ID: 929169887

View in Genome Browser
Species Human (GRCh38)
Location 2:38921034-38921056
Sequence AGTTAGCCTCAAGAACATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929169881_929169887 11 Left 929169881 2:38921000-38921022 CCTGACTGTAGAACTGTCCCTGC 0: 1
1: 0
2: 0
3: 12
4: 103
Right 929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
929169883_929169887 -6 Left 929169883 2:38921017-38921039 CCCTGCAGGTCAATTCCAGTTAG 0: 1
1: 0
2: 1
3: 5
4: 95
Right 929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
929169879_929169887 18 Left 929169879 2:38920993-38921015 CCGCCTTCCTGACTGTAGAACTG 0: 1
1: 0
2: 0
3: 19
4: 216
Right 929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
929169878_929169887 30 Left 929169878 2:38920981-38921003 CCTGGTGAAGAGCCGCCTTCCTG 0: 1
1: 0
2: 0
3: 13
4: 216
Right 929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
929169880_929169887 15 Left 929169880 2:38920996-38921018 CCTTCCTGACTGTAGAACTGTCC 0: 1
1: 0
2: 1
3: 6
4: 115
Right 929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 112
929169884_929169887 -7 Left 929169884 2:38921018-38921040 CCTGCAGGTCAATTCCAGTTAGC 0: 1
1: 0
2: 0
3: 13
4: 86
Right 929169887 2:38921034-38921056 AGTTAGCCTCAAGAACATAAGGG 0: 1
1: 0
2: 2
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929169887 Original CRISPR AGTTAGCCTCAAGAACATAA GGG Intronic