ID: 929174662

View in Genome Browser
Species Human (GRCh38)
Location 2:38964156-38964178
Sequence AAACCCTGCTTCACAAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 20, 1: 32, 2: 26, 3: 28, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929174659_929174662 20 Left 929174659 2:38964113-38964135 CCAATCTACTCTGTAATCTCATT 0: 1
1: 5
2: 15
3: 63
4: 406
Right 929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG 0: 20
1: 32
2: 26
3: 28
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929174662 Original CRISPR AAACCCTGCTTCACAAAGAT GGG Intronic