGGGTCTTAAAGTGGTAACTGG + Intronic
1018468271 6:164072371-164072393 GAGGGAAAGAAAGGTGAAAGTGG - Intergenic
1022937741 7:35197504-35197526 CAGTGAATGAAAGGTGTAAATGG + Intergenic
1023940626 7:44766507-44766529 GAGGGTTTGAATGGTGCAGCTGG - Exonic
1028148794 7:87347929-87347951 GAGGGTAGGAAAGATAAAACTGG + Intronic
1028372386 7:90108087-90108109 AAGTGAATGAAAGGTGTAAATGG - Intergenic
1030296866 7:107937774-107937796 GAGTGTATGAAAGCTGATACTGG - Intronic
1035953744 8:4052938-4052960 GAGGGTCTGAGAGGTATAAATGG + Intronic
1045677473 8:104623865-104623887 GAGGGTATGAAAGAAGAAATTGG + Intronic
1045683617 8:104688828-104688850 GAGGCTAGGAAAAGAGTAACTGG - Intronic
1052436218 9:28433251-28433273 GAGAGTAGGAAAGGGATAACAGG - Intronic
1058881540 9:109289634-109289656 GAAGGGATGACAGGAGTAACAGG - Intronic
1186184264 X:7004758-7004780 TAGGGTATGAAAGGAGTATTAGG + Intergenic
1186552328 X:10519684-10519706 GAGGTTATGATAGGTGGAAGAGG - Intronic
1187178487 X:16918768-16918790 GAGGGTAGGAAGGGTGTATGGGG + Intergenic
1188977429 X:36691866-36691888 GATGGTATGAAGGGTCTAAATGG - Intergenic
1195558248 X:106251977-106251999 GAGGCTGTGAAAGGTGTTGCAGG - Intergenic