ID: 929166649

View in Genome Browser
Species Human (GRCh38)
Location 2:38888461-38888483
Sequence AGGTGTGTGGATCGCTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929166640_929166649 22 Left 929166640 2:38888416-38888438 CCAGGCAGGTGGCTCATCCTGTA 0: 1
1: 0
2: 4
3: 19
4: 161
Right 929166649 2:38888461-38888483 AGGTGTGTGGATCGCTTGCCAGG 0: 1
1: 0
2: 2
3: 27
4: 186
929166646_929166649 -4 Left 929166646 2:38888442-38888464 CCAGCACTTTGGGATGCCAAGGT 0: 345
1: 30085
2: 127757
3: 225559
4: 206215
Right 929166649 2:38888461-38888483 AGGTGTGTGGATCGCTTGCCAGG 0: 1
1: 0
2: 2
3: 27
4: 186
929166644_929166649 -3 Left 929166644 2:38888441-38888463 CCCAGCACTTTGGGATGCCAAGG 0: 965
1: 90781
2: 215299
3: 238912
4: 147909
Right 929166649 2:38888461-38888483 AGGTGTGTGGATCGCTTGCCAGG 0: 1
1: 0
2: 2
3: 27
4: 186
929166643_929166649 5 Left 929166643 2:38888433-38888455 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 929166649 2:38888461-38888483 AGGTGTGTGGATCGCTTGCCAGG 0: 1
1: 0
2: 2
3: 27
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929166649 Original CRISPR AGGTGTGTGGATCGCTTGCC AGG Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
903672187 1:25043072-25043094 AAGTGTGTGCACCGCTGGCCTGG + Intergenic
904079510 1:27863092-27863114 AGGTGTGAAGATGGCTTGGCAGG - Intergenic
904096545 1:27982793-27982815 GGGTGGGTGGATCACCTGCCTGG - Intronic
904227716 1:29037762-29037784 AGGCGAGTGGATCACTTGTCAGG - Intronic
910620979 1:89254169-89254191 AGGTGTGTGGATTTCTTTCTGGG - Intergenic
913537892 1:119791657-119791679 AGGGTTGTGGATCTCTTTCCTGG + Intergenic
916032323 1:160888450-160888472 AGGTGGGAGAATCACTTGCCTGG - Intergenic
919901110 1:202044963-202044985 AAGTGTGTGGAGGGGTTGCCAGG - Intergenic
922228505 1:223665943-223665965 AGGTGTGTGGAGGGAATGCCGGG - Intergenic
1063704972 10:8421845-8421867 AGGTGTGTGCCTGGCTTACCAGG + Intergenic
1065032879 10:21605712-21605734 AGGTGTTTGGCTCACTGGCCTGG + Intronic
1067305571 10:45060739-45060761 AGGTGGGAGGATCGCTTACCGGG + Intergenic
1069671046 10:70204106-70204128 AGGTAGGTGGATCGCCAGCCTGG + Intronic
1070126689 10:73627823-73627845 AGGTGGGAGGATCGCTTGAGTGG - Intergenic
1071583972 10:86801369-86801391 AGGTGGGTGGATGGCTTGAGTGG - Intronic
1071704136 10:87978833-87978855 AGGTGGGTGGATCACCTGTCAGG - Intergenic
1072502101 10:96027818-96027840 AGGTGTGTGGATTTGTTTCCGGG - Intronic
1077227252 11:1443740-1443762 AGGTGTGTGGGTCGGTGCCCAGG + Intronic
1077484049 11:2830776-2830798 AGGTGTGTGGCTCTGTGGCCAGG - Intronic
1078995371 11:16692278-16692300 AGGTGGGTGGATCACCAGCCTGG - Intronic
1079166456 11:18048353-18048375 AGGTGTGTGGATCCGTTTCTGGG - Intergenic
1083127520 11:60586293-60586315 AGGTGTGTGGATTTGTTTCCTGG - Intergenic
1083256266 11:61497919-61497941 AGGTGTGTGTGTCGCTCACCTGG + Intergenic
1083338270 11:61940690-61940712 AGGTGGGCGGATCACTTGTCAGG + Intergenic
1083741917 11:64715770-64715792 AGGAGTGGGGGTTGCTTGCCTGG - Intronic
1084800692 11:71541911-71541933 TGCTGTGTGTTTCGCTTGCCAGG - Intronic
1085056761 11:73409132-73409154 AGGTGGCTGGATCGCTAGCAAGG - Intronic
1086293026 11:85332765-85332787 AGGTGTGTGGATTTATTTCCAGG + Intronic
1086573623 11:88313296-88313318 AGGTGGGTGGATCACTTGTCTGG - Intronic
1087429698 11:98037041-98037063 AGGTGGGCGGATCACTTGTCAGG + Intergenic
1087439301 11:98162041-98162063 AGGTGTGTGGCTCGCTTACTCGG - Intergenic
1088643183 11:111893793-111893815 AGGTGTGTGGATTTGTTTCCGGG - Intergenic
1093751729 12:22807750-22807772 AGGGGTGTGGCTTGCTTACCTGG + Intergenic
1094207417 12:27855060-27855082 GGGTGTGTGGATTGCTTGTAGGG + Intergenic
1094220506 12:27987878-27987900 AGGCGGGTGGATCGCTTGTAAGG - Intergenic
1096349746 12:50886818-50886840 ACGTGTGTGGTTTGCTTGCCAGG - Intronic
1098269080 12:68752773-68752795 AGGCGGGTGGATCACTTGTCAGG + Intronic
1098551735 12:71770088-71770110 GGGTGGGTGGACAGCTTGCCTGG + Intronic
1098702877 12:73651689-73651711 AGGTGTGTGGATCTATTTCTGGG - Intergenic
1098728879 12:74007106-74007128 AGGTGTGTGGATTTCTTTCTGGG - Intergenic
1099509691 12:83518321-83518343 AGGGGTGTGGCTCGTTTGCTTGG - Intergenic
1101113009 12:101504769-101504791 AGGTGGGTGGATCACTTATCAGG - Intergenic
1102565155 12:113792398-113792420 AGGTAGGTGGATCGCTGGTCAGG - Intergenic
1103059538 12:117847608-117847630 AGGTGTCTGGATCTCTTTTCCGG - Intronic
1103665918 12:122565654-122565676 AGGTAGGCGGATCGCTTCCCAGG + Intronic
1106319387 13:28624039-28624061 AGGTCTGTGGAGCCCTAGCCAGG - Intergenic
1106742791 13:32664756-32664778 AGGTGGGAGGATCGCTTGCAGGG + Intronic
1107083491 13:36400085-36400107 AGGTGTGTGGATTTGTTTCCAGG + Intergenic
1107085676 13:36425621-36425643 AGGTGTATGGATCTGTTTCCAGG - Intergenic
1108256141 13:48612776-48612798 AGGTGAGAAGATTGCTTGCCAGG + Intergenic
1108901036 13:55409233-55409255 AGATGTGTAGATCTCTTGCAAGG + Intergenic
1108973645 13:56408327-56408349 AGATGTGTGGATTGGTTTCCAGG - Intergenic
1109433697 13:62271469-62271491 ATTTGTGTGGATCTCTTTCCAGG + Intergenic
1111491075 13:88976254-88976276 AGGTGGGTGGATCACTTGTCAGG - Intergenic
1112499648 13:99932716-99932738 AGGTGGGTGGATCACTTGAGAGG - Intergenic
1112706060 13:102069875-102069897 AGGTGGGTGGATCACCTGGCGGG + Intronic
1113446799 13:110375139-110375161 AGGTGTGAGGATGGCTCACCGGG + Intronic
1113839308 13:113349763-113349785 AGGAGTGTGGAGCCCCTGCCTGG - Intronic
1114944457 14:27662274-27662296 AGGTGTGTGGATTTCTTTCTCGG - Intergenic
1116020385 14:39453493-39453515 AGGTGGGTGGATCACTAGCCTGG - Intergenic
1117125187 14:52615264-52615286 AGGTGTGTGGATTGGTTTCTGGG + Intronic
1120858230 14:89231568-89231590 AGGAGTGTGGTTCTGTTGCCTGG + Intronic
1124113727 15:26819684-26819706 AGGTGTGTGGATTTATTTCCGGG - Intronic
1126108388 15:45161793-45161815 GTGGGTGCGGATCGCTTGCCTGG + Exonic
1126521725 15:49602956-49602978 AGGTGTGTGGATTGGTTTCTGGG + Intronic
1127035582 15:54913471-54913493 AGGTGTGTGGATTTGTTTCCAGG - Intergenic
1128743580 15:70098948-70098970 AGGTGTCTCGGTCGCTAGCCTGG + Intergenic
1128990460 15:72255486-72255508 AGGCGGGTGGATCACTTGACTGG - Intronic
1130665808 15:85868943-85868965 AGGTGTGTTGATCACTGACCAGG - Intergenic
1131192095 15:90325040-90325062 AGTTGGGAGGATTGCTTGCCAGG - Intergenic
1132775510 16:1591547-1591569 AGGTGTGTGGGTTGCTGGCGTGG - Intronic
1134527854 16:14958110-14958132 AGGCGGGAGGATCGCTTGTCAGG + Intergenic
1134602275 16:15542782-15542804 AGGGGTGTGGCTCGCTTACTTGG + Intronic
1135968383 16:27054046-27054068 AGGCAGGAGGATCGCTTGCCTGG + Intergenic
1139622640 16:68159134-68159156 AGGTAGGAGGATCACTTGCCCGG + Intronic
1140452789 16:75084598-75084620 AGCTGAATGGATAGCTTGCCTGG - Intronic
1142532810 17:594415-594437 AGGGGTGTGGATCAATTTCCTGG + Intronic
1144548610 17:16219791-16219813 AGGTGGGTGGATCACTTGTCAGG - Intronic
1146747788 17:35346996-35347018 AGGTGAGAGGATCGCTTGAGGGG + Intergenic
1147058857 17:37857850-37857872 AGGTGTTTGGCTCACTGGCCTGG - Intergenic
1151262475 17:72927290-72927312 AGGTGCGTGGATCACTTGAGAGG - Intronic
1151526639 17:74674168-74674190 AGGTGGGAGAATCACTTGCCTGG - Intronic
1151893899 17:76967326-76967348 GGGTGTGGGGACCCCTTGCCAGG - Intergenic
1152074135 17:78148431-78148453 AGGTGGGAGGATTGCTTGTCCGG + Intronic
1152523736 17:80875738-80875760 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523745 17:80875787-80875809 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523839 17:80876224-80876246 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523850 17:80876272-80876294 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523860 17:80876321-80876343 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523910 17:80876565-80876587 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523932 17:80876661-80876683 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523956 17:80876756-80876778 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523967 17:80876804-80876826 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523987 17:80876900-80876922 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1152523999 17:80876949-80876971 GGGTGTGTGTGTCGCCTGCCGGG + Intronic
1157963335 18:52181253-52181275 GGGTGTGTGGATCACTTATCTGG - Intergenic
1158049896 18:53204309-53204331 AGGCAGGAGGATCGCTTGCCAGG + Intronic
1161992063 19:7689844-7689866 AGGTGGGTGGATCACCTGCCAGG - Intronic
1162488515 19:10977109-10977131 ATCTGTGTGCATTGCTTGCCAGG + Intronic
1165490818 19:36121717-36121739 AGGTGCGTGGCTCGCGGGCCCGG + Exonic
929166649 2:38888461-38888483 AGGTGTGTGGATCGCTTGCCAGG + Intronic
934035269 2:88083864-88083886 AGGCGGGTGGATCACTTGTCAGG + Intronic
935032948 2:99339605-99339627 AGGTGGGAGGATCACTGGCCAGG - Intronic
939356855 2:141114096-141114118 AGGGGTGTGGCTCGTTTGCTCGG + Intronic
940260540 2:151775552-151775574 AGGTGGGAGGATCACTGGCCTGG - Intergenic
940658625 2:156519722-156519744 AGGGGTGTGGCTCGATTACCTGG + Intronic
944888893 2:204096573-204096595 AGGTGGGAGGATCGCTTGGGAGG + Intergenic
946224729 2:218258181-218258203 AGGTGGGTGGATCACCTGTCAGG - Intergenic
946244558 2:218379502-218379524 AGGTGGGTGGATCACTTGAGTGG + Intergenic
947001177 2:225458254-225458276 AGGTGGGAGGATCGCTTGAGTGG + Intronic
947140042 2:227012243-227012265 AGGGGTGTGGATGGCGTCCCTGG - Exonic
948431019 2:237919092-237919114 AGGTGGGTGGACCACTTGTCAGG - Intergenic
1169201994 20:3715528-3715550 AGGTGGGTGGATCACTTGACTGG - Intergenic
1169587428 20:7101657-7101679 AGGTGTGTGGATTTCTTTCTGGG - Intergenic
1170256614 20:14351059-14351081 AGGTGTGTGGATTTCTTTCTGGG + Intronic
1172416580 20:34773752-34773774 AGGTGGGTGGATCACTTGAGGGG - Intronic
1172730073 20:37079716-37079738 AGGTGGGAGGATCGCTTGGGAGG - Intronic
1175488662 20:59363958-59363980 AGGCGAGTGGATCACTTGTCAGG + Intergenic
1176014562 20:62923402-62923424 AGATGGGTGGATCACTTGTCAGG - Intronic
1176154820 20:63613740-63613762 GGGTGGGTGGATCACTTGTCAGG - Intronic
1177355244 21:19998695-19998717 AGGGGTGTGGATGTCTTGCGAGG + Intergenic
1179140381 21:38719858-38719880 AGGCGGGTGGATCACTTGACTGG + Intergenic
1179783531 21:43717574-43717596 AGGGGTGTGGCTTGCTTACCTGG + Intergenic
1181098879 22:20525443-20525465 AGGTGGGTGGATCACTTGAGAGG - Intronic
1181450341 22:23016055-23016077 AGGTGGGAGGATTGCTAGCCGGG - Intergenic
1183873379 22:40757700-40757722 AGGTGAGTGAATCGCTTGCGTGG + Intergenic
1183976881 22:41517468-41517490 AGGTGTGTGGGACCCTGGCCCGG + Intronic
1184802406 22:46769611-46769633 AGGAGTGGGGAGCGCTTGACTGG + Intronic
949349643 3:3112278-3112300 AGGTGGGTGGATCACCTGTCAGG - Intronic
949579146 3:5369632-5369654 AGGTGGGTGGATCACCTGTCAGG + Intergenic
950630238 3:14277370-14277392 GGGTGTGTGGCCCACTTGCCAGG + Intergenic
950955571 3:17050013-17050035 AGGTGTGTGGATTTCTTTCTGGG - Intronic
951173887 3:19576549-19576571 AAGTGTGTGGTTCGGTTGCCAGG - Intergenic
951501378 3:23390762-23390784 AGGGGTATGGCTCGCTTACCTGG - Intronic
953015966 3:39076406-39076428 AGCTGCCTGGATCTCTTGCCGGG + Intronic
954610129 3:51940608-51940630 AGGTTTGGGGATCCCTTCCCAGG - Intronic
954770241 3:52961041-52961063 AGGTGGGAGGATCACTTGCAAGG + Intronic
956704138 3:71984669-71984691 AGGTGGGTGGATCACTTGTCAGG + Intergenic
956991388 3:74770339-74770361 AGGTGGGTGGATCTTTTGTCAGG - Intergenic
957923014 3:86771934-86771956 AAGTGTGTGCATCCCTGGCCAGG - Intergenic
961416392 3:126761058-126761080 AGGCAGGAGGATCGCTTGCCAGG - Intronic
970617977 4:17785551-17785573 AGGTGGGCGGATCACTTGTCAGG - Intergenic
973690032 4:53418191-53418213 AGGTGGGTGGATCACTGGACAGG + Intronic
973753973 4:54054016-54054038 AGGTGGGCGGATCACTTGTCAGG - Intronic
974166782 4:58214521-58214543 AGGGGTGTGGATCGCCTGCTTGG + Intergenic
976306860 4:83568734-83568756 AGGTGGGTGGATCACCTGTCAGG - Intronic
980525081 4:133979536-133979558 AGGACTGTGCATCGCTTGCCTGG + Intergenic
981181290 4:141748741-141748763 AGGTGTGTGGCTCTATTTCCGGG - Intergenic
982559097 4:156907624-156907646 CGGTGGGTGGAGCTCTTGCCAGG + Intronic
982647465 4:158042355-158042377 AGGTGTGTGGCTCTATTTCCGGG - Intergenic
986780412 5:11060108-11060130 AGCTGTGTGCATGGCTTGGCAGG - Intronic
988014901 5:25542981-25543003 AGGTGTCTGAATCACTTGCAGGG + Intergenic
989302587 5:39911394-39911416 AGGTGGGAGGATGGCTTGACTGG + Intergenic
993723207 5:91341989-91342011 AGGTGAGAGGATCACTTGCCTGG + Intergenic
994533150 5:100992503-100992525 AGGGGTGTGGCTTGCTTGCTGGG + Intergenic
994642555 5:102428097-102428119 AGGTGGGTGGATCACTTGTCAGG - Intronic
996145591 5:119971337-119971359 AGGTGGGAGGATCACTTGACAGG + Intergenic
997211641 5:132080440-132080462 AGGTGTGTGGTTGGCCTGCATGG - Intergenic
999808089 5:155102446-155102468 AGGTGGGAGGATCGCTTGAGCGG + Intergenic
1001504076 5:172263031-172263053 AGGTGGGAGGATCGCTCGCCCGG - Intronic
1001609736 5:172990596-172990618 AGGTGGGTGGATCACTTGGTCGG + Intronic
1003818126 6:9864306-9864328 AGGTGGGTGGATCACCTGTCAGG + Intronic
1008104861 6:47430389-47430411 AGGTGGGAGAATTGCTTGCCTGG + Intergenic
1009696246 6:67107690-67107712 AGGTGTGTGGATTTCTTTCTGGG - Intergenic
1011641448 6:89419526-89419548 AGGTGGTTGGATCACTTGTCAGG + Intergenic
1011641456 6:89419569-89419591 AGGTGGTTGGATCACTTGTCAGG + Intergenic
1019233250 6:170586034-170586056 AGGCAAGAGGATCGCTTGCCTGG - Intergenic
1020410639 7:7888189-7888211 AGGTGGGTGGATCACTTGTCAGG - Intronic
1021354163 7:19633599-19633621 AGGTGTGTGGATTTGTTTCCGGG - Intergenic
1023972912 7:45004775-45004797 AGGTGGGTGGATCACCTGTCAGG + Intronic
1024982495 7:55169326-55169348 AGGTGTGTGGATCACTTGTCAGG - Intronic
1026085666 7:67260985-67261007 AGGTGGGTGGATTACTTGTCAGG + Intergenic
1026691499 7:72553898-72553920 AGGTGGGTGGATTACTTGTCAGG - Intergenic
1029212508 7:98920368-98920390 AGGTGGGAGGATTGCTTGCTTGG + Intronic
1029813429 7:103071623-103071645 AGGCAGGTGGATTGCTTGCCAGG - Intronic
1030681983 7:112443639-112443661 AGGTGTGTGGACCACTTGTCAGG + Intronic
1032406622 7:131660502-131660524 AGGTGGGAGGATCGCTTGAGGGG + Intergenic
1032514995 7:132500213-132500235 AGGTGGGTGGATCACCTGTCAGG + Intronic
1034095601 7:148405092-148405114 TTGTGTGTGGAACCCTTGCCAGG + Intronic
1035604694 8:922010-922032 AGGTGTGTGGCATGCTGGCCCGG + Intergenic
1037840701 8:22243551-22243573 AGGTGGGAGGATCGCTTGAAAGG - Intergenic
1039974214 8:42346478-42346500 AGGTGGGAGGATTGCTTGGCTGG - Intronic
1041722567 8:60989405-60989427 AGGTGGGTGGATCGCCTGTCAGG - Intergenic
1042537041 8:69869562-69869584 AGGTGGGTGGATCACCTGTCAGG - Intergenic
1042913300 8:73848454-73848476 AGGTGGGAGGATCGCTTTCCAGG + Intronic
1042914795 8:73864830-73864852 AGTTGGGTGGATCACTTGTCAGG - Intronic
1044192610 8:89336913-89336935 AGGTGTGTGGATTTGTTTCCAGG + Intergenic
1044563983 8:93643429-93643451 AGGTGGGTGGATCACTTGCACGG - Intergenic
1045527497 8:102953891-102953913 AGGTGGGAGGATCACTTGCCTGG - Intronic
1045881480 8:107045839-107045861 AGGGGTGGGGATCACGTGCCGGG + Intergenic
1048397778 8:134031185-134031207 AGGTGGGAGGATCGCTTGAGTGG - Intergenic
1049799102 8:144509569-144509591 TGGTGTGTGGGCTGCTTGCCGGG + Exonic
1055057213 9:72034954-72034976 AGGTGGGAGGATCACTTGCCAGG + Intergenic
1055468343 9:76587443-76587465 AGGTGGGAGCATCACTTGCCTGG - Intergenic
1057966163 9:99505406-99505428 AGGTGGGAGGATCACTTGGCCGG + Intergenic
1060821409 9:126663707-126663729 AAGCTTGTGGATCGCTTGCCAGG + Intronic
1060989691 9:127841294-127841316 AGGTGTGTAGATAGCCAGCCAGG - Intronic
1061723731 9:132569961-132569983 AGGTGGGCGGATCACTTGTCAGG - Intronic
1186031805 X:5376470-5376492 AGGGGTGTGGCTCGCTTGCTTGG - Intergenic
1186036412 X:5428545-5428567 AGGGGTGTGGCTCGCTTACTCGG + Intergenic
1187066364 X:15842796-15842818 AGGTGGGTGGATCACCTGTCAGG + Intronic
1187358320 X:18599926-18599948 AGGTGGGAGGATCGCTTGCCAGG - Intronic
1189915458 X:45851496-45851518 AGGTGGGTGGCTCGCCAGCCGGG - Intergenic
1190192680 X:48290848-48290870 AGGTGTGTGGCTAACTGGCCTGG - Intergenic
1192242857 X:69348653-69348675 AGGCATGAGAATCGCTTGCCCGG - Intergenic
1193069707 X:77295045-77295067 AGGGGTGTGGATGTCTTGCGAGG - Intergenic
1193204457 X:78731287-78731309 AGGTGTGTGGATTTCTTTCTGGG + Intergenic
1193283555 X:79684849-79684871 AGGTGTGTGGATTACTTTCTGGG + Intergenic
1193619478 X:83734056-83734078 AGGTGTGTGGATTTGTTTCCGGG + Intergenic
1193907676 X:87262416-87262438 AGGTGTGTGGATTTGTTTCCGGG - Intergenic
1195409823 X:104557792-104557814 AGGTGGGTGGATCACCTGTCAGG - Intergenic
1195975290 X:110520419-110520441 AGGTGTGTGTGTCGCCTGCTAGG - Intergenic
1196509872 X:116496421-116496443 AGGTGTGTGGATTTCTTTCTGGG + Intergenic
1197810025 X:130433067-130433089 AGGAGTGTGGAGCACTTTCCTGG - Intergenic
1198014418 X:132594051-132594073 TGGTGTGTGGAGCCTTTGCCAGG + Intergenic