ID: 929172862

View in Genome Browser
Species Human (GRCh38)
Location 2:38948938-38948960
Sequence CTGTTCCATTGTAAGCGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929172856_929172862 20 Left 929172856 2:38948895-38948917 CCCCTCTGATCTGGACAGGGATT 0: 1
1: 0
2: 1
3: 14
4: 130
Right 929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 65
929172857_929172862 19 Left 929172857 2:38948896-38948918 CCCTCTGATCTGGACAGGGATTT 0: 1
1: 0
2: 0
3: 4
4: 144
Right 929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 65
929172858_929172862 18 Left 929172858 2:38948897-38948919 CCTCTGATCTGGACAGGGATTTC 0: 1
1: 0
2: 3
3: 6
4: 133
Right 929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 65
929172851_929172862 30 Left 929172851 2:38948885-38948907 CCTCCAAATTCCCCTCTGATCTG 0: 1
1: 0
2: 2
3: 16
4: 266
Right 929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 65
929172853_929172862 27 Left 929172853 2:38948888-38948910 CCAAATTCCCCTCTGATCTGGAC 0: 1
1: 0
2: 1
3: 8
4: 164
Right 929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929172862 Original CRISPR CTGTTCCATTGTAAGCGCTC AGG Intronic
903487922 1:23705284-23705306 TTGTTCCATTTTAAGTTCTCGGG - Intergenic
903729079 1:25476909-25476931 CTGTTCCATTGTGAGCACTGAGG + Intronic
904395611 1:30219449-30219471 ATGGTCCATTGTAAGGACTCTGG + Intergenic
911404758 1:97422665-97422687 CTGGTCCATAGTAGGTGCTCAGG - Intronic
920277361 1:204816581-204816603 CTGTTCCATTGATAGAGCACAGG - Intergenic
921210482 1:212892432-212892454 TTGTTCCATTGTTAGAGCTTAGG - Intronic
921273327 1:213491814-213491836 CTGTTCCACTGGATGCGCTGGGG - Intergenic
1065692821 10:28352991-28353013 GTGTTCCATTGTAAACCCGCAGG - Intergenic
1067190274 10:44062720-44062742 CTTTTCCATTTTAATTGCTCTGG - Intergenic
1071688770 10:87792901-87792923 CTTCTCCATTGTGAGCCCTCAGG + Intronic
1076356678 10:129858386-129858408 CTGTTCCATCGTAAGAGCCCTGG + Intronic
1086517894 11:87634865-87634887 CTATGCCATTGTCAGCGCTCAGG - Intergenic
1086619977 11:88875896-88875918 CTGTTCCATTTTTAGAGCACAGG + Intronic
1090948348 11:131451070-131451092 CTGTTCCATTTAAAGCACCCAGG - Intronic
1097160166 12:57040618-57040640 ATGTTCCCTTGTGAGCTCTCAGG - Intronic
1097426599 12:59453334-59453356 CTGTACTATTGTAATCACTCAGG + Intergenic
1097637028 12:62135110-62135132 CTTTTCCATGGTAAGCTCTATGG + Intronic
1097974977 12:65675685-65675707 CTTTTCCATTGTAAGATCACTGG - Intergenic
1100131185 12:91495719-91495741 CTGTTCCATTGCAGGGGCTGTGG + Intergenic
1100913997 12:99397395-99397417 CTGGCCCATTGTAAGCACTGAGG - Intronic
1103961934 12:124614322-124614344 CTGCTCCATTGGGAGCACTCAGG + Intergenic
1106582016 13:31026982-31027004 CTGGTGCATTGTAGGTGCTCAGG + Intergenic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1121723726 14:96130673-96130695 TTTGTCCATTGTAAGCGCACAGG - Intergenic
1128224313 15:65991249-65991271 CTGGTCCCTGGTAAGCTCTCGGG - Intronic
1129323832 15:74789260-74789282 CTGTTCCTTCGTAACCGCCCCGG + Intronic
1130114702 15:80996679-80996701 GTATTCCATTGTAAGCACTCCGG - Intergenic
1133721093 16:8495108-8495130 CTGTTCCATTCTAAGTGCTGCGG + Intergenic
1135233718 16:20735239-20735261 CTGTTTTATTGTAAGTACTCTGG + Exonic
1137793219 16:51192858-51192880 CAGTTCCAATGTCAGCACTCAGG + Intergenic
1146664412 17:34687947-34687969 CTGCTGCATTGTAGGTGCTCAGG - Intergenic
1152311686 17:79555225-79555247 CTGGCCCATGGTAAGCACTCGGG + Intergenic
1158413956 18:57232900-57232922 CTGATCTATTCTAAGCTCTCTGG + Intergenic
1160218231 18:76952921-76952943 CTGGTCCAAAGTAAGCACTCAGG + Intronic
1162846760 19:13398795-13398817 CTGATGCATAGTAAGTGCTCAGG + Intronic
1167459263 19:49615733-49615755 CTGTTCCCTTCTAGACGCTCTGG + Exonic
929172862 2:38948938-38948960 CTGTTCCATTGTAAGCGCTCAGG + Intronic
937424877 2:121790415-121790437 CTGTAGCATTGTCATCGCTCTGG + Intergenic
937907646 2:127060108-127060130 CTGTTCCACTGTTTGCCCTCAGG - Intronic
947713280 2:232327826-232327848 CTGATGCATTGAAAGCCCTCAGG - Intronic
948273507 2:236691505-236691527 CTGTTCCATTATAAGAACACTGG - Intergenic
1169274452 20:4224272-4224294 CTGTTCCAGTGGAAGTGGTCAGG + Intronic
1169322284 20:4643433-4643455 CTGTTCCATTTTTAGAGCACAGG - Intergenic
1174046108 20:47734999-47735021 CTGTGCCATTTTGAGGGCTCAGG - Intronic
1174757930 20:53177945-53177967 CTGGTGCATTGTAAGCACTCTGG + Intronic
1178186215 21:30224317-30224339 CTGGTTCATAGTAAGAGCTCAGG + Intergenic
950160166 3:10754481-10754503 CTCTTCCATTGTAGGCTTTCTGG - Intergenic
951838277 3:27005481-27005503 CTGTTCCTTTGTAGGGGCTAGGG - Intergenic
951983011 3:28586481-28586503 CTGTGCCTTTGTAGGCTCTCAGG + Intergenic
952857906 3:37787422-37787444 CTGTTCCATTTTGAGCACTATGG + Intronic
953229681 3:41053535-41053557 CAGTTCCATTGTGAGTGCTGTGG - Intergenic
955397592 3:58568131-58568153 CTTGTCCATTGTAAGAGATCTGG + Intronic
960953270 3:123013280-123013302 CTGCTACAGTGTAAGCTCTCAGG + Intronic
972609331 4:40642336-40642358 CTGGTCCATTGTAAGGACTTTGG + Intergenic
972699758 4:41482735-41482757 CTGCTCCATTGTAAGAGCTCAGG - Intronic
974234982 4:59169204-59169226 CTGTTCCATTTTTAGGGCACAGG + Intergenic
978965407 4:114734863-114734885 CTGTGGCATTGTAAGGCCTCAGG + Intergenic
982059430 4:151589484-151589506 CTTTTCCATTGTGAGCTGTCAGG + Intronic
987132382 5:14871758-14871780 CGGCTCCATTATAAGCGCTCTGG + Exonic
991210566 5:64099733-64099755 CTGTTACATTGTAAGGTTTCTGG - Intergenic
1003288126 6:4752788-4752810 CTTTTCCATTGCAAGCTCCCAGG - Intronic
1007603560 6:43099611-43099633 CTGTTAAATGGTAAGCTCTCTGG - Intronic
1010927645 6:81763331-81763353 CTGGTCCTTTGTAGGCACTCAGG + Intergenic
1018750544 6:166800413-166800435 GTGTTCCAGTGTATGCGCTGTGG - Intronic
1021855763 7:24853973-24853995 CTGTTCCCTAGTGAGCCCTCAGG + Intronic
1033803084 7:144923810-144923832 CTGATCCATTCTCAGTGCTCAGG - Intergenic
1036934211 8:12985340-12985362 CATTTCCATTGTAATCTCTCTGG + Intronic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1041848838 8:62363385-62363407 CTGTTCTACTATAAGGGCTCAGG - Intronic
1044423447 8:92024986-92025008 CTGATACATGGTAAGCACTCCGG + Intronic
1044834455 8:96281947-96281969 CTGGTGCATAGTAAGTGCTCAGG + Intronic
1044931607 8:97257515-97257537 GTGTCCAATTGTAAGTGCTCCGG + Intergenic
1188751628 X:33912095-33912117 CCTTTCCATTGTTAGAGCTCTGG - Intergenic
1198880695 X:141277888-141277910 CTGTTGCATTGTCAGAGGTCAGG - Intergenic