ID: 929164291

View in Genome Browser
Species Human (GRCh38)
Location 2:38865459-38865481
Sequence GACTCACAGTACCACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19277
Summary {0: 1, 1: 177, 2: 3356, 3: 6885, 4: 8858}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929164291_929164296 15 Left 929164291 2:38865459-38865481 CCAGCCCTGTGGTACTGTGAGTC 0: 1
1: 177
2: 3356
3: 6885
4: 8858
Right 929164296 2:38865497-38865519 CTTTATAAATTACTCAGTCTTGG 0: 283
1: 3907
2: 4487
3: 3227
4: 3137
929164291_929164297 16 Left 929164291 2:38865459-38865481 CCAGCCCTGTGGTACTGTGAGTC 0: 1
1: 177
2: 3356
3: 6885
4: 8858
Right 929164297 2:38865498-38865520 TTTATAAATTACTCAGTCTTGGG 0: 232
1: 3627
2: 11875
3: 14999
4: 13096

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929164291 Original CRISPR GACTCACAGTACCACAGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr