ID: 929175641

View in Genome Browser
Species Human (GRCh38)
Location 2:38972612-38972634
Sequence CATTATTCAAAGAAAGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 486}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929175641 Original CRISPR CATTATTCAAAGAAAGAAGT TGG (reversed) Intronic
901179810 1:7333895-7333917 CATTTATCAAGGAAAGAGGTGGG + Intronic
903431839 1:23310378-23310400 CATTCTTCAAAAAAAAAAATTGG - Exonic
904681489 1:32232530-32232552 CATGAGCCAAAGAAAGAAGGCGG + Intergenic
905128245 1:35731301-35731323 CATTAGTCAGACAAAGAAGGAGG + Intronic
906028961 1:42701414-42701436 CATTATTTCAAAAAGGAAGTGGG + Intronic
906702489 1:47870040-47870062 CATTATTCAAGGTAAGAAATGGG - Intronic
906866304 1:49424275-49424297 CATTCTTTATAGAAAGAATTTGG - Intronic
906892722 1:49735392-49735414 CATGAGTCAAAGAATGCAGTCGG + Intronic
907342145 1:53742908-53742930 AATGATTCATAGGAAGAAGTAGG - Intergenic
907423820 1:54365789-54365811 CAGATTTCAAGGAAAGAAGTGGG - Intronic
907655125 1:56334308-56334330 CATTATCCAAAGAAGGAATGAGG - Intergenic
907819486 1:57953183-57953205 CATTTTTCAGATAAAGAAGCTGG - Intronic
908919513 1:69172382-69172404 CATGATTAAGAGAAAGAAATGGG + Intergenic
908926536 1:69261988-69262010 CATGACTGAAAGAAAGAAGTTGG + Intergenic
909655371 1:78025957-78025979 CACTATTCATTGAAAGAAATTGG - Intronic
909682322 1:78306020-78306042 CATTATTCAAGAAAATAAATTGG + Intronic
909900865 1:81133053-81133075 CATTCTTGAAAGAGAGAAGAAGG - Intergenic
910489156 1:87748993-87749015 GTTTATTTAAAGGAAGAAGTTGG - Intergenic
910553712 1:88506078-88506100 CATTTTTAAAATAAAGAAGATGG - Intergenic
910791189 1:91052900-91052922 CTTTATGCAAAGAAAGACTTAGG + Intergenic
910830033 1:91451766-91451788 CATTATTCAAATAAAGAAACAGG + Intergenic
911422168 1:97656894-97656916 CAATATTCCAAGAATGAACTTGG + Intronic
911444653 1:97976167-97976189 CTTTATTCAAGGAAAGAATGGGG + Intergenic
911775319 1:101803785-101803807 CATTTTTTAAAGAAATAAATGGG + Exonic
913573334 1:120143343-120143365 CATTTTTCAAAGAAACATATAGG + Intergenic
914294590 1:146308140-146308162 CATTTTTCAAAGAAATATATAGG + Intergenic
914555634 1:148758923-148758945 CATTTTTCAAAGAAATATATAGG + Intergenic
914674539 1:149898658-149898680 CATTTTTCAAAATGAGAAGTTGG + Intronic
914980013 1:152406290-152406312 CATTATTCAAAAATAGAAATAGG - Intergenic
916344932 1:163777026-163777048 CATTATTAAAAGAAAAGAATGGG - Intergenic
916935334 1:169621852-169621874 CACAATTCAGAGAAAGCAGTGGG - Intronic
917044583 1:170844383-170844405 TATTTTTCAAAGAAAGAAATAGG + Intergenic
917057371 1:170997766-170997788 CATCATTCAAAGGAAGAGCTTGG + Intronic
917376965 1:174359079-174359101 CATTATACATAGAAAAAAATAGG - Intronic
917858957 1:179126791-179126813 CATTATTTAAAAAAAAAATTTGG - Intronic
919103377 1:193121235-193121257 CATCATCCAAAGAATGAAGAGGG + Intergenic
919560331 1:199110234-199110256 CATTATTTAAAGAATGAGGATGG + Intergenic
920639340 1:207736556-207736578 CATTATTAAAAATAAGAAATAGG + Intronic
920717706 1:208356393-208356415 CATTCATCAAAGTAAGAAATAGG + Intergenic
921943293 1:220865949-220865971 AATTAATAACAGAAAGAAGTTGG - Intergenic
922039256 1:221880196-221880218 CATTTTACAAAGAAAGAGGCTGG + Intergenic
922093495 1:222420587-222420609 CCTTCTTCAAAGAAAGAGCTAGG + Intergenic
923470902 1:234289963-234289985 AAGTTTTCAAAGAAAGAAGAGGG + Intronic
923980953 1:239323027-239323049 CATTTTTCAATGAAAAAATTAGG - Intergenic
924766502 1:247036350-247036372 CTTAATTCAAAGTAAAAAGTGGG + Intergenic
1062797563 10:356335-356357 AAGGATTCAAAGAAAGAAGCAGG + Intronic
1063057103 10:2517782-2517804 CATTATTCCTAGAAAAAAGTAGG + Intergenic
1064410293 10:15098519-15098541 CAGTATTAAAAGAAATAAGTTGG - Intronic
1064534502 10:16344831-16344853 CATTATCCAAATAAAGTATTTGG - Intergenic
1064765070 10:18662480-18662502 TATTATTCAAGGAAATAATTTGG + Intronic
1064792887 10:18978898-18978920 CATTATTCAAATAAGGCACTAGG - Intergenic
1065216423 10:23453111-23453133 CATTATTCAAATGATGAAGCTGG - Intergenic
1065488835 10:26261379-26261401 CATTTTACAAGGAAAGAAGGAGG - Intronic
1065900573 10:30204078-30204100 GATTATTCAAAGCAAAAATTAGG + Intergenic
1066569823 10:36758892-36758914 CATTATTCTAAGAAAGCTGCTGG - Intergenic
1067377426 10:45740819-45740841 CATTGTTCAAAGAGACAATTGGG + Intronic
1067885131 10:50081504-50081526 CATTGTTCAAAGAGACAATTGGG + Intronic
1068139654 10:52990199-52990221 GATGATACAAAGGAAGAAGTTGG - Intergenic
1068274585 10:54776911-54776933 GTTTATACAAAGAAAGAACTAGG + Intronic
1068689129 10:59898160-59898182 CATTATTCCATGAAAGAAACAGG + Intronic
1068776605 10:60874327-60874349 GATTATTCTGAGAATGAAGTGGG - Intronic
1069313552 10:67069353-67069375 AAATATTCAAATAAAGAAGTTGG - Intronic
1069402550 10:68064251-68064273 AATAATTAAAAGAAAGAAATAGG + Intronic
1071804765 10:89106103-89106125 CATTTTTTAAAGAAAGATTTTGG + Intergenic
1072024888 10:91445561-91445583 CATTATACAATGAAAGAAGAGGG + Intronic
1073388936 10:103155861-103155883 CATTATTTAAAAAATGAATTTGG + Intronic
1073551025 10:104401457-104401479 CAAGATTTAAAGAAAGAAGAAGG - Intronic
1073784766 10:106877279-106877301 CTCTATTCAAAGAATAAAGTGGG + Intronic
1073805181 10:107090056-107090078 CATTATAGAATGAAAGAAGGTGG + Intronic
1074215867 10:111383153-111383175 AATTATCCAAAGAAATAATTTGG + Intergenic
1074648839 10:115495256-115495278 TATATTTCAAAGAATGAAGTGGG + Intronic
1075322750 10:121505310-121505332 CAGTATTAAAATAAAGAAGTGGG + Intronic
1075595092 10:123723430-123723452 AATAATTCAAAGAAAGACTTTGG - Intronic
1077072420 11:681708-681730 AATTATTTAAAAAAAAAAGTCGG - Intronic
1077267512 11:1659160-1659182 CTTTTTTTAAAGAAAGAAGTTGG + Intergenic
1077448316 11:2614575-2614597 CATATATCAAAGAATGAAGTTGG - Intronic
1078005053 11:7526400-7526422 TAAAAGTCAAAGAAAGAAGTTGG + Intronic
1078005249 11:7527633-7527655 TAATATTCAGAGAAAGATGTTGG + Intronic
1078005444 11:7529084-7529106 AAATATTCAGAGGAAGAAGTTGG + Intronic
1078648910 11:13168882-13168904 GATCAGTCAAAGCAAGAAGTGGG + Intergenic
1078858042 11:15222301-15222323 CACTTTTAAAAGAAAGAGGTGGG - Intronic
1078865955 11:15297341-15297363 CATGGTACAAAAAAAGAAGTTGG - Intergenic
1079621377 11:22559206-22559228 CATTATTCAAATAAAACAATAGG + Intergenic
1079749991 11:24185202-24185224 CTTTATTGAAAGAAAGAAAGAGG + Intergenic
1079899821 11:26168413-26168435 CAGTATTCACAGGAAGAATTTGG + Intergenic
1080822041 11:35816652-35816674 CATTTTCCAAAGACAGAAGACGG - Exonic
1081328847 11:41779460-41779482 CAATATTTAAAGAAAGAAAGTGG - Intergenic
1082988100 11:59185100-59185122 AATTATTCAGAGACAGAAGCAGG + Intronic
1083348047 11:62007381-62007403 CATGTTCAAAAGAAAGAAGTTGG + Intergenic
1083760807 11:64816326-64816348 CATTTTTAAAAGTAAGAAGCCGG + Intergenic
1085362770 11:75906720-75906742 CACTTTTAAAAGAATGAAGTTGG - Intronic
1085560280 11:77466194-77466216 AAATATTCAAGCAAAGAAGTTGG + Intronic
1085600373 11:77850629-77850651 CATTTTTCAAAATAAAAAGTTGG - Intronic
1085842106 11:80024078-80024100 GATTATTCAAAGAAAAAACATGG + Intergenic
1086016743 11:82177196-82177218 CATTTTACAAATAAAGAAATTGG - Intergenic
1086846084 11:91751363-91751385 CATTTTTGAGAGAAGGAAGTGGG - Intergenic
1087057590 11:93948538-93948560 CATTTATCAAAGAAAAAAGGAGG - Intergenic
1087364722 11:97203745-97203767 CAGTATCCAAAGAAAAAAGTAGG + Intergenic
1087745986 11:101947375-101947397 CAATATTTAGAGAGAGAAGTAGG + Intronic
1087950967 11:104219836-104219858 CATTATACAAATAAAGAAACTGG + Intergenic
1088165748 11:106934594-106934616 CAATTTTCAAAGAATAAAGTAGG - Intronic
1088620825 11:111681619-111681641 CAATTTTCAAAGTAAGGAGTTGG - Intronic
1089538995 11:119178635-119178657 CATTAGCCAAAGGAAGAAGTTGG + Intronic
1090422267 11:126583649-126583671 CATTTTACAAAGAAGGAAGCAGG - Intronic
1091214563 11:133892827-133892849 CATTATGCAGAGAACCAAGTAGG - Intergenic
1091416360 12:289552-289574 CATTTCTCAAAAAAAGAGGTGGG + Intronic
1091865466 12:3831848-3831870 CATTAATAAAAAAAAGCAGTAGG - Intronic
1092457249 12:8654993-8655015 CAGTATCCAAAGATAGAAGCAGG + Intronic
1093115940 12:15211121-15211143 CATTAATCAAGGTAAGAAGAGGG - Intronic
1093146439 12:15572225-15572247 AATTATTCCAACAAAGTAGTTGG - Intronic
1093786008 12:23192919-23192941 TATTTTTCAAAGAAGGAAATTGG - Intergenic
1094760968 12:33532326-33532348 AAAAAGTCAAAGAAAGAAGTGGG + Intergenic
1095333230 12:40994183-40994205 CAAAATTCCAAGAAAGAAGGAGG + Intronic
1095380885 12:41590236-41590258 CATTATTCTAGAAAAGAATTCGG + Intergenic
1095562303 12:43580429-43580451 CATTATTCAAAAAAATACATAGG - Intergenic
1095622830 12:44279116-44279138 CCTTATTAAGAGAAAGTAGTTGG - Intronic
1095691477 12:45094322-45094344 CATGATTCAAGGAAAGAAGAGGG + Intergenic
1095837596 12:46655374-46655396 AATTATTCACAGAAAGCAGAGGG + Intergenic
1096332199 12:50723480-50723502 CATTATTCAGTGAAGGAACTGGG + Intronic
1096358189 12:50960550-50960572 CATTTTTCAAAGAACCAAGCTGG - Intronic
1097492157 12:60283402-60283424 CATTATTCAAATAAATATGAAGG + Intergenic
1097561852 12:61217046-61217068 CTTTATGTAAAGAAAAAAGTTGG + Intergenic
1097703274 12:62842009-62842031 CCTTATTTAAATAAGGAAGTTGG - Intronic
1097849393 12:64396568-64396590 CATCATTCAAAGCAAGAAGAGGG + Intergenic
1097864810 12:64551044-64551066 CCTTATTCAAATTCAGAAGTAGG + Intergenic
1098362604 12:69669318-69669340 AATTGTTCAAAGAAACAATTAGG - Intronic
1098808747 12:75056121-75056143 CATGACTTAAAGCAAGAAGTAGG + Intronic
1099839071 12:87943311-87943333 CTTTATTCTAAGAAAGAAAGGGG + Intergenic
1100217836 12:92470792-92470814 AATTATTTAAATAAAAAAGTGGG - Intergenic
1100809868 12:98327266-98327288 CATGATTTTAAGAAAGAAGAAGG + Intergenic
1101622736 12:106405162-106405184 CAGGATTGAAAGAAAAAAGTTGG - Intronic
1103600326 12:122050650-122050672 CATTTTACAAACAAGGAAGTAGG - Intronic
1103814562 12:123643610-123643632 GAATATCCAAAGAAAGAAGTGGG - Intronic
1104007286 12:124902440-124902462 CTGTATTCAAAGGAAGAAGCAGG - Intergenic
1104125434 12:125841542-125841564 CTTTATTCAAAGAAACCATTAGG + Intergenic
1105722378 13:23129215-23129237 GATTGTTCAAAGGAAGGAGTAGG + Intergenic
1106800284 13:33249463-33249485 AATCATTCAAAGAAAGGAGGTGG - Intronic
1107776367 13:43847436-43847458 CCATATTTAAAAAAAGAAGTGGG + Intronic
1108991917 13:56669890-56669912 CATTTTACAAACAAAGAAGGAGG - Intergenic
1109863168 13:68226424-68226446 CATTTTTCAAAATAAGAAGCTGG + Intergenic
1111598494 13:90441685-90441707 CCATATTCAAAGACAGGAGTTGG - Intergenic
1112155107 13:96808724-96808746 CATAATTTCAAAAAAGAAGTAGG + Intronic
1112246649 13:97741280-97741302 CATTTTACACAGAAAGATGTAGG - Intergenic
1112403232 13:99094411-99094433 GATTATTCTAAAAATGAAGTAGG - Intergenic
1113119665 13:106912708-106912730 CATTTTACAAAAAAAGAGGTAGG + Intergenic
1114862733 14:26545477-26545499 CAGTTTTCAAGGAAAGAAATGGG + Intronic
1115193457 14:30771393-30771415 CAATATTTAAGGAAAGAACTTGG - Intergenic
1116145053 14:41055480-41055502 AATAATTCAAAGAAAAAAATTGG - Intergenic
1116220501 14:42079918-42079940 AATTAATCAAAGAGAGATGTAGG - Intergenic
1116256659 14:42565475-42565497 CATTATTAAAAAAAAAAGGTAGG - Intergenic
1117735265 14:58762646-58762668 AATTTTTCAAAGATTGAAGTGGG - Intergenic
1117953623 14:61106420-61106442 CATTGTTCAGAGGAAGAAGACGG + Intergenic
1117976414 14:61301359-61301381 CATTTTTCAAATAAAGTTGTAGG + Intronic
1117998930 14:61505124-61505146 CATTCAGCAATGAAAGAAGTGGG - Intronic
1118343620 14:64917130-64917152 CTTATTTCAAAGAAAGAATTAGG + Intronic
1119046911 14:71326507-71326529 CATTATAAAAAGAAGCAAGTCGG - Intronic
1120427794 14:84372506-84372528 CATCACTCAAAAAAAGAATTTGG - Intergenic
1120445550 14:84590772-84590794 GATTATTTTAAAAAAGAAGTAGG - Intergenic
1120671487 14:87367251-87367273 AATTTTTCAAAGAAATAAGTGGG - Intergenic
1121653659 14:95578791-95578813 CAATATTTAAAAAAAGAAGAAGG - Intergenic
1121734067 14:96205748-96205770 CTTTATGCAAAGATAGAGGTAGG + Intronic
1122086575 14:99311775-99311797 CACTAGTCAAAGAAGGAAATGGG - Intergenic
1202893993 14_KI270722v1_random:185431-185453 CATAATTCACAGAAAGAGTTGGG - Intergenic
1202943214 14_KI270726v1_random:2713-2735 AAGGATTCAAACAAAGAAGTAGG + Intergenic
1123576928 15:21679877-21679899 GATAATTCAAAGATGGAAGTGGG + Intergenic
1124911423 15:33924814-33924836 CATTATTTGAAGAAAGACATAGG + Intronic
1127171592 15:56308748-56308770 CCTTATACAAAAAATGAAGTTGG - Intronic
1127371239 15:58343796-58343818 GATTCTTCAAAGAAAGAAATTGG + Intronic
1127868554 15:63051120-63051142 CATTATTTAAAGAAAAAGGCAGG + Intronic
1130527580 15:84720613-84720635 AATTATTCAAAACAAGAAGTGGG + Intergenic
1130801686 15:87271031-87271053 CATTCTTCAAAAAAGGAACTAGG + Intergenic
1131172584 15:90189102-90189124 CATGAATGAAAGAAGGAAGTGGG + Intronic
1131745020 15:95438077-95438099 CCTTATACATAGAAAGTAGTTGG + Intergenic
1202985796 15_KI270727v1_random:414122-414144 GATAATTCAAAGATGGAAGTGGG + Intergenic
1133803017 16:9099495-9099517 CCTTATTCAAAAAAGGAACTGGG - Intronic
1133850715 16:9500790-9500812 TATTATGAAAAGAATGAAGTTGG - Intergenic
1134318913 16:13144865-13144887 CATTATACAAAGAAAGAAGGGGG + Intronic
1134427582 16:14165996-14166018 CATAGTTGAAAGTAAGAAGTAGG + Intronic
1134839265 16:17388521-17388543 CATTTTGCAGAGGAAGAAGTTGG - Intronic
1135578924 16:23608659-23608681 CCTTATTCATAGAGAGTAGTAGG - Intronic
1135704051 16:24659158-24659180 AATTATTCTAAGAAATAAGAAGG - Intergenic
1137783316 16:51115784-51115806 AATTCTTAAAAGAAAAAAGTTGG - Intergenic
1138061618 16:53897301-53897323 CGGTATTAAAAGAAACAAGTAGG - Intronic
1138119981 16:54392425-54392447 CATTACTTGAAGAAAGAATTTGG + Intergenic
1138160684 16:54750448-54750470 CATTAGTCCAAGAAGGATGTGGG + Intergenic
1138569875 16:57863375-57863397 CACTATGCAAAGCAAAAAGTAGG + Intergenic
1138894311 16:61184328-61184350 CTTTCTTCTAAGAAATAAGTTGG - Intergenic
1139411832 16:66768420-66768442 GATTATAAAAAGAAGGAAGTAGG + Intronic
1140309935 16:73839675-73839697 CCTAAGTCAAAGAAAGAAGGAGG + Intergenic
1140611150 16:76600646-76600668 GGTTATTTAAAGCAAGAAGTAGG + Intronic
1140959370 16:79897432-79897454 AATTATGCAAATAAAGAAGCTGG - Intergenic
1140990885 16:80210325-80210347 CACTATGCAAAAAAAAAAGTAGG + Intergenic
1141020631 16:80492777-80492799 CATTATTCACATAAAAAAGTGGG + Intergenic
1141891327 16:86928644-86928666 CAATATTCAAAGACACACGTGGG - Intergenic
1142315545 16:89342312-89342334 CATCCTTCAAAGATAGAAGCTGG - Intronic
1142889558 17:2933953-2933975 CATTTTTCCAAGAAACAACTGGG - Intronic
1143231992 17:5364224-5364246 AATTAGTCAGAAAAAGAAGTGGG + Intronic
1143600899 17:7945196-7945218 CATAATTAAAAGAAGGAAGTGGG - Intronic
1143858088 17:9867494-9867516 TCTTATACAAAGAAAGAGGTGGG - Intronic
1144068949 17:11650046-11650068 AATAATTAAAAGAAAGATGTGGG - Intronic
1144719751 17:17460680-17460702 CATTAGTCAAAGGAAGAAGCTGG - Intergenic
1146039633 17:29438872-29438894 CATTTTTCAAAATAAAAAGTTGG - Intronic
1147574512 17:41590988-41591010 CATTTTTTAAAAAAAGAAGCTGG - Intergenic
1148505799 17:48126220-48126242 CATTACTCAAGGAGAGGAGTGGG - Intergenic
1149227595 17:54492823-54492845 CATTATAGAAGGAAAGAAGTAGG + Intergenic
1149975144 17:61257932-61257954 AATTGATCTAAGAAAGAAGTGGG - Intronic
1150197596 17:63317129-63317151 GATGATGCAGAGAAAGAAGTTGG - Intronic
1150458746 17:65329437-65329459 CATTTTTTAAAGATATAAGTAGG - Intergenic
1150913953 17:69417120-69417142 AATTATTGGTAGAAAGAAGTGGG + Intronic
1151023332 17:70645654-70645676 CATTATTGTAATAAAGAAATAGG - Intergenic
1151076826 17:71283181-71283203 AGTGATTCAAACAAAGAAGTTGG + Intergenic
1151099105 17:71535381-71535403 TATAATTCCAAGAAGGAAGTGGG + Intergenic
1151280167 17:73068070-73068092 TATTATGAAAACAAAGAAGTGGG - Intronic
1151466749 17:74290548-74290570 CATTATTAAAATAAACATGTAGG + Intronic
1153548911 18:6240143-6240165 AATTATTCTAAGAAAAAAGAGGG - Intronic
1153847464 18:9062901-9062923 CTTTAGCCAAAGAAAGAAGAAGG + Intergenic
1155803698 18:30140501-30140523 CTTTCTTCAAAGGAAGCAGTTGG + Intergenic
1155896003 18:31327274-31327296 CATTATTTTAATAAAGAATTTGG + Intronic
1155915797 18:31555841-31555863 GATACTTCAATGAAAGAAGTTGG + Intergenic
1156214383 18:34980919-34980941 CCATATTAAAAGTAAGAAGTTGG + Intronic
1157302978 18:46493325-46493347 CATTATTGACAGAAAGTAATTGG - Intronic
1157737865 18:50066470-50066492 CCTTATGCAATGAAAAAAGTTGG - Intronic
1157777724 18:50409000-50409022 CAATGTTCAGAGAAAGAAGTTGG - Intergenic
1158422255 18:57305421-57305443 CATTATTGCATGAATGAAGTAGG - Intergenic
1158455757 18:57605879-57605901 CATGATGTAAAGAAAGAAGATGG - Exonic
1159210942 18:65320809-65320831 AAACATTTAAAGAAAGAAGTTGG - Intergenic
1159702432 18:71645625-71645647 GATTTTTAACAGAAAGAAGTAGG + Intergenic
1159829846 18:73262946-73262968 CTTTATTAAAAGAAGGAATTTGG - Intronic
1160091970 18:75835648-75835670 CATTATCTAAAGGAAGAATTAGG - Intergenic
1160174616 18:76582626-76582648 CATCTTTCAAAGAAGGGAGTTGG + Intergenic
1160182402 18:76646922-76646944 CATAATTTTAAGTAAGAAGTAGG + Intergenic
1160367786 18:78343374-78343396 CATAATTCCTAGTAAGAAGTTGG + Intergenic
1161141708 19:2651864-2651886 AATTTTTTAAAGAAAGAAATTGG - Intronic
1161888467 19:7015688-7015710 CATTAATAAAAGGAAGAAGGCGG - Intergenic
1162297859 19:9825838-9825860 CATTATTTAAAGGGAAAAGTGGG - Intronic
1163090540 19:15016629-15016651 CCATATTCAGAGAAAGAAGCTGG + Intronic
1164730867 19:30503474-30503496 TATTGTTGAATGAAAGAAGTGGG + Intronic
1164864641 19:31594249-31594271 CATTGTTCAGAGGAAGAAGGAGG - Intergenic
1167615567 19:50531054-50531076 CACTTTTCAGAGAAAGAAGATGG + Intronic
925311427 2:2886934-2886956 CATGATTCAAAGGAAGAAAAAGG + Intergenic
925649282 2:6072070-6072092 CATTAGTGAAAGAAGGAAGCGGG - Intergenic
926643008 2:15257837-15257859 CATTGTTCACATAAATAAGTGGG - Intronic
926976048 2:18517857-18517879 CAAGATTCAAAAAAAGAAGGTGG - Intergenic
927069629 2:19513661-19513683 CACTATTCAAAGAGAGAAAGAGG - Intergenic
927415527 2:22875667-22875689 TATTATTTACAAAAAGAAGTGGG - Intergenic
928266336 2:29815151-29815173 CATTATTAAGTGATAGAAGTGGG - Intronic
928819960 2:35349507-35349529 CTTTATTCACAGAAAATAGTAGG - Intergenic
929175641 2:38972612-38972634 CATTATTCAAAGAAAGAAGTTGG - Intronic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930217801 2:48714875-48714897 CATTTTGCAAAGAAGGAAATAGG + Intronic
930327659 2:49940595-49940617 CCATATTCCAAGAAAAAAGTTGG + Intronic
930500248 2:52207188-52207210 GATTATTCAATGAAAGATTTGGG - Intergenic
930901735 2:56515363-56515385 ATTTATTAAAAAAAAGAAGTGGG - Intergenic
930975424 2:57453227-57453249 CATTAATAAAAGAAATAAGGAGG + Intergenic
931040326 2:58290443-58290465 CACTATTAAAAGAAAAAAGTCGG - Intergenic
931229130 2:60359230-60359252 CATTATTCCAAGAGAGAAAAAGG + Intergenic
932031211 2:68187073-68187095 CATTATTCAAATATAGTAGTTGG + Intronic
932961692 2:76419858-76419880 CATGACTCAAAGCAAGAAGGGGG - Intergenic
933385640 2:81607339-81607361 AAAGATTTAAAGAAAGAAGTGGG - Intergenic
933912320 2:86952773-86952795 AAGTATTCATAGAAAGAAATGGG - Intronic
934010675 2:87817124-87817146 AAGTATTCATAGAAAGAAATGGG + Intronic
935774248 2:106457825-106457847 AAGTATTCATAGAAAGAAATGGG + Intronic
935905821 2:107838088-107838110 AAGTATTCATAGAAAGAAATGGG - Intronic
936127622 2:109803263-109803285 AAGTATTCATAGAAAGAAATGGG - Intronic
936217075 2:110568222-110568244 AAGTATTCATAGAAAGAAATGGG + Intronic
936345320 2:111671311-111671333 CATTAATTAAAAAAAGAAGAAGG - Intergenic
936426215 2:112422806-112422828 AAGTATTCATAGAAAGAAATGGG + Intronic
936881458 2:117256275-117256297 TTTTATTCAAACAGAGAAGTAGG + Intergenic
937181017 2:119996519-119996541 TATTAATCAAGGAAAGAAGAAGG + Intergenic
937641000 2:124211224-124211246 CATTTTTCAAGGACAGTAGTTGG + Intronic
937922529 2:127141174-127141196 AATTATTGAAAGAAGGAAATTGG - Intergenic
939002820 2:136755912-136755934 TACTATGCAAAGAAACAAGTAGG + Intergenic
939255028 2:139732346-139732368 AATAAAACAAAGAAAGAAGTTGG - Intergenic
939515382 2:143160876-143160898 CATACTTCAAAGAAAGAGCTAGG + Intronic
940295017 2:152113577-152113599 CAATATGCAAAAAATGAAGTTGG + Intergenic
940568402 2:155398901-155398923 CATAATTCAAAGAAATGGGTGGG + Intergenic
940738682 2:157482220-157482242 CAATATTAAAATAGAGAAGTTGG + Intronic
940895503 2:159078814-159078836 AATTATTCAAAGAAAACTGTAGG - Intronic
941178014 2:162223402-162223424 TATTAGTCAAATAAAGAGGTGGG + Intronic
941186310 2:162325046-162325068 TATTACACAAAGAAAGAATTTGG + Intronic
941981565 2:171463899-171463921 CAATATTCAGAGCAAGGAGTTGG + Intronic
942230429 2:173856397-173856419 CATTTTTAAAAAACAGAAGTTGG - Intergenic
942501979 2:176600905-176600927 CGTTTTACAAAGAGAGAAGTAGG + Intergenic
943328283 2:186527848-186527870 CCATATGCAAAGAATGAAGTTGG - Intergenic
943539339 2:189192457-189192479 CATTATGCAAATAAGGAATTGGG - Intergenic
944510597 2:200461248-200461270 CATTATTTAAACAGAGAATTTGG - Intronic
944519520 2:200550321-200550343 CATTCTTCACAGAAATAAGGGGG + Intronic
944704797 2:202277727-202277749 GATTATTAAAAGAAAGTTGTAGG - Intronic
945119287 2:206442369-206442391 CATGATTAAAAGAAAGAATGTGG - Intergenic
945207034 2:207343286-207343308 CATTTTTCAAAATAAAAAGTTGG + Intergenic
945415862 2:209571389-209571411 TAATATTCAGAGAAAGAAATCGG - Intronic
945506223 2:210644180-210644202 TATTATAGAAAGAAAGAAGTTGG + Intronic
946140533 2:217686900-217686922 CACTATTGAAAGGAAGAAGGTGG - Intronic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947947904 2:234122138-234122160 CATTATTTGCAGAAAGGAGTAGG - Intergenic
947957380 2:234203963-234203985 CATTTTTTAAATAAAAAAGTAGG - Intergenic
948020420 2:234728908-234728930 TACTATTGGAAGAAAGAAGTTGG + Intergenic
948690607 2:239700972-239700994 CATTATTCCATGAAAAAAGTGGG + Intergenic
1169015437 20:2289144-2289166 CATTAGTCAAATGAAGAGGTTGG + Intergenic
1169284856 20:4299471-4299493 CATTATGAAGAGAAAGAAGATGG + Intergenic
1169761743 20:9102705-9102727 CATTATTAAGAGGAAAAAGTAGG - Intronic
1172806370 20:37614918-37614940 AAGTATTCAAACAAAAAAGTTGG + Intergenic
1173703312 20:45092314-45092336 CATTATGCAAATAAAGAGCTGGG - Exonic
1175080248 20:56413791-56413813 AATTTTTCAAAGTAAGTAGTTGG - Intronic
1178607759 21:34054609-34054631 GATTATCCAAAGAAAGAATAGGG + Intergenic
1182665617 22:31957209-31957231 CATTAATTGAAGAAAGAGGTGGG - Exonic
1182681622 22:32084133-32084155 TATTAATCAAAGAAAGACCTTGG - Intronic
1183896844 22:40976189-40976211 CATTTTTTAAGGAAAGAACTTGG - Intergenic
1183937122 22:41269243-41269265 TATGATTCAAAGAAAGTATTAGG + Intronic
1184307878 22:43619552-43619574 CATACTTGAAAGAAAGAAGAAGG + Intronic
1185289949 22:50018399-50018421 AATAAATCAAACAAAGAAGTGGG + Intronic
949650678 3:6155529-6155551 CATTTTTAAAAGAAAGAGATTGG + Intergenic
949944772 3:9181220-9181242 CATTATTCAAAGACTCAAGAAGG + Intronic
950911576 3:16600431-16600453 CACTATTAAAAGAAAGAATTAGG - Intronic
951271996 3:20636819-20636841 CATTATTCAAAAAGAGGAGACGG + Intergenic
952571617 3:34724564-34724586 GATTATTCAAAGGAGGAAGAAGG - Intergenic
953988673 3:47466178-47466200 CTTTGTCCAAAGAAAAAAGTGGG + Intronic
954161072 3:48722902-48722924 CAGTATTCAAAGTAGGAGGTAGG + Intronic
955636341 3:61033737-61033759 AATTATTAAAAGAAAGACCTGGG - Intronic
955940059 3:64138899-64138921 CAATATTTAAATAAAGAAATTGG + Intronic
956497276 3:69841251-69841273 AATTATTGGAAGAAAGAAGAGGG + Intronic
958546068 3:95552129-95552151 TATTGCTGAAAGAAAGAAGTTGG - Intergenic
960094671 3:113677783-113677805 CACTCTTAAAAGAGAGAAGTAGG - Intronic
960513915 3:118581901-118581923 GATCATTCATACAAAGAAGTTGG - Intergenic
960728600 3:120698186-120698208 AATTATTCATAGAATAAAGTTGG + Intronic
961155848 3:124678847-124678869 GATTATTTAAAGAAATAATTTGG - Intronic
961331981 3:126147792-126147814 CATTTTTCCAAGAAAGAAAGAGG - Intronic
962018481 3:131470084-131470106 CATCATTCAAAGAAAAAAAATGG + Intronic
962226262 3:133612590-133612612 CATTTTTCCTAGAAAGAAGTTGG - Intronic
962604014 3:137016591-137016613 CATTAGCCAAAGAAAAGAGTGGG - Intergenic
963063605 3:141244672-141244694 CCTTAAAAAAAGAAAGAAGTGGG - Intronic
963305183 3:143643772-143643794 CATTATTGGAAGAAAGTGGTTGG - Intronic
963694633 3:148550278-148550300 CAATATTCAAATTAAGTAGTGGG + Intergenic
964858904 3:161178915-161178937 CATTCTTCAAAGAAAGTAATTGG + Intronic
966355636 3:179075650-179075672 GATGATTTAAAGAAAGAAGTCGG - Intergenic
966438199 3:179912967-179912989 CATCCTTCAAAGAAAAAATTAGG + Intronic
967401195 3:189062952-189062974 CATCAATCAAAGAAAGAGATTGG + Intronic
967439041 3:189485652-189485674 CTTTATTCTAAGAAAGAGGAGGG - Intergenic
967491706 3:190099694-190099716 CTTTATTCATAGAAAAAAGATGG + Intronic
969058829 4:4419255-4419277 CTTTGTTCAAAGGAAGAAGTGGG - Exonic
970881448 4:20937040-20937062 CATTATGAAAGGAAAGAAGAGGG + Intronic
971104738 4:23512144-23512166 CATTACTCCTAGACAGAAGTAGG + Intergenic
971667737 4:29512509-29512531 CATTGTTCAAGGCATGAAGTGGG + Intergenic
971763329 4:30797572-30797594 CATTATTAAAAGTAGGAAGTGGG - Intronic
971952828 4:33377007-33377029 CATTGTGAAAAAAAAGAAGTCGG + Intergenic
972032622 4:34480211-34480233 CTTTATTCATAGAAAGGATTGGG - Intergenic
972437329 4:39045890-39045912 CATTTTTCAAAGCAAGCAGGAGG - Intronic
973063181 4:45755656-45755678 CATGATACAAACCAAGAAGTGGG - Intergenic
973119773 4:46507358-46507380 CATTATTTTAAGACAGAATTTGG + Intergenic
973191766 4:47393517-47393539 CAGTATGCAAAGAAAAAACTGGG - Intronic
973655184 4:53039763-53039785 CATTTTACAAATAAGGAAGTTGG + Intronic
974432121 4:61812559-61812581 CATTGTAGAAAGAAAGTAGTGGG + Intronic
975005537 4:69279272-69279294 GATTTTTAACAGAAAGAAGTGGG + Intergenic
975429051 4:74266943-74266965 CATCTTTAAAAGAAAGAAATTGG + Intronic
977077915 4:92481728-92481750 AATTATTTAAAGAATGATGTTGG + Intronic
977414351 4:96712574-96712596 CATTACTCAGAGAAATCAGTTGG + Intergenic
977490963 4:97710803-97710825 AATTATTCAAGGAAATAAATTGG + Intronic
977618842 4:99113923-99113945 AATTTTTCAAAGTAAAAAGTTGG - Intergenic
978323134 4:107520310-107520332 CATTATTCAAAGGCAGAAAATGG + Intergenic
978518172 4:109591596-109591618 CATTTTTCAAAGACAACAGTGGG + Intronic
978638492 4:110840622-110840644 CAATATTCAAAGAAAAACATAGG + Intergenic
978711122 4:111782447-111782469 CTTTATTCAAATTATGAAGTAGG - Intergenic
978932572 4:114333445-114333467 CAATATTCGAATCAAGAAGTTGG - Intergenic
979340321 4:119514873-119514895 CATTATACAAAGAAGGAAACAGG + Intronic
979418430 4:120473147-120473169 CATTTTTCAAATAATGAAGTTGG - Intergenic
979437974 4:120717038-120717060 CAATGTTCAAAGAAAGGAGCAGG - Intronic
979855899 4:125633961-125633983 AGGTATTCAAAGAAAGAGGTGGG + Intergenic
979897567 4:126178678-126178700 CATTTTTAAAAGAAAAAACTGGG - Intergenic
980481492 4:133394228-133394250 CATTATCTAAAGAAAGATGATGG + Intergenic
980505767 4:133718664-133718686 CATTATTCAAGGCAAGAAATGGG + Intergenic
980563741 4:134510206-134510228 CATTTTAAAAAGAGAGAAGTTGG - Intergenic
980661601 4:135866424-135866446 AAATATTAAAAGAAATAAGTTGG + Intergenic
981328506 4:143480631-143480653 CATGATTCAAAAAAAAAAGAAGG + Intergenic
981565362 4:146095910-146095932 CATGAAGCAAAGAAAGAAGTTGG + Intergenic
982157001 4:152533580-152533602 CATTATTCTAAGACAACAGTTGG + Intronic
982447223 4:155506760-155506782 CATTAATTAAAAAAAAAAGTAGG - Intergenic
982611714 4:157582520-157582542 CATTATTTAAATACAGAATTTGG + Intergenic
982710384 4:158752496-158752518 CCTTATTCACATAAATAAGTAGG - Intergenic
983142622 4:164171562-164171584 CACCATTAAAAGAAAAAAGTAGG + Intronic
984215483 4:176908787-176908809 CAGTATCCAAAAAAAGATGTTGG - Intergenic
984460053 4:180023279-180023301 CACTAATTAAAGAAAGATGTTGG + Intergenic
984610148 4:181828364-181828386 TAGTATTGAAAGAAAGAAGAAGG - Intergenic
985122605 4:186659416-186659438 CATGTTTCTAAGAAACAAGTGGG + Intronic
987170879 5:15256307-15256329 CATTTTTAAAAGGAAGAAATGGG + Intergenic
987178221 5:15338800-15338822 CATTGTTCTAAGAAACAACTTGG - Intergenic
987680424 5:21129467-21129489 TCATATTCAAAGAATGAAGTTGG - Intergenic
988935171 5:36074773-36074795 TTTTATACATAGAAAGAAGTAGG + Intergenic
989021223 5:37011983-37012005 CATAATTTTAAGTAAGAAGTAGG - Intronic
989361178 5:40603019-40603041 CTTTATTCAAAGAAAGGAATAGG - Intergenic
990684525 5:58286423-58286445 CATTAATAAAAAAAGGAAGTGGG - Intergenic
992500430 5:77337483-77337505 CATTATATAAAGAAATAAATTGG + Intronic
993243993 5:85428354-85428376 TAATTTTCAAAGAAAGAAGTGGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
994078349 5:95678892-95678914 CATTCTTCAAAGGAAATAGTGGG + Intronic
994082731 5:95725716-95725738 ATTTATTCTAACAAAGAAGTTGG - Intronic
994949523 5:106441313-106441335 AATTATTTAAGGAATGAAGTGGG + Intergenic
994998472 5:107096026-107096048 CATTTTTCAAATAAAGAAACTGG + Intergenic
995786640 5:115837708-115837730 TATTATGAAAACAAAGAAGTGGG - Exonic
995810111 5:116097158-116097180 AAATATGCAAATAAAGAAGTTGG + Intronic
996413132 5:123180575-123180597 CATCATTAAAATAAAGAGGTAGG + Intronic
996836120 5:127794677-127794699 CATTTGTTAAAGAAATAAGTTGG - Intergenic
998875567 5:146595511-146595533 AATTCTTGAAAGATAGAAGTTGG + Intronic
999932831 5:156452334-156452356 CATTATCCAAAGAAAAATGTGGG - Intronic
1000470292 5:161631587-161631609 CATTTTTGGAAGCAAGAAGTAGG - Intronic
1000875768 5:166636272-166636294 CATTCTCCAAAGAAATAAGAGGG - Intergenic
1001030275 5:168257542-168257564 GCTTTTTCAATGAAAGAAGTGGG + Intronic
1001126374 5:169023366-169023388 CTGTATTCAAAGAAAAAAGAGGG + Intronic
1002943711 6:1740684-1740706 CATTTTTCAAAAAAAAAAATTGG - Intronic
1003389053 6:5697468-5697490 CATTTTACAAAGAAAAAATTGGG + Intronic
1003601663 6:7523298-7523320 TATTATTCCAAGAAAGAAACAGG - Intergenic
1003771290 6:9304465-9304487 CATTACTCAAAGAATAAACTTGG - Intergenic
1005565626 6:27090722-27090744 CATAGTACAAAGAAAGCAGTCGG + Intergenic
1007158837 6:39772359-39772381 CACTATTCAGAGAAGGAAGGTGG + Intergenic
1008159824 6:48063425-48063447 CTTTATACTAAGAAAGAAGTAGG - Intronic
1008455980 6:51711272-51711294 CATTAGTGAAACAAAGAAGGAGG - Intronic
1008578587 6:52884652-52884674 CATTATTACAAGAAGAAAGTGGG - Intronic
1008792174 6:55249513-55249535 CATAATTCATATAAATAAGTTGG + Intronic
1008984235 6:57523052-57523074 TAGTATTCATAGAAAGAAATTGG + Intronic
1009338844 6:62528377-62528399 AATTAATAAAAGAAAGAAGTTGG + Intergenic
1009584665 6:65583736-65583758 CATTATTTAAAGAAAATAATAGG - Intronic
1011092701 6:83624283-83624305 AATTATTCAAAGTGAAAAGTTGG + Intronic
1011473856 6:87733782-87733804 CATTATTCAATAATAGAAATAGG + Intergenic
1011673124 6:89703488-89703510 CATTATTCAAAGAGCCATGTTGG - Intronic
1011758432 6:90530362-90530384 CAATATTAAAACAAATAAGTTGG + Intronic
1012004628 6:93697163-93697185 CAATTTTAAAAGAAAGAATTAGG + Intergenic
1012962186 6:105633924-105633946 CATCATTTTTAGAAAGAAGTAGG - Intergenic
1013440501 6:110160800-110160822 AATTATTCAAAGAAAAAGGTAGG - Intronic
1013998365 6:116336453-116336475 CATGTTTTAAAGAAAAAAGTAGG + Intronic
1014461099 6:121696600-121696622 CATAATCCAAGGAATGAAGTAGG - Intergenic
1014596976 6:123357145-123357167 TATAAGTCAAAGAAAAAAGTGGG - Intronic
1014885569 6:126776639-126776661 CTTTATGAAAATAAAGAAGTGGG + Intergenic
1015073213 6:129122963-129122985 CATTATGGAAGGAAAAAAGTAGG + Intronic
1015153297 6:130062795-130062817 CATTATTCAAAAAAAAAAAAAGG + Intronic
1015306692 6:131716533-131716555 CATTAATGAAAGAAAGAAAAAGG - Intronic
1015389677 6:132667416-132667438 CATTAATCAAAGCAAGAAGATGG + Intergenic
1016125189 6:140392929-140392951 CAATATGCAAAAAATGAAGTTGG + Intergenic
1016272861 6:142309525-142309547 CATCCTGCAAAGAAAGAAGATGG - Exonic
1017608856 6:156162931-156162953 CATTTTACAAAGCAAGAAATAGG - Intergenic
1017796598 6:157850372-157850394 TATTATTCAAAGGAATATGTGGG + Intronic
1017949376 6:159123103-159123125 CATTATTTAAAGAGAGAGGCCGG - Intergenic
1019966791 7:4506055-4506077 CATTTTCCAAAGAAGGAACTGGG + Intergenic
1020119903 7:5497194-5497216 CATTTTTAAAAAAAAAAAGTGGG + Intronic
1020406588 7:7842214-7842236 CATTTTACAGAGAAAGAACTGGG - Intronic
1020708807 7:11579539-11579561 CATTAATGAAAGAAAGATGGTGG - Intronic
1021056403 7:16052465-16052487 AAATATTCACAGAAAGAATTAGG - Intergenic
1021275864 7:18650062-18650084 CATTAGTCAGAGAAGGAAATTGG - Intronic
1021369631 7:19827084-19827106 CATTTTTCAAAAGAAGACGTAGG + Intergenic
1021473364 7:21032228-21032250 CATCCTTCAAAGGATGAAGTGGG + Intergenic
1021833568 7:24643955-24643977 CAGTAATCAAAGAAAGGATTAGG - Intronic
1022858174 7:34337887-34337909 CATTATTTAAAAATAGAAATAGG - Intergenic
1023050345 7:36245682-36245704 CATTTTTCAAAAGAAGAAATTGG - Intronic
1023409116 7:39870674-39870696 CAAGATTCAAAGAAGGAATTAGG + Intergenic
1024013566 7:45291465-45291487 GAGTTTTCCAAGAAAGAAGTGGG - Intergenic
1025043814 7:55673355-55673377 CAAGATTCAAAGAAGGAATTAGG - Intergenic
1025136741 7:56421876-56421898 CAAGATTCAAAGAAGGAATTAGG - Intergenic
1025205441 7:56990876-56990898 CAGTATTTAAAAAAAAAAGTGGG - Intergenic
1025602863 7:63015954-63015976 CATTTTTCTAAAAACGAAGTGGG - Intergenic
1026183466 7:68062460-68062482 CATAGCTCAAAGAAGGAAGTAGG - Intergenic
1026343075 7:69450925-69450947 CATTTTTCAAAGAGCTAAGTAGG + Intergenic
1026866407 7:73826773-73826795 CATTGTACAAAGGAGGAAGTTGG + Intronic
1028271564 7:88797281-88797303 TATAATCCAAATAAAGAAGTAGG - Intronic
1028586896 7:92461110-92461132 CATGATTCTAGGAAAGAACTTGG + Intergenic
1029025401 7:97411964-97411986 CAATATTCCAAGAGGGAAGTGGG + Intergenic
1030962278 7:115940590-115940612 CAGTTTCCAAAGAAAGCAGTAGG - Exonic
1031101849 7:117490848-117490870 CATAATTCAGAGAAAGCACTGGG - Intronic
1031206372 7:118763296-118763318 CAATATTTAGAGGAAGAAGTTGG + Intergenic
1031406068 7:121389014-121389036 CATTCTTCTAAGAATGAAATTGG + Intronic
1034565753 7:151913858-151913880 AGTTATTCAAAGAAAGAAGATGG - Intergenic
1034703172 7:153114522-153114544 AATCATTCAAAGAAGAAAGTGGG + Intergenic
1035071049 7:156145188-156145210 AATTTTTCAAAGATAGAATTGGG - Intergenic
1035110007 7:156473611-156473633 CATTATTTTAAAAAAGAATTTGG - Intergenic
1035824170 8:2626920-2626942 CACTAGTCAAAGAAAAAAGGAGG + Intergenic
1037080376 8:14777924-14777946 CATCATTTAAAGAAAAAAATTGG + Intronic
1037229297 8:16635872-16635894 CATTAGTGAAAGAAAAACGTAGG + Intergenic
1037442581 8:18931639-18931661 CATCATTAAAAGAAAAGAGTCGG - Intronic
1038081698 8:24144752-24144774 CATTAATCAAATAAAGCTGTGGG - Intergenic
1038876009 8:31550324-31550346 CATTATCCAATAAAAGAAGCAGG - Intergenic
1038940811 8:32302536-32302558 CAATAGTCAAAGAAAAAAATTGG - Intronic
1038940819 8:32302753-32302775 CAATAGTCAAAGAAAAAAATTGG - Intronic
1038964186 8:32552692-32552714 GATTATTCACAGAATGAAATAGG + Intronic
1039733085 8:40300650-40300672 CATAATTCAAGGAAAGAAGCCGG - Intergenic
1040074734 8:43218192-43218214 CCTGCTCCAAAGAAAGAAGTGGG - Intergenic
1040100431 8:43496241-43496263 CAAGATTCAAAGAAGGAATTAGG + Intergenic
1040117656 8:43642485-43642507 CACTATTCGAAGAAAGATTTGGG + Intergenic
1040727643 8:50401968-50401990 CAAAATTCACACAAAGAAGTGGG - Intronic
1041167866 8:55108554-55108576 CATTTTTCAGAAAAACAAGTTGG + Intronic
1041290036 8:56300050-56300072 CATTACTCAAAGAATGATGAAGG - Intronic
1041485084 8:58367229-58367251 AATTATTAAATGAAATAAGTAGG + Intergenic
1041493813 8:58464259-58464281 CAATTTTCAAAGTAAGATGTTGG - Intergenic
1041640877 8:60200164-60200186 CATTCTACAAAACAAGAAGTGGG + Intronic
1041735199 8:61103649-61103671 CATTAATCACTGAAAGAAATGGG - Intronic
1042084936 8:65096788-65096810 TATTATTAAAAGAAAGACTTAGG + Intergenic
1042480412 8:69296235-69296257 CATTAGTGAAAAAAAGAACTGGG - Intergenic
1043038812 8:75232664-75232686 CATTTTTGTAAGAAAGGAGTGGG + Intergenic
1043413496 8:80024757-80024779 CATTATGCAAAGGATGAAGAGGG + Intronic
1043827815 8:84949988-84950010 CATTCTTCTTAGAGAGAAGTGGG - Intergenic
1045480713 8:102589844-102589866 CATGATTCAAAGGGAGAAGCGGG + Intergenic
1045511901 8:102818129-102818151 AATCATTAAAAGAAAAAAGTTGG - Intergenic
1045572543 8:103383884-103383906 CAATTTTCAAAGTAACAAGTTGG - Intergenic
1047042354 8:121010011-121010033 CATTGTTCAAAAAAGGAATTTGG + Intergenic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1048546446 8:135391823-135391845 CATTATACAAATGAAGAAATTGG - Intergenic
1049282889 8:141759496-141759518 CATTATTTAGAGAAAGAGGAAGG + Intergenic
1050212827 9:3282735-3282757 CATTCTTCAAATAAAGAAGGTGG - Intronic
1050949460 9:11569661-11569683 CATTATTCAAAGTAAAAAACTGG + Intergenic
1051782994 9:20710925-20710947 CTTTATTTACAAAAAGAAGTGGG - Intronic
1052114291 9:24630383-24630405 CTTTATTCAAAAAAAGTAATTGG + Intergenic
1052366553 9:27618176-27618198 CAATATTCTAATAATGAAGTTGG + Intergenic
1052569877 9:30206454-30206476 CATTATTTAAAGAAAGGAGCAGG - Intergenic
1054886696 9:70206505-70206527 AATTATTCAAGAAAAGTAGTGGG + Intronic
1055101643 9:72471794-72471816 CATTATTTTTGGAAAGAAGTGGG - Intergenic
1055577604 9:77675918-77675940 CAATGTTCACAGCAAGAAGTGGG + Intergenic
1055913300 9:81375080-81375102 CATTAGTAACAGGAAGAAGTGGG + Intergenic
1057823926 9:98357853-98357875 CATTTTTTAAAAAAAGAAGAAGG - Intronic
1059049395 9:110906327-110906349 TATTATACAAATTAAGAAGTAGG - Intronic
1059213555 9:112537874-112537896 CATTAACAAAAGAAAAAAGTTGG + Intronic
1059652324 9:116326367-116326389 CCTTATTCCAAGAAAATAGTTGG - Intronic
1060387327 9:123243172-123243194 CATTTTTCTAAGAAATTAGTTGG - Intronic
1061724129 9:132572287-132572309 CATTATTCTAAGATTGAAGCAGG + Intronic
1203491034 Un_GL000224v1:104648-104670 CATAATTCACAGAAAGAGTTGGG - Intergenic
1203503658 Un_KI270741v1:46519-46541 CATAATTCACAGAAAGAGTTGGG - Intergenic
1186215062 X:7290775-7290797 CATTTTACAGAGAAAGAAGTGGG - Intronic
1186570426 X:10709499-10709521 CATTTGTCTAAGAAAGAATTTGG + Intronic
1186594502 X:10966148-10966170 CAATAATAAAAAAAAGAAGTTGG + Intergenic
1186600865 X:11035729-11035751 CATTTTTCAAAGTAAGATCTGGG - Intergenic
1187223252 X:17350494-17350516 AATTTTTCAAAATAAGAAGTTGG + Intergenic
1189951062 X:46231266-46231288 CATTATTCAATGATGGAGGTGGG + Intergenic
1191189115 X:57647671-57647693 CAGGATTCAAAGTAAAAAGTGGG - Intergenic
1194050870 X:89066713-89066735 AAATATTCAAAGAAACAAATTGG - Intergenic
1194387218 X:93270589-93270611 CATTATTCAATAAAAAATGTTGG - Intergenic
1194684234 X:96892660-96892682 CATTATTTTAAAAAAGAATTAGG + Intronic
1194837895 X:98703882-98703904 AATTCTGCAAAGAAAGATGTTGG + Intergenic
1195403473 X:104487375-104487397 CATTAATGAAATAAAGAAGGTGG + Intergenic
1197685208 X:129432421-129432443 AGTGATTCAAAGTAAGAAGTTGG - Intergenic
1199973296 X:152876330-152876352 CATTATTCCAAGAGAGTAGAAGG - Intergenic
1200042494 X:153380109-153380131 CATCATGCCAGGAAAGAAGTGGG + Intergenic
1200825998 Y:7641899-7641921 CAATATTAAAATAAAGAAGCAGG + Intergenic