ID: 929174765

View in Genome Browser
Species Human (GRCh38)
Location 2:38965211-38965233
Sequence CTTAAATTATAGTCACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929174765 Original CRISPR CTTAAATTATAGTCACCTCA AGG Intronic
903689815 1:25165386-25165408 TTTAAATTATAGTCATGCCAGGG - Intergenic
905711177 1:40105238-40105260 CTTGAATTATAGTCTATTCAGGG - Intergenic
906205847 1:43985875-43985897 ATTAAATTCTGGTCACCTCTAGG - Intronic
907123282 1:52026597-52026619 CTTAAAATCTAGTCATCTTAAGG + Intronic
909061232 1:70881663-70881685 CTTCAATTATAGTCTGCTCCTGG + Intronic
911036864 1:93559711-93559733 CTGAGGTTGTAGTCACCTCAAGG + Intergenic
911826588 1:102493968-102493990 CTTCAAATATAGTCACATTAGGG + Intergenic
912415138 1:109503110-109503132 CTAAAAGTATATTCACCTAATGG - Intergenic
913498828 1:119452109-119452131 CTGAAACGAGAGTCACCTCAAGG - Intergenic
913510064 1:119553322-119553344 CTGAAATGAGGGTCACCTCAAGG - Intergenic
913513882 1:119586449-119586471 CTGAAATGAGGGTCACCTCAAGG - Intergenic
915783019 1:158575020-158575042 CCAAAATTATTGTCACCCCAAGG - Intergenic
917190190 1:172408623-172408645 CTTTACTTATATTCACCTCATGG + Exonic
917212742 1:172646696-172646718 CTTCAAATATAGTCACATTAGGG - Intergenic
918016669 1:180640681-180640703 GTTAAATTATATTTCCCTCAAGG + Intronic
918942620 1:191020979-191021001 CTTTAGTTATAGTTACATCAGGG - Intergenic
921474158 1:215585461-215585483 CATAAATGATGGTCACCTAAGGG - Intronic
922655360 1:227377742-227377764 CTAAAATTAAAGCAACCTCAAGG + Intergenic
923024679 1:230195172-230195194 CAGAAATTATAGCCACCTCTCGG - Intronic
1063090739 10:2864364-2864386 CTTGAGATAAAGTCACCTCAGGG - Intergenic
1063611351 10:7564165-7564187 ATTAAAATGTAGTCACCTGAGGG - Intronic
1065312284 10:24428024-24428046 CCTAAACTATAGTTACCTCAGGG - Intronic
1068854457 10:61783285-61783307 CCTAAATTACAGCCACCTCCTGG + Intergenic
1071480126 10:86058839-86058861 CCTAAATTATAAGCTCCTCAAGG - Intronic
1077750708 11:4965332-4965354 ATTAAATTATAGATACCTAAAGG + Intronic
1078181656 11:9016710-9016732 CTTAAATTGTAGGCAGCTGATGG + Intergenic
1078914614 11:15767538-15767560 CTTAAAGTATGGTCATCTCTTGG + Intergenic
1078959142 11:16243130-16243152 CATAAATTCTCGTCCCCTCAAGG + Intronic
1079741475 11:24067319-24067341 TTTTAATTATATTCACATCAAGG + Intergenic
1080228051 11:29983240-29983262 CTTGAATTATAATCCCCACATGG - Intergenic
1080764583 11:35283410-35283432 CCTAAATTGTAGACACCACAAGG - Intronic
1086807204 11:91258845-91258867 CTTAAACTGTGGTTACCTCATGG - Intergenic
1087792915 11:102426002-102426024 ATTAAATTTTAAGCACCTCATGG + Intronic
1092318715 12:7447758-7447780 CTTCAAATATAGTCACATTAGGG - Intronic
1092443673 12:8532932-8532954 CTTAAATTATAGCCACCTTCAGG + Intergenic
1092701131 12:11232035-11232057 GTTAAAGTCTAGTCAACTCAAGG - Intergenic
1093640370 12:21520541-21520563 CAGAACTCATAGTCACCTCATGG - Intergenic
1093897281 12:24588531-24588553 ACTAAATTATAGTTACCCCATGG + Intergenic
1094782109 12:33802950-33802972 CTTATTTTATAGGCACCTGAAGG + Intergenic
1098988979 12:77044033-77044055 CTGAAATTACAGTCACCCTATGG - Intronic
1100310697 12:93392180-93392202 CTTAAGTTAAAATCAACTCAAGG - Intronic
1100490759 12:95075480-95075502 ATGAAAGTATAGTCACGTCAGGG + Intergenic
1100791551 12:98135760-98135782 TTTAAATTATAGTAACTTAAAGG - Intergenic
1101872365 12:108576759-108576781 TTTAAAATATGATCACCTCAAGG + Intergenic
1105660491 13:22488937-22488959 CTTAGATTATAATATCCTCAAGG - Intergenic
1108763292 13:53596402-53596424 ATTAATTTGTAGACACCTCATGG - Intergenic
1109585018 13:64388533-64388555 ACTAAATTATAGTTACCTAAGGG - Intergenic
1111436555 13:88217315-88217337 TTTAAATTTGAGTCACCTCAAGG - Intergenic
1112657833 13:101471363-101471385 ATTAAATTATATACTCCTCAAGG + Intronic
1113022357 13:105901791-105901813 TTTAAATTTTAATCACCTAAGGG + Intergenic
1116463490 14:45205969-45205991 GTTACATTATAATCACCTCAGGG + Intronic
1117746530 14:58875354-58875376 TTTAAAAAATAGTCACCTTAAGG + Intergenic
1118504718 14:66398726-66398748 TTAAAATTATATTCACCTTATGG - Intergenic
1118673673 14:68159164-68159186 CTTTAATAATTGTCAACTCATGG - Intronic
1119150603 14:72356172-72356194 CTCAAATTATAATCCCCACATGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1119689434 14:76659761-76659783 GTTAAATCATAGCCTCCTCAGGG + Intergenic
1121921157 14:97882894-97882916 TTTAACTTATAGTCACCTTCTGG - Intergenic
1124140717 15:27074561-27074583 CTGAAATTAGAGCCACCTCCTGG - Intronic
1124622506 15:31282220-31282242 CTTCAAATACAGTCACCACAGGG + Intergenic
1131906367 15:97147418-97147440 CTTGAATTGGTGTCACCTCAGGG - Intergenic
1132051393 15:98610511-98610533 CTTGAATTCTAATCACCTGAAGG - Intergenic
1137880255 16:52038728-52038750 TTTATATTACAGTTACCTCAGGG - Intronic
1140963845 16:79944720-79944742 CTAAGATTAGAGTCACCTGAAGG + Intergenic
1146390447 17:32417375-32417397 CTTGAATTAAAGATACCTCATGG - Intergenic
1152398498 17:80049725-80049747 CACAAATTAAAGGCACCTCATGG - Intronic
1153268519 18:3295903-3295925 CTTCAATAATAATCAGCTCATGG + Intergenic
1156387938 18:36623700-36623722 GTTAAATTATCGTCACCTATGGG + Intronic
1156586727 18:38439068-38439090 CTTAAATTATACTAACACCACGG - Intergenic
1156682752 18:39610794-39610816 GTTAAATTATTGTCACTTTAAGG - Intergenic
1156758321 18:40555977-40555999 TTTAAATTAGAGAAACCTCATGG - Intergenic
1158337296 18:56426614-56426636 CTTCAATTCTAATCAGCTCATGG - Intergenic
1159197085 18:65131212-65131234 CTTCACTTCTAGTCTCCTCATGG + Intergenic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1164130113 19:22354373-22354395 CTCAAATTATGCTCACCTGATGG - Intergenic
1164952471 19:32348856-32348878 CTAAAAATATAGTCATGTCATGG + Intronic
1165966855 19:39588785-39588807 GATAATTTGTAGTCACCTCATGG - Intergenic
1165978397 19:39697730-39697752 GATAATTTGTAGTCACCTCATGG - Intergenic
925016459 2:529378-529400 TTCAAATTATACTCACCTTAAGG - Intergenic
929174765 2:38965211-38965233 CTTAAATTATAGTCACCTCAAGG + Intronic
929638772 2:43553794-43553816 TTTAAATTATAGTCATCCTATGG + Intronic
929746445 2:44664599-44664621 CTTAAATTATAAACACCTTAGGG - Intronic
934067877 2:88356090-88356112 CTTCAATAATTGTCAACTCATGG - Intergenic
939462472 2:142514480-142514502 CTTAAAACAGAGTCACATCATGG + Intergenic
939676133 2:145074164-145074186 CTTGACTTATAGTAACCTGAAGG + Intergenic
940480935 2:154229950-154229972 CTCAAAATATATTCTCCTCATGG - Intronic
941316534 2:163999918-163999940 CTTACATAAAAGTCACTTCAGGG + Intergenic
941566549 2:167115592-167115614 CTTCAATTCTAGTCTACTCATGG + Intronic
941713327 2:168738009-168738031 CTTTAATAATAATCAACTCATGG - Intronic
942267872 2:174246622-174246644 CTTAAAGTTTAATTACCTCACGG + Intronic
943258975 2:185633014-185633036 CTTATATTATTGTCACCTGGGGG - Intergenic
943463679 2:188201606-188201628 TTTAAATAATATTCACCTAAAGG + Intergenic
943626000 2:190200343-190200365 CTTAGATTTTAGTCATCTGAAGG + Exonic
945310411 2:208305749-208305771 TTTAAATTATAGTCCTATCATGG + Intronic
1168786085 20:541756-541778 TTTAAAGAAAAGTCACCTCACGG + Intronic
1174108594 20:48181541-48181563 CCTAAAATATAGCCAACTCAGGG - Intergenic
1175364901 20:58446283-58446305 AGTAAATTTTAGTCCCCTCACGG - Exonic
1176929496 21:14791166-14791188 CTCAAATTTTAGTAACATCAAGG - Intergenic
1177654111 21:23994895-23994917 CTCAAAATATAGTCACATCTGGG + Intergenic
952018480 3:28988269-28988291 ATTAAAGTATACTCACCTGATGG - Intergenic
955814683 3:62829471-62829493 ATGAAATTATAGTCATCTCTTGG - Intronic
956975002 3:74569002-74569024 CTTAAATTCTTCTGACCTCATGG - Intergenic
957292328 3:78293714-78293736 CTTCAATGCCAGTCACCTCATGG + Intergenic
958421042 3:93931856-93931878 CAAAAATTAAAGTCAGCTCATGG - Intronic
959099744 3:101996981-101997003 CTTCAATCATAATCACCTAACGG - Intergenic
959228854 3:103620648-103620670 CTTGAATTGTAGTTCCCTCATGG - Intergenic
965463751 3:169001425-169001447 CTTAATTTTTATTTACCTCAAGG - Intergenic
966642001 3:182202342-182202364 ATTAAATTATAAAAACCTCATGG - Intergenic
969109164 4:4831057-4831079 CTTCAAATATAGTCACATCTGGG - Intergenic
970051260 4:11917380-11917402 CTTAAATTTTGGTGTCCTCAAGG - Intergenic
971937577 4:33172241-33172263 CTCTAATTATAGTCACCACAGGG - Intergenic
974686178 4:65233174-65233196 CTTAGATTAGAGTCCTCTCATGG + Intergenic
974765169 4:66335196-66335218 ATTAAATTATATTCTCCACAAGG + Intergenic
978077486 4:104550966-104550988 CCTAAATTATATTCACATCTTGG + Intergenic
978132107 4:105211481-105211503 CCTAAATGCTGGTCACCTCAGGG - Intronic
978228154 4:106363964-106363986 GATATAATATAGTCACCTCAAGG - Intergenic
979833672 4:125333655-125333677 CTTAAAATAAAGTCTCCTTAAGG - Intronic
980541192 4:134199230-134199252 CCTGAATTATAGTCAACTAATGG + Exonic
980712423 4:136587661-136587683 GTAAAATTATTGTCACCTCTTGG - Intergenic
984043392 4:174766813-174766835 ATTAAATTACAGTCACCTGCAGG - Intronic
984355463 4:178653177-178653199 CTTAAATTATAGTCAGAAAATGG - Intergenic
984987931 4:185349772-185349794 CTTAAATTATATTCAAATGAAGG - Intronic
987476785 5:18400240-18400262 CTTCAATTATACAGACCTCATGG - Intergenic
990542248 5:56785419-56785441 CTTAAATTTAAGTTTCCTCAAGG + Intergenic
992446478 5:76838808-76838830 AATAAATTATAGTCCTCTCAGGG - Intergenic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
1004485666 6:16063976-16063998 GTCAAATTATACTCACTTCATGG - Intergenic
1008864597 6:56194221-56194243 TTTAAATTATAATAACATCAGGG - Intronic
1010291754 6:74145704-74145726 CTGCAATTATAGTCACTTGATGG + Intergenic
1010958853 6:82122705-82122727 TTTAAATTATTTTCACTTCATGG + Intergenic
1011004725 6:82631373-82631395 TTTAAATAATACTTACCTCATGG - Intergenic
1012458623 6:99435156-99435178 CTTAACTTAAAATCATCTCAGGG - Exonic
1012794432 6:103741507-103741529 CTTAATTTAGAATGACCTCATGG - Intergenic
1015492446 6:133841320-133841342 CTTAAATTTTAAACACATCAAGG - Intergenic
1016719704 6:147281688-147281710 CTTAAATTATAATCAGTTCTTGG - Intronic
1020443729 7:8246566-8246588 GTTACAATATATTCACCTCATGG + Intronic
1024316541 7:48024473-48024495 TTTAAATTACAGCCACCTGATGG - Intronic
1025943668 7:66090660-66090682 CTTCAATGATAATCAACTCACGG + Intronic
1026645344 7:72162820-72162842 CTTAAGTTCTAACCACCTCATGG - Intronic
1027612505 7:80378589-80378611 CTCAAATTATAGTCAGCTTTGGG - Intronic
1027750231 7:82134387-82134409 CTAAAATTATAGTCATCCTAGGG - Intronic
1030397439 7:109004585-109004607 CTTAAATTTTAATCTCCTGAAGG + Intergenic
1031158386 7:118137057-118137079 CTGAAGCTATAGTCATCTCAAGG - Intergenic
1031382760 7:121108441-121108463 CTTAACATATAGTCATCTGAGGG - Intronic
1032623725 7:133565308-133565330 CAATAATTATAGTCTCCTCATGG + Intronic
1033895073 7:146058615-146058637 TTGCAATCATAGTCACCTCAGGG + Intergenic
1034148855 7:148897559-148897581 ATAAAATGATAGTCACTTCATGG + Intergenic
1036928472 8:12930442-12930464 CATAAATTCTGGTCACCTGAGGG + Intergenic
1037602262 8:20407062-20407084 CTTCAAATACAGTCACATCAGGG - Intergenic
1039282719 8:36004407-36004429 CATAAACTATAGTCATGTCATGG + Intergenic
1039957674 8:42219730-42219752 TTTAAAGTATAGTCAGGTCAAGG - Intergenic
1040726344 8:50385829-50385851 CTTCAATTAGAGTCACCACCTGG + Intronic
1042095789 8:65214412-65214434 CTGAAACTATAGTAGCCTCAGGG + Intergenic
1042298559 8:67250004-67250026 CTTAAATTATTTTCTCTTCAGGG - Intronic
1043007246 8:74834779-74834801 CATAAATTCTAGGCATCTCATGG - Intronic
1043013762 8:74912307-74912329 CTTAGAGTCTAGTCACCACAGGG + Intergenic
1043434736 8:80227208-80227230 CTTAAATTTTAGTCACATGGAGG - Intronic
1043970566 8:86524056-86524078 CTTATATAATAGTCTCCTAATGG - Intronic
1045553610 8:103194531-103194553 TTTAAATTTTAGTTACCTCCAGG - Intronic
1045584449 8:103517086-103517108 ACTAAATTATAAGCACCTCAAGG - Intronic
1047426623 8:124752392-124752414 CTTTATTCAAAGTCACCTCACGG + Intergenic
1047443051 8:124896105-124896127 CTCAATTCATAGTCACCTCCTGG + Intergenic
1048113541 8:131494130-131494152 CTCAAATTAAAGTCACCTACTGG - Intergenic
1049388410 8:142355697-142355719 CTTAAGTTCTAAACACCTCAGGG + Intronic
1050589103 9:7144442-7144464 GTTAAATTATAGGCAGCTCTTGG + Intergenic
1051025889 9:12610293-12610315 AAATAATTATAGTCACCTCAAGG - Intergenic
1188301696 X:28512326-28512348 CTTAAATTATAAAAACCCCATGG + Intergenic
1188642060 X:32518698-32518720 CTTAAAACATGATCACCTCAAGG - Intronic
1190448068 X:50550869-50550891 CTCAAAATAAAGTCACATCAAGG + Intergenic
1192865371 X:75125989-75126011 TATGAATTTTAGTCACCTCATGG - Intronic
1194051476 X:89074410-89074432 CATAGATTATAGTGTCCTCATGG + Intergenic
1197739941 X:129882965-129882987 CTTATATTATGGTCAGCTGATGG - Intergenic
1198146453 X:133862343-133862365 CATAAATGATAGCCATCTCATGG + Intronic
1199008423 X:142730034-142730056 CTGAAATTAGAGTCACCACCTGG - Intergenic
1199179574 X:144837819-144837841 GTTAATTTATAGTCACCCTATGG + Intergenic