ID: 929178729

View in Genome Browser
Species Human (GRCh38)
Location 2:39009598-39009620
Sequence CCAATAATACACAAAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929178729 Original CRISPR CCAATAATACACAAAGAAGG TGG Intronic
901010059 1:6195588-6195610 ACAAAAATACACAAATTAGGTGG + Intronic
901283032 1:8054422-8054444 CCAAAAATACAAAAATTAGGTGG - Intergenic
901818970 1:11813550-11813572 CCAAAAATACACAAATTAGGTGG - Intronic
901820562 1:11826663-11826685 GCAGGAATACAAAAAGAAGGTGG - Intronic
901958051 1:12801516-12801538 CCAATAAGACCCAAACAAGCAGG - Intergenic
902296250 1:15469014-15469036 CTAAAAATACAAAAATAAGGTGG + Intronic
902998213 1:20244270-20244292 CCAACAAGAAAAAAAGAAGGTGG - Intergenic
903029804 1:20455705-20455727 CCAAAAATACAAAAATTAGGCGG + Intergenic
903895343 1:26599490-26599512 CCAAAAATACAAAAAGTAGCTGG + Intergenic
904079656 1:27864036-27864058 CCAAAAATACACAAATTAGCTGG - Intergenic
904872433 1:33627212-33627234 CCAATAACACACAAACTGGGGGG + Intronic
905374182 1:37507156-37507178 CCAATAATACAAAAATTAGCTGG + Intronic
905657458 1:39693948-39693970 ACAAAAATACAAAAATAAGGAGG + Intronic
905816408 1:40954352-40954374 CTAAAAATACACAAATAAGCTGG + Intergenic
906417262 1:45630110-45630132 CCAAAAATACAAAAAGTAGCTGG - Intronic
907225902 1:52946088-52946110 CCAAAAATACAAAAATTAGGGGG - Intronic
908297454 1:62727324-62727346 CCAAAAATACAAAAATAAGCCGG - Intergenic
908344676 1:63219857-63219879 CCAAAAATACACAAATTAGCTGG - Intergenic
908747364 1:67388505-67388527 CCAAAAATACAAAAAGTAGCTGG - Intronic
909176240 1:72364526-72364548 CCAATAAAACACAAATCAGCAGG - Intergenic
910182405 1:84499931-84499953 CCAAAAATACAAAAAGTAGCCGG + Intronic
911127662 1:94355539-94355561 CCCATGTTACACAATGAAGGGGG - Intergenic
912766443 1:112416402-112416424 CTAATAACACACAATGTAGGTGG - Intronic
912812214 1:112803021-112803043 CAAATGAGACACAAAGAAGCAGG - Intergenic
914216409 1:145634239-145634261 CCAAAAATACAAAAATAAGCTGG - Intronic
914468981 1:147956897-147956919 CCAAAAATACAAAAATAAGCTGG - Intronic
914720621 1:150285812-150285834 CAAAAAATACAAAAAGTAGGTGG + Intronic
916032491 1:160890096-160890118 CAAATAATATAAAAAGTAGGTGG + Intergenic
917364530 1:174215293-174215315 CCAATAATACAAAAATTAGCTGG + Intronic
918746992 1:188215288-188215310 CCTATTATACACAAAGAAACTGG - Intergenic
918851093 1:189692025-189692047 ACAACTATACACCAAGAAGGAGG + Intergenic
919170633 1:193949269-193949291 CCAATATCTCAAAAAGAAGGTGG + Intergenic
919220613 1:194624366-194624388 CCAATAATAAACAAAAAAGTAGG + Intergenic
921248153 1:213268687-213268709 ACAATAATAGACAAAGGAAGGGG + Intronic
921685358 1:218083282-218083304 CGAATGAGACACAAAGGAGGTGG - Intergenic
921778887 1:219136793-219136815 CCAATTCTACACAAACAAGAAGG + Intergenic
922436522 1:225612831-225612853 ACAATAATGCAAAAAAAAGGGGG + Intronic
922723552 1:227911249-227911271 CCAAAAATACAAAAATAAGCTGG + Intergenic
923599808 1:235392570-235392592 CCAATAATACAAAAATTAGCTGG - Intronic
923893376 1:238240108-238240130 TCAATAATCCACAAATAAGGAGG + Intergenic
923917150 1:238521586-238521608 CCAAAAATACAAAAAGTAGCTGG - Intergenic
924053960 1:240106473-240106495 CCAATAATACATAAGGGAGCAGG - Intronic
1063546866 10:6989638-6989660 CCAAAAATACAAAAATTAGGTGG + Intergenic
1063660860 10:8034484-8034506 CCCATAAAAAACAAAGACGGGGG + Intergenic
1064155373 10:12899004-12899026 CCAGAAATGCACACAGAAGGTGG + Intronic
1064626781 10:17269555-17269577 CCAAAAATACAAAAACTAGGTGG + Intergenic
1064708567 10:18098130-18098152 CAAAAAATACACAAAGTAGCTGG - Intergenic
1065079811 10:22117093-22117115 CCAAAAAAACAAAAAGAATGCGG + Intergenic
1065090806 10:22231669-22231691 TGTATAATACACAAAAAAGGGGG - Intergenic
1065723411 10:28647612-28647634 ACAAAATTACACTAAGAAGGAGG - Intergenic
1066519865 10:36205291-36205313 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1067010602 10:42709412-42709434 CCAAAAATACAAAAATTAGGTGG + Intergenic
1067690924 10:48501739-48501761 CCAAAAAAAAAAAAAGAAGGTGG + Intronic
1067735075 10:48844428-48844450 CTAATAATACAAAAAGTAGCTGG + Intronic
1067913559 10:50372202-50372224 CGAATACTAGAGAAAGAAGGTGG + Intronic
1068390277 10:56386941-56386963 CCAAAAATAAACAAAGCTGGAGG + Intergenic
1068549249 10:58387098-58387120 CCAAAAATACAAAAATGAGGTGG + Intronic
1068882083 10:62061178-62061200 CCAATAATGATCAAACAAGGTGG + Intronic
1069112074 10:64460187-64460209 ACAATAATACAAAAAGTAGCTGG + Intergenic
1069441778 10:68435207-68435229 CCAAAAATACAAAAATTAGGAGG - Intronic
1069538497 10:69274434-69274456 CCAAAAATACAAAAAGTAGCTGG + Intronic
1070228045 10:74532314-74532336 CTAATAATACACAAAATAGCAGG + Intronic
1070284988 10:75076383-75076405 CCAATAATTTTCAAAGAATGGGG - Intergenic
1070303147 10:75219987-75220009 CCAAAAATACAAAAATTAGGTGG - Intronic
1070535408 10:77373706-77373728 CCACTGATGCAAAAAGAAGGTGG + Intronic
1070728954 10:78811843-78811865 CCAATAGAACACAAAGACAGAGG - Intergenic
1070914354 10:80143556-80143578 CTAAAAATACAAAAAGAAGCCGG - Intronic
1071060581 10:81566857-81566879 CCAAAAATGCACAAAGAAACAGG + Intergenic
1071903895 10:90151675-90151697 CCAAAAATACAAAAATTAGGCGG - Intergenic
1073285834 10:102387503-102387525 CTAATAATACAAAAATAAGCCGG + Intergenic
1073372838 10:103006366-103006388 CCAATAATACAAAAATTAGCTGG - Intronic
1075759104 10:124841737-124841759 CCAATAATACAAAAATTAGCAGG - Intergenic
1077255364 11:1579875-1579897 CCAAAAATACACAAATTAGCCGG - Intergenic
1078202742 11:9198447-9198469 CCAAAAATACAAAAATTAGGTGG + Intronic
1078971892 11:16423539-16423561 GCAATAATACATAAAGAAAAAGG + Intronic
1081227809 11:40546367-40546389 ACAGTAATACAGATAGAAGGTGG - Intronic
1082827616 11:57592159-57592181 CCAAAAATACAAAAATTAGGTGG - Intergenic
1082879656 11:58025361-58025383 CCAAAAATACAAAAAGTAGCTGG - Intronic
1084144948 11:67260196-67260218 CTAATAATACAAAAATAAGCCGG + Intergenic
1084253393 11:67921015-67921037 CAACTAAGACACAAAGGAGGTGG + Intergenic
1084375813 11:68776715-68776737 CCAAAAATACAAAAATTAGGTGG + Intronic
1084819483 11:71674911-71674933 CAACTAAGACACAAAGGAGGTGG - Intergenic
1086693643 11:89818334-89818356 CCATAATTACACAAATAAGGTGG - Intergenic
1086712503 11:90026235-90026257 CCATAATTACACAAATAAGGTGG + Intergenic
1086919797 11:92573382-92573404 CCAATAAAACAGAAAGCAGAGGG - Intronic
1087689309 11:101301129-101301151 CCTAAAATACACAAAGCAGTTGG + Intergenic
1088236267 11:107727722-107727744 CCAAAAATAAAAAAAAAAGGAGG - Intergenic
1088316467 11:108511930-108511952 CCAAGAATACACTGAGAAAGAGG - Exonic
1089442123 11:118526262-118526284 CCAAAAATAGAGAAACAAGGAGG - Exonic
1089834174 11:121355663-121355685 CCATAAAAACACAAAGAATGGGG + Intergenic
1091859550 12:3767958-3767980 TCAATAAAACTCAGAGAAGGTGG + Intergenic
1092147904 12:6227520-6227542 TGAATGACACACAAAGAAGGGGG - Intronic
1092353895 12:7778583-7778605 CTAATAATACAAAAATAAGCCGG + Intergenic
1092829699 12:12431853-12431875 CTAAAAATACAAAAAGTAGGTGG - Intronic
1093121362 12:15275399-15275421 CTAGTAATGCCCAAAGAAGGAGG - Intronic
1093172057 12:15872520-15872542 CAAAAAATACAAAAAGTAGGTGG + Intronic
1093228464 12:16514200-16514222 CCAATCATACACCAAGAACATGG + Intronic
1095743565 12:45633073-45633095 CCAAAAATAAACAAAGAATGAGG + Intergenic
1096391104 12:51229818-51229840 CCAAAAATACAAAAAGTAGCCGG - Intergenic
1097791124 12:63816784-63816806 CTAATAATACAAAAATAAGCTGG - Intergenic
1098283840 12:68888276-68888298 CCAATATTATTTAAAGAAGGAGG + Intronic
1098399199 12:70055166-70055188 ATAATAATAAATAAAGAAGGAGG - Intergenic
1098531809 12:71550310-71550332 CCAAAAATACAAAAATTAGGTGG - Intronic
1100366341 12:93924251-93924273 CCCATAAAAATCAAAGAAGGTGG + Intergenic
1100484435 12:95011288-95011310 CCAATGAAACACAGGGAAGGTGG - Intergenic
1100520865 12:95374390-95374412 ATAATAATAAAAAAAGAAGGGGG + Intergenic
1100638416 12:96458140-96458162 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1100818565 12:98409269-98409291 CCAATAATACAAAAATAAGCTGG + Intergenic
1100954231 12:99888772-99888794 CCAATAATACATTTAGAATGAGG - Intronic
1101865002 12:108514341-108514363 CTAAAAATACACAAATTAGGCGG + Intergenic
1102579397 12:113876627-113876649 CCAAAAATACAAAAATAAGCTGG + Intronic
1102754993 12:115332186-115332208 GCAATAATACCCAAATAATGTGG - Intergenic
1102983093 12:117257964-117257986 CTAATAATACAAAAATTAGGCGG - Intronic
1103316314 12:120058750-120058772 CTAAAAATACAAAAATAAGGCGG - Intronic
1103827477 12:123751491-123751513 CCAAGAATACAAAAATAAGCCGG + Intronic
1104700241 12:130897479-130897501 ACAAAAATACAAAAAGAAAGTGG - Intergenic
1105300251 13:19127370-19127392 CCAAAAATACAAAAATTAGGCGG + Intergenic
1105430917 13:20336630-20336652 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1105497963 13:20946983-20947005 CTGAAAATACACAAAGAAGCTGG - Intergenic
1106018408 13:25891482-25891504 CCAAAAATACAAAAATCAGGCGG - Intronic
1106384056 13:29267243-29267265 TCAATAATGCATAAAGGAGGTGG + Intronic
1107974080 13:45672657-45672679 CTAATATTACAGAAAGATGGAGG - Intergenic
1108160730 13:47635862-47635884 CCAGAAATACAAAAAGAAGCTGG + Intergenic
1108317503 13:49251244-49251266 CCAAAAATACAAAAAGTAGCTGG + Intronic
1109108818 13:58290142-58290164 CTAATAATACAAAAAGTAGCCGG - Intergenic
1110883917 13:80608740-80608762 CCAAGTATACACAAAAAAGCAGG + Intergenic
1111531890 13:89547655-89547677 ACAAAAATACACATAGAGGGAGG - Intergenic
1111619807 13:90709893-90709915 CTAATATAACACAAGGAAGGGGG + Intergenic
1112016347 13:95334494-95334516 CCAAAAATACACAAATTAGCCGG + Intergenic
1112782524 13:102916682-102916704 CCAAAAATACACAAATTAGTCGG - Intergenic
1113815187 13:113164702-113164724 CCAGTACTACAGAAGGAAGGAGG - Intronic
1114770170 14:25421385-25421407 CCACTAGTGCACAGAGAAGGAGG - Intergenic
1115252588 14:31365034-31365056 CCAATAATACAAAAATTAGCCGG - Intronic
1115498711 14:34030729-34030751 CTAAAAATACACAAATTAGGTGG - Intronic
1115775999 14:36715927-36715949 CTAATAATACAAAAAGTAGCTGG + Intronic
1116172648 14:41422797-41422819 CCAAAAATACAAAAAGTAGCCGG - Intergenic
1116212838 14:41969816-41969838 CCAAAAATACAAAAATTAGGTGG + Intergenic
1116411701 14:44632143-44632165 CCAAAAATACAAAAAGTAGCTGG + Intergenic
1116858522 14:49974879-49974901 CTAAAAATACAAAAAGTAGGTGG - Intergenic
1117461579 14:55950611-55950633 CCAAAAATACACAAATTAGCTGG + Intergenic
1119048112 14:71338899-71338921 CTAAAAATACAAAAAGAAGCCGG - Intronic
1120181496 14:81347249-81347271 CCAAAAATACACAAATAAAAAGG + Intronic
1120625575 14:86821543-86821565 CCAATAACAAACAACAAAGGAGG + Intergenic
1122456107 14:101852792-101852814 CCAAAATGACAGAAAGAAGGTGG - Intronic
1122533791 14:102447694-102447716 CCAAAAATACACAAATTAGCTGG - Intronic
1122554533 14:102570374-102570396 CTAAAAATACAAAAATAAGGCGG - Intergenic
1123465241 15:20510265-20510287 CCAAAAATACAAAAATTAGGTGG - Intergenic
1123652875 15:22490764-22490786 CCAAAAATACAAAAATTAGGTGG + Intergenic
1123743296 15:23299630-23299652 CCAAAAATACAAAAATTAGGTGG + Intergenic
1124143287 15:27096730-27096752 CAACAAATACAAAAAGAAGGTGG - Intronic
1124275969 15:28326244-28326266 CCAAAAATACAAAAATTAGGTGG - Intergenic
1124292164 15:28463209-28463231 CCAAAAATACAAAAATTAGGTGG + Intergenic
1124306731 15:28585356-28585378 CCAAAAATACAAAAATTAGGTGG + Intergenic
1124321561 15:28715927-28715949 CTAAAAATACACAAATTAGGTGG + Intronic
1124911039 15:33920935-33920957 CCAAAAATACACAAATTAGCTGG - Intronic
1125564415 15:40665192-40665214 CCAAAAATACACAAATTAGCTGG - Intergenic
1126024798 15:44435406-44435428 CCAAAAATACAAAAATTAGGCGG + Intronic
1126458783 15:48893558-48893580 CCGATAATTCACACAAAAGGAGG + Intronic
1126970408 15:54104838-54104860 ACAATAAGACACTGAGAAGGTGG + Intronic
1127091613 15:55472454-55472476 CTAATAATACAAAAATTAGGTGG + Intronic
1128416176 15:67448025-67448047 CCTATAATAAACTCAGAAGGCGG + Intronic
1129365412 15:75051038-75051060 CAAATAATACAAAAATAAGCTGG - Intronic
1130315033 15:82787939-82787961 CCAAAAATACAAAAATAAGCTGG - Intronic
1131113291 15:89778387-89778409 CCACTAATTAACAAATAAGGAGG - Exonic
1131313314 15:91310374-91310396 CTAAAAATACAAAAAGTAGGTGG - Intergenic
1131476637 15:92745645-92745667 CCAAAAATACAAAAATTAGGCGG + Intronic
1132377016 15:101335119-101335141 CCAAAAATACAAAAAGTAGCCGG - Intronic
1132752862 16:1466789-1466811 CTAAAAATACAAAAAGTAGGCGG + Intronic
1133862399 16:9608664-9608686 AAAACGATACACAAAGAAGGGGG - Intergenic
1134103111 16:11466548-11466570 CCAAAAATACAAAAAGTAGCCGG - Intronic
1134538235 16:15043784-15043806 CCAAAAATACAAAAATTAGGTGG + Intronic
1135126923 16:19818552-19818574 CTAATAATACAAAAATTAGGTGG - Intronic
1135558096 16:23453842-23453864 CTAATAATACAAAAAGTAGCCGG - Intergenic
1135930281 16:26730481-26730503 CCCAGAACACACAATGAAGGAGG - Intergenic
1136869893 16:33796999-33797021 ACAATAACACATAAAGAAGCTGG - Intergenic
1137258389 16:46798344-46798366 CTAAAAATACAAAAAGAAGCTGG + Intronic
1137265492 16:46865722-46865744 CAAAAAATACAAAAAGTAGGTGG + Intergenic
1137335896 16:47548443-47548465 CCAAAAATACAAAAAGTAGCTGG + Intronic
1137639522 16:50016321-50016343 CAAATAATACACAAACGCGGAGG - Intergenic
1138047000 16:53735545-53735567 CCAAGAATACCTAAAAAAGGAGG - Intronic
1138516401 16:57537336-57537358 CCAACAATTCACCAAGATGGTGG + Intergenic
1138944692 16:61834570-61834592 TCAAGAATACTCAAAAAAGGTGG + Intronic
1139013418 16:62661392-62661414 CCAATAATACACAGAAAGGCAGG + Intergenic
1139728350 16:68920948-68920970 CTAAAAATACAAAAAAAAGGTGG + Intronic
1140448234 16:75049164-75049186 CTAAAAATACAAAAAGAAGCTGG - Intronic
1140460990 16:75139528-75139550 CCAAAAATAAACAAATAAGTTGG + Intergenic
1140697408 16:77548650-77548672 CTAAAAATACAAAAAAAAGGAGG + Intergenic
1141937597 16:87251952-87251974 CCAAAAATACACAAATTAGCTGG - Intronic
1142312872 16:89324011-89324033 CCAAAAATACAAAAAGTAGCTGG - Intronic
1203102279 16_KI270728v1_random:1319056-1319078 ACAATAACACATAAAGAAGCTGG + Intergenic
1142657679 17:1404716-1404738 CCAAAAATACAAAAAGTAGCTGG + Intergenic
1143434301 17:6911946-6911968 GTAAAAAGACACAAAGAAGGTGG + Intronic
1144000409 17:11048997-11049019 CTAATAATACACAAATTAGTTGG + Intergenic
1145803301 17:27705956-27705978 CCAAAAATACAAAAATTAGGTGG + Intergenic
1147860131 17:43515348-43515370 CCAAAAATACAAAAATTAGGTGG - Intronic
1148651185 17:49251262-49251284 CCAAGAATAAACAATAAAGGGGG - Intergenic
1149320884 17:55479421-55479443 CTAAAAATACAAAAAGTAGGTGG + Intergenic
1149762312 17:59243342-59243364 CCAAAAATACAAAAATTAGGTGG + Intronic
1149974733 17:61254127-61254149 CTAATAATACCTAAGGAAGGAGG - Intronic
1150126538 17:62639172-62639194 CCAAAAATACAAAAAGTAGCTGG + Intronic
1150605068 17:66683759-66683781 CTAAAAATACAAAAAGAAGCCGG - Intronic
1151790552 17:76303043-76303065 CCAAAAATACAAAAATTAGGTGG - Intronic
1151793288 17:76323982-76324004 CTAATAATACAAAAATTAGGCGG + Intronic
1151926674 17:77202617-77202639 CAAATAAAAAACAAAAAAGGAGG + Intronic
1152506738 17:80754309-80754331 CGAATGACACAAAAAGAAGGCGG - Intronic
1152837847 17:82546276-82546298 CCAAAAATACAAAAATTAGGCGG - Intronic
1153046890 18:864180-864202 CTAACAATACACAAAGTAGCTGG + Intergenic
1153127807 18:1817215-1817237 ACAATAATACACCCAGAAGAAGG - Intergenic
1153230378 18:2929742-2929764 CTAAAAATACAAAAATAAGGCGG + Intronic
1153274385 18:3353525-3353547 CTAATAATACAAAAAGTAGCCGG - Intergenic
1153439646 18:5102259-5102281 CCAATAATACAAAAATTAGCTGG - Intergenic
1154967937 18:21378273-21378295 CCAATGCTACCCAAAGAAGAAGG - Intronic
1155128645 18:22906298-22906320 TCAAGAATACATAAAGAAGCTGG - Intronic
1155645935 18:28077727-28077749 CCAAAAATACAAAAATTAGGCGG + Intronic
1155898871 18:31363016-31363038 CCAAAAATACAAAAATTAGGAGG - Intergenic
1155953025 18:31933539-31933561 TCAACAATACATAATGAAGGCGG + Intronic
1156334348 18:36155172-36155194 CTAAAAATACAAAAAGAAGATGG - Intronic
1156342317 18:36220757-36220779 CTAAAAATACAAAAAGAAGCTGG + Intronic
1158045973 18:53155863-53155885 CCAAAAATACACAAATTAGCCGG + Intronic
1159121665 18:64178221-64178243 CTAATAATACACAAATTAGCTGG - Intergenic
1159181631 18:64913997-64914019 AAAAGAAAACACAAAGAAGGAGG - Intergenic
1159256451 18:65953652-65953674 CCAAAAATACAAAAATTAGGAGG - Intergenic
1159447005 18:68553528-68553550 CCAAAAATACACAAATTAGCTGG + Intergenic
1159977987 18:74739655-74739677 CCAAAAATACACTATGAAGGAGG + Intronic
1160886537 19:1352176-1352198 CTAAAAATACAAAAAGTAGGCGG + Intergenic
1160911658 19:1476776-1476798 CCAAAAATACACAAACTAGCTGG - Intronic
1161020857 19:2010798-2010820 CTAAAAATACACAAATAAGCTGG - Intronic
1161616411 19:5273329-5273351 CCCAAAAAACACAAAGCAGGAGG + Intronic
1162215383 19:9129644-9129666 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1162455520 19:10781887-10781909 CCAAAACTACACCGAGAAGGAGG - Intronic
1162705232 19:12550492-12550514 CCAAAAATACAAAAAGTAGCCGG + Intronic
1162820873 19:13222854-13222876 CCAAAAATACAAAAAGTAGCCGG - Intronic
1163543922 19:17929588-17929610 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1165389526 19:35530315-35530337 CCAAAAACACAAAAAGAAGATGG - Intergenic
1165532207 19:36413247-36413269 CCAATAATACAAAAATAAGCTGG + Intronic
1165556252 19:36635179-36635201 CCAAAAATACAAAAATAAGCTGG - Intergenic
1165791933 19:38497810-38497832 CAAAAAATACAAAAAGTAGGTGG + Intronic
1165823133 19:38689833-38689855 CTAATAATACAAAAAGTAGCCGG - Intronic
1166841614 19:45700795-45700817 CTAATAATACACAAATTAGCTGG + Intronic
1167073316 19:47233234-47233256 CCAATAATACAAAAATTAGCTGG - Intergenic
1167352467 19:48984166-48984188 CCAAAAATACAAAAATTAGGTGG - Intronic
1168382276 19:55933861-55933883 CCAAAAATACAAAAATTAGGTGG + Intergenic
1168521489 19:57054357-57054379 CCAAAAATACAAAAATTAGGTGG + Intergenic
925773434 2:7307281-7307303 CAGATAGAACACAAAGAAGGAGG + Intergenic
925982442 2:9188081-9188103 CCAAGCATACACAAGGTAGGAGG - Intergenic
928027148 2:27749625-27749647 GAATTAATACTCAAAGAAGGAGG - Intergenic
928633639 2:33219747-33219769 CAAAAGATACACAAAGAAGGGGG - Intronic
928905777 2:36365893-36365915 CTAAAAATACACAAAGTAGTTGG - Intronic
929178729 2:39009598-39009620 CCAATAATACACAAAGAAGGTGG + Intronic
929329052 2:40657201-40657223 GTAAGAATACAAAAAGAAGGTGG + Intergenic
929504698 2:42519442-42519464 CCAAAAATACAAAAAGTAGCCGG + Intronic
930208184 2:48609142-48609164 CATATAAGACAAAAAGAAGGAGG - Intronic
930823309 2:55669918-55669940 CCAAAAATACAAAAATTAGGCGG - Intronic
931552904 2:63467316-63467338 CTAAAAATACACAAATAAGCCGG + Intronic
931878819 2:66544373-66544395 CCAAAAATTCACAAAGAAGTAGG - Intronic
932161188 2:69461751-69461773 CCAAAAATACAAAAAGTAGCTGG - Intronic
932357089 2:71075958-71075980 CCAATTATACTCAAAGAACTAGG + Intronic
933060193 2:77727135-77727157 GCAATCATACACAAGGAAAGGGG - Intergenic
933142796 2:78814831-78814853 CCAAAAATACAAAAAGTAGCCGG + Intergenic
933280123 2:80323683-80323705 TCACTAATAGAAAAAGAAGGAGG - Intronic
933337405 2:80975816-80975838 CCAATAATACAAAAATTAGCTGG - Intergenic
934675148 2:96244538-96244560 CTAATAATACAAAAATTAGGTGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935519355 2:104084940-104084962 CCAGTAAAACAGAAAGAAAGGGG - Intergenic
935862539 2:107348602-107348624 CCAAAAATACAAAAATTAGGGGG + Intergenic
936464719 2:112737086-112737108 CTAAAAATACAAAAAGTAGGCGG - Exonic
937567021 2:123306459-123306481 CCATTAATACACTAAGATGCAGG + Intergenic
937832165 2:126435834-126435856 CCAAAAATACAAAAATTAGGTGG - Intergenic
938578201 2:132622948-132622970 CTAAAAATACACAAAGTAGCCGG + Intronic
938826238 2:135008282-135008304 CTAAAAATACAAAAATAAGGCGG - Intronic
939231337 2:139429977-139429999 CCGATAATCCACAATAAAGGAGG - Intergenic
939253599 2:139715204-139715226 CCAAAAATACAAAAATAAGCTGG + Intergenic
939386314 2:141503585-141503607 CAAATTATACAGATAGAAGGAGG - Intronic
939935025 2:148280590-148280612 CCAAAAATACAAAAATAAGCTGG - Intronic
940805827 2:158185433-158185455 GAAATAATTCTCAAAGAAGGTGG - Intronic
941945233 2:171089041-171089063 CCAAAAATACAAAAAGTAGCCGG - Intronic
941980381 2:171449167-171449189 CCAAAAATACAAAAAGTAGCTGG - Intronic
944385420 2:199158367-199158389 CCAGAAATACAAAAAGAAGCTGG + Intergenic
945038004 2:205720769-205720791 CCAATCATAAACAAAGCTGGGGG + Intronic
945265377 2:207886106-207886128 CCAATATTTCACAAAAAAAGGGG + Intronic
945604639 2:211913248-211913270 ACAATAATAAACATAGAATGTGG + Intronic
945623853 2:212175393-212175415 ACAAAAACACACACAGAAGGAGG - Intronic
946541148 2:220685999-220686021 CCGATGAAACACAAAGCAGGAGG - Intergenic
946633830 2:221702100-221702122 CCAATAATAACAAAAGAAAGAGG - Intergenic
947027413 2:225752214-225752236 GCACTAATACAGAAAGAAGTAGG - Intergenic
947604106 2:231472735-231472757 CCAAAAATACAAAAATTAGGTGG + Intronic
947773400 2:232688647-232688669 CCAAAAATACAAAAAGTAGCTGG - Intergenic
947976864 2:234374226-234374248 CTAATCATACACAAACAATGTGG + Intergenic
948112492 2:235467705-235467727 CCAAAAATACAAAAATAAGCCGG + Intergenic
948186100 2:236022694-236022716 CCAAAAATACAAAAAGCAGTTGG - Intronic
1169059256 20:2649326-2649348 CCAATAATACAAAAATTAGCTGG + Intergenic
1169654190 20:7904081-7904103 CAAATAAGGAACAAAGAAGGAGG - Intronic
1170175307 20:13462021-13462043 CCAATAAGACACAAGGAGGCAGG + Intronic
1170275716 20:14584495-14584517 GCAAGAATACAAAAAGAAGATGG - Intronic
1170831878 20:19849973-19849995 CCAAAAATAGACATAGGAGGAGG - Intergenic
1172236004 20:33375103-33375125 CCAAGAATACATAAAGAGGCTGG + Intronic
1172253309 20:33495234-33495256 CTAAAAATACAAAAAGAAGCTGG + Intronic
1172392087 20:34572490-34572512 CCAAAAATACAAAAATTAGGCGG + Intronic
1172517474 20:35544962-35544984 CCAAAAATACAAAAAGTAGCCGG - Intronic
1174029569 20:47611628-47611650 CTAATAATACAGAAATGAGGTGG + Intronic
1174722161 20:52824418-52824440 CCAATAATACAAAAATTAGCCGG + Intergenic
1176306725 21:5127616-5127638 CCAAAAATACACAAATTAGTTGG + Intronic
1176342689 21:5713397-5713419 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176474943 21:7145548-7145570 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176502138 21:7611059-7611081 GGAGTAATACACAGAGAAGGAGG + Intergenic
1176537010 21:8111466-8111488 GGAGTAATACACAGAGAAGGAGG - Intergenic
1176936657 21:14875439-14875461 CCAATAATCCCCCATGAAGGTGG - Intergenic
1178335432 21:31738329-31738351 CTAAAAATACAAAAATAAGGTGG - Intergenic
1178399262 21:32270233-32270255 CCAATACCAAATAAAGAAGGAGG + Intronic
1178535388 21:33405868-33405890 CCAAAAATACAAAAATTAGGGGG + Intronic
1178584363 21:33860143-33860165 CCAAAAATACAAAAAGTAGCCGG + Intronic
1179447564 21:41443448-41443470 CACATATTACACATAGAAGGGGG + Intronic
1179570301 21:42274634-42274656 CCAAAAATACACAAATCAGCCGG - Intronic
1179606054 21:42515918-42515940 CCAAAAATACACAAAAGAGCTGG - Intronic
1179850332 21:44134414-44134436 CCAAAAATACACAAATTAGTTGG - Intronic
1181436178 22:22912220-22912242 ACAATGATACACAAAGAGAGGGG + Intergenic
1184149608 22:42630597-42630619 CCAACAAAAGCCAAAGAAGGGGG - Intronic
1203241961 22_KI270733v1_random:27870-27892 GGAGTAATACACAGAGAAGGAGG - Intergenic
949851233 3:8422423-8422445 CCAATTGTACCCAAAGTAGGAGG + Intergenic
950337277 3:12206386-12206408 CTAAAAATACAAAAAGTAGGTGG - Intergenic
951135842 3:19103345-19103367 CCAATAATAGACAAACAGAGGGG - Intergenic
951214986 3:20015278-20015300 CCAAAAATACACAAATTAGCTGG + Intergenic
951726359 3:25765296-25765318 CCAAAAATACAAAAATAAGCTGG + Intronic
953356357 3:42259545-42259567 TCAGTAAGACTCAAAGAAGGGGG + Intronic
953728509 3:45423472-45423494 TCAACAATACAAAAAGAAGCCGG - Intronic
953817610 3:46173294-46173316 TCAAAAATACATAAACAAGGGGG - Intronic
953892029 3:46757974-46757996 CCTATAATACTCAAAGAAACAGG + Intronic
954771673 3:52975761-52975783 CCAAAAATACAAAAAGTAGCCGG - Intronic
956288068 3:67631464-67631486 CCAAAAATACAAAAAGTAGCCGG + Intronic
957502810 3:81078644-81078666 CCATGACTACACAAATAAGGGGG + Intergenic
957689017 3:83543558-83543580 CCAAAAATACAAAAAGTAGCTGG - Intergenic
957985338 3:87567912-87567934 CCAAAAATACAAAAATTAGGCGG + Intergenic
960216085 3:115039214-115039236 ACAATAATATCCTAAGAAGGGGG + Intronic
960437528 3:117645502-117645524 CTAATAATACAAAAATTAGGTGG - Intergenic
960710598 3:120523820-120523842 CCAAAAATACACAAATTAGCCGG + Intergenic
961285683 3:125800498-125800520 CAACTAAGACACAAAGGAGGTGG - Intergenic
961700357 3:128739349-128739371 CCAAAAATACAAAAAGTAGCTGG + Intronic
961901056 3:130212422-130212444 CAACTAAGACACAAAGGAGGTGG + Intergenic
961994918 3:131232408-131232430 CCAGTAATACACATACTAGGTGG + Intronic
962408926 3:135124314-135124336 CTGATGATACACAGAGAAGGAGG - Intronic
962782827 3:138737229-138737251 CTAAAAATACAAAAAGAAGCTGG + Intronic
963517449 3:146326309-146326331 CAAAGAACACACAAAAAAGGAGG - Intergenic
963881197 3:150530959-150530981 CCAAAAATACAAAAATTAGGTGG - Intergenic
964353207 3:155823506-155823528 CCAAAAATACAAAAATAAGCTGG + Exonic
965909680 3:173757555-173757577 GCAATTATAGCCAAAGAAGGTGG + Intronic
966603289 3:181796543-181796565 CCAAAAATACAAAAATTAGGTGG - Intergenic
966633033 3:182099677-182099699 CCAAAAATACACAAACTAGCTGG - Intergenic
967110263 3:186286870-186286892 CCAAAAATACAAAAAGTAGCTGG + Intronic
967626917 3:191697324-191697346 CCAAAAATACAAAAAGTAGCCGG + Intergenic
967797502 3:193613551-193613573 CAAAAAAAAAACAAAGAAGGAGG - Intronic
967916603 3:194583127-194583149 CCAAAAATACAAAAAGTAGCCGG - Intergenic
969012046 4:4074046-4074068 CAACTAAGACACAAAGGAGGTGG + Intergenic
969062691 4:4450602-4450624 CAAATAATAAATACAGAAGGAGG - Intronic
969265995 4:6064419-6064441 CCAAAAATATATAAAGAAGAAGG - Intronic
969635567 4:8367667-8367689 CCAATAATTTCCAAAGAAGAGGG - Intronic
969742045 4:9035673-9035695 CAACTAAGACACAAAGGAGGTGG - Intergenic
969801416 4:9568562-9568584 CAACTAAGACACAAAGGAGGTGG - Intergenic
970365891 4:15357875-15357897 CCAATAATAGACAAACAGAGAGG - Intronic
970768338 4:19578653-19578675 CCACTAATACATAAAATAGGAGG + Intergenic
971433828 4:26598007-26598029 AAAATAACACACAAAGAAAGGGG - Intronic
971496546 4:27272376-27272398 TCAATAATGCACAAAGAAAATGG - Intergenic
971646540 4:29213722-29213744 CCAAAAATACAAAAAGTAGCTGG - Intergenic
971998872 4:34003000-34003022 GCACTGAAACACAAAGAAGGAGG + Intergenic
972243140 4:37215836-37215858 AAAATAATACAAAAAGAGGGAGG + Intergenic
972397268 4:38668465-38668487 CCATTTATACATAAAGAATGTGG - Intronic
973221457 4:47731705-47731727 CCAATAATACAAAAATTAGCTGG + Intronic
974739211 4:65982880-65982902 CCAAAAATACAAAAATTAGGAGG + Intergenic
974810815 4:66943607-66943629 GCAATAATACTTAAAGAAAGGGG + Intergenic
974879412 4:67735565-67735587 CCAATCATGCTCAAAGAAAGGGG + Intergenic
974937392 4:68424525-68424547 CCAATAATAGACAAACAGAGAGG + Intergenic
976654913 4:87478597-87478619 CCAAAAATACAAAAATTAGGCGG - Intronic
978845449 4:113268041-113268063 CCAATAATAGACAAACAGAGAGG - Intronic
978982244 4:114960975-114960997 GCAATAATAAAGAAGGAAGGAGG + Intronic
979690854 4:123556702-123556724 CCAGGAATACACAAAGAGGGTGG + Intergenic
980381806 4:132030884-132030906 CTAAAAATACAAAAAGAAGCTGG - Intergenic
980925112 4:139128681-139128703 CCAAAAATACACAAATTAGCTGG - Intronic
981623131 4:146726289-146726311 CCAAAAATTCAAAAAGTAGGTGG + Intronic
982000577 4:151017452-151017474 CCAAAAATACAAAAATTAGGCGG - Intergenic
982006016 4:151063473-151063495 CCAAAAATACAAAAAGTAGCTGG + Intergenic
982040118 4:151389170-151389192 CCAAAAATACAAAAAGTAGCTGG + Intergenic
982985147 4:162197856-162197878 CTAAAAATACACAAATAAGCTGG + Intergenic
983292883 4:165828086-165828108 CCAATAATTCACAAAAGTGGAGG + Intergenic
983886234 4:172983531-172983553 CAAATAATACAAAAAGTAGCCGG + Intronic
984052044 4:174876264-174876286 CCAAAAATACAAAAAGTAGCTGG + Intronic
984394875 4:179184234-179184256 ACCATAATACACAAAGAAACTGG + Intergenic
984706319 4:182849694-182849716 CTAAAAATACAAAAAGTAGGTGG - Intergenic
985934730 5:3088233-3088255 CCAAAAATACAAAAAGTAGCTGG + Intergenic
985941029 5:3136055-3136077 CCAATGATATGCAAAGAAGATGG + Intergenic
987104424 5:14623378-14623400 CCAAAAATACAAAAAGTAGCCGG + Intergenic
988465745 5:31490035-31490057 CCAAAAATACACAAATTAGCTGG - Intronic
988497098 5:31754563-31754585 CTTAAAATACACAAAGAAGCTGG - Intronic
989508176 5:42252049-42252071 CCCATAATCTAAAAAGAAGGAGG + Intergenic
990041721 5:51384780-51384802 CAAATAATACATAAAGAGTGGGG - Intronic
990525628 5:56624128-56624150 CCAAAAATACAAAAAGTAGCCGG - Intergenic
991121108 5:63015370-63015392 CTAATAATACACAAATTAGCTGG + Intergenic
991376664 5:65975167-65975189 CCAATAATACAAAAATCAGCTGG - Intronic
991389273 5:66124955-66124977 CCAAAAATACAAAAAGTAGCTGG + Intergenic
992765310 5:79993019-79993041 ACAATCATACAGAAAGAATGTGG + Intronic
993575704 5:89597698-89597720 TCATTATTACACAAAGGAGGTGG + Intergenic
993742865 5:91562195-91562217 CCAAAAATAGACAAAGTAAGTGG + Intergenic
994134909 5:96274860-96274882 CAAATAATAAACAAAAAAGAAGG + Intergenic
995213750 5:109571202-109571224 CCAATAATGCACAGAGGAAGAGG + Intergenic
995867982 5:116712902-116712924 CCGATAATACACAGAGTTGGTGG + Intergenic
996469947 5:123848637-123848659 CTAAAAATACACAAAGTAGCCGG - Intergenic
996652236 5:125892970-125892992 CTAAAAATACAAAAAGTAGGCGG + Intergenic
998006101 5:138657975-138657997 CCAAAAATACAAAAATTAGGTGG + Intronic
998125658 5:139619232-139619254 CCAATAATACAAAAATTAGCAGG + Intronic
998393785 5:141805241-141805263 CCAAGAAGAGACAAGGAAGGTGG + Intergenic
998423546 5:142008563-142008585 CTAAAAATACACAAAGTAGCTGG + Intronic
998839844 5:146241618-146241640 CCAAAAATACAAAAATTAGGTGG - Intronic
998967468 5:147555927-147555949 CCAATAATACAAAAATTAGCCGG + Intergenic
999769532 5:154764741-154764763 CCAAAAATACAAAAAGTAGCTGG + Intronic
1000070325 5:157734608-157734630 CCAATAAAACACATAGCTGGAGG - Exonic
1000415099 5:160976172-160976194 CCCTCAATACACACAGAAGGAGG - Intergenic
1001062064 5:168500024-168500046 CTAATAATACAAAAATTAGGCGG + Intronic
1001809343 5:174615482-174615504 CCAAAAATACAAAAATAAGCCGG - Intergenic
1002410287 5:179069399-179069421 CCAAAAATACAGAAAGTAGCAGG + Intronic
1003215260 6:4103741-4103763 CCAAAAATACAAAAAGTAGCTGG - Intronic
1003367891 6:5494318-5494340 CCTTTAGTTCACAAAGAAGGCGG + Intronic
1003859002 6:10304725-10304747 CCAAAAATACAAAAATTAGGTGG - Intergenic
1004514531 6:16311040-16311062 CCAGTAATACACACAGGAGAAGG - Intronic
1004529433 6:16439911-16439933 CCAAAAATACAAAAATTAGGTGG + Intronic
1004931390 6:20466272-20466294 CCAAAAATACAAAAAGTAGCCGG - Intronic
1006205562 6:32338672-32338694 CCAGTAACACTCAAAGAAAGAGG - Intronic
1006876277 6:37299845-37299867 CCAAAAATACACAAATTAGCCGG + Intronic
1007569270 6:42877639-42877661 CCAATAATATTAAAAGGAGGAGG - Intergenic
1007681564 6:43637224-43637246 CCAAAAATACAAAAATAAGCTGG - Intronic
1008589260 6:52976723-52976745 CCAATAATAAAAAAAGAAAATGG - Intergenic
1008768179 6:54945550-54945572 CTAAAAATACACAAATTAGGTGG - Intergenic
1008951594 6:57166187-57166209 CCAAAAATACAAAAATTAGGCGG - Intronic
1009685630 6:66952748-66952770 AAAATAATACACAATGAAAGTGG - Intergenic
1009976752 6:70679178-70679200 CCAAAAATACAAAAATTAGGCGG - Intronic
1010193213 6:73214361-73214383 CCAAAAATACAAAAAGTAGCTGG + Intronic
1010638362 6:78288253-78288275 CCAATAATACATGAAAAAGGTGG - Intergenic
1011451628 6:87498607-87498629 CCAAAAATACAAAAATAAGCCGG + Intronic
1011546493 6:88487027-88487049 CCAAAAATACAAAAAGTAGCTGG + Intergenic
1011859725 6:91739585-91739607 CCAATAGAACAGAAAGATGGAGG + Intergenic
1012230325 6:96753420-96753442 CAAATAATAAACAAAAAAGATGG + Intergenic
1012426296 6:99118489-99118511 CAAAGAAGTCACAAAGAAGGCGG + Intergenic
1013129230 6:107215973-107215995 CCAAAAATACACAAATTAGTTGG + Intronic
1013896238 6:115091883-115091905 GAAATAATACATAAAGAAAGGGG - Intergenic
1014624965 6:123714135-123714157 CCAATGATACAAAAAGATGTTGG + Intergenic
1015397157 6:132747453-132747475 CCAAAAATACAAAAAGTAGCTGG + Intronic
1016066490 6:139688512-139688534 CCAAAAATACAAAAATAAGCTGG - Intergenic
1017226173 6:152023435-152023457 CCAAAAATAAACAAAGAAAAAGG - Intronic
1017479010 6:154831367-154831389 CCAATAGGACAAAAAAAAGGGGG - Intronic
1018116581 6:160591843-160591865 CAAATAAGACACAAGGAAAGGGG - Intronic
1018358611 6:163043392-163043414 CCAAAAATACAAAAACTAGGTGG + Intronic
1019785569 7:2974989-2975011 CCAAAAATACAAAAACAAGCCGG + Intronic
1020465099 7:8469139-8469161 CCCATATTATACAAAGAAAGGGG + Intronic
1021560153 7:21961559-21961581 CCAATAATACAAAAATTAGCCGG - Intergenic
1022245265 7:28553032-28553054 CCAATAATACACCTTCAAGGTGG + Intronic
1022689621 7:32635558-32635580 ACAATAACACAGAGAGAAGGAGG + Intergenic
1022917188 7:34969736-34969758 ACAATAACACAGAGAGAAGGAGG + Intronic
1023210505 7:37798941-37798963 CCAATAGAACACAAGGAAAGTGG + Intronic
1023361798 7:39424565-39424587 CCAGGAATAGACCAAGAAGGTGG + Intronic
1023708825 7:42970235-42970257 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1026364972 7:69639070-69639092 ATAATAATTCACTAAGAAGGGGG - Intronic
1026641438 7:72129627-72129649 CAAATAATATAGGAAGAAGGAGG + Intronic
1026906166 7:74063939-74063961 CCAAAAATACAAAAATAAGCCGG + Intronic
1027157099 7:75776231-75776253 CCAATAATACAAAAATTAGTCGG - Intronic
1027502252 7:78967707-78967729 CCAAGAATACACAAAGGGGAAGG - Intronic
1027603570 7:80270953-80270975 CCAAAAATGCAGAAACAAGGGGG - Intergenic
1029186159 7:98740244-98740266 CCAAAAATACAAAAAGTAGCCGG + Intergenic
1029433410 7:100547276-100547298 CTGAAAATTCACAAAGAAGGTGG - Intronic
1030508908 7:110458528-110458550 CCAATAATAGACAAACAGAGAGG + Intergenic
1030607256 7:111650777-111650799 CCAATAATGCAAAAAGTAGCAGG - Intergenic
1030745277 7:113158433-113158455 CTAATAATACAAAAAGGAGAAGG - Intergenic
1030849043 7:114459775-114459797 CTAATAATACAAAAAGTAGCCGG - Intronic
1030889886 7:114986466-114986488 CCAGTGATTCACAAGGAAGGAGG - Intronic
1031186139 7:118482119-118482141 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1031529204 7:122855827-122855849 CCAAAAATATGCAAACAAGGAGG - Intronic
1032597398 7:133255336-133255358 CCAAAAATACAAAAATTAGGTGG - Intronic
1032865990 7:135924835-135924857 CCAATAATACAAAAATTAGTTGG - Intergenic
1033052391 7:138017590-138017612 CCAAAAATACAAAAAAAAGCGGG - Intronic
1033069713 7:138191073-138191095 ACAATAATACAGACAGAATGGGG + Intergenic
1033664412 7:143427227-143427249 AAAATAATAAATAAAGAAGGAGG - Intergenic
1033888384 7:145976965-145976987 CCAATAATAGACAAACAGAGAGG - Intergenic
1033966590 7:146982363-146982385 TCAAAAAAACACAAAGAATGGGG - Intronic
1035891629 8:3350724-3350746 CTCATAATACATAAAAAAGGTGG + Intronic
1035951413 8:4025620-4025642 CCAATAATATACAATGAATAAGG + Intronic
1036192315 8:6681108-6681130 CTAATAATACAAAAATAAGCTGG - Intergenic
1036247236 8:7128229-7128251 CAACTAAGACACAAAGGAGGTGG - Intergenic
1036253563 8:7186134-7186156 CAACTAAGACACAAAGGAGGTGG + Intergenic
1036363931 8:8101346-8101368 CAACTAAGACACAAAGGAGGTGG - Intergenic
1036468892 8:9031917-9031939 CCAAAAATACAAAAATTAGGCGG - Exonic
1036887026 8:12565737-12565759 CAACTAAGACACAAAGGAGGTGG + Intergenic
1037070843 8:14646814-14646836 CCAATAATACACCAGGAACTGGG + Intronic
1037515479 8:19627229-19627251 CCACTAATACACAAACCAGATGG + Intronic
1037864032 8:22428602-22428624 CCAAAAATACAAAAATTAGGTGG - Intronic
1038500948 8:28043239-28043261 ACAATAAGAAACAAAGAAGCTGG + Intronic
1038579461 8:28735019-28735041 TCAATAATACACTAAGCAAGAGG - Intronic
1039110296 8:34034535-34034557 CCAATACTATACCAAGATGGGGG + Intergenic
1039499477 8:38005287-38005309 AAAATAAAACACAAAAAAGGAGG - Intergenic
1039629421 8:39092870-39092892 CCAAGAATACACAATGAAGAAGG - Intronic
1039997783 8:42549248-42549270 CCAAAAATACAAAAATAAGCTGG + Intronic
1040516804 8:48142443-48142465 CCAAAAATACAAAAAGTAGCTGG + Intergenic
1040869476 8:52085784-52085806 ACAATAATACAATAAGAAGTTGG - Intergenic
1041535700 8:58923243-58923265 GCTATAATCCACAAAGAAGATGG + Intronic
1041900827 8:62980091-62980113 CCAAGAGTAAAGAAAGAAGGTGG - Exonic
1042268839 8:66935783-66935805 CTAATAATACAAAAATAAGCCGG - Intergenic
1042546658 8:69957196-69957218 CTAAAAATACAAAAATAAGGTGG - Intergenic
1042633844 8:70851132-70851154 CCAATAATAGACAAACAGGGAGG + Intergenic
1043956424 8:86365317-86365339 CTAAAAATACAGAAAGATGGAGG + Intronic
1044731497 8:95232058-95232080 CCAAAAATACAAAAATTAGGCGG - Intergenic
1045203342 8:100010322-100010344 CCAAAAATACACAAATTAGCTGG + Intronic
1045533929 8:103009480-103009502 ACAAGAATCCACAAAGCAGGAGG + Intergenic
1046864751 8:119135139-119135161 CTAATAATACAAAAAGTAGCTGG - Intergenic
1047353496 8:124098013-124098035 CAAATATTAGACAAAGAAGGTGG - Intronic
1047746763 8:127850855-127850877 CTAAAAATACAAAAAGTAGGTGG + Intergenic
1048724124 8:137362265-137362287 CCAATGAGATACTAAGAAGGAGG + Intergenic
1049810463 8:144566400-144566422 CCAAAAATACAAAAATAAGCTGG + Intronic
1049962958 9:754006-754028 CCAAAAATACAAAAATTAGGCGG + Intergenic
1050340128 9:4628606-4628628 CCAAAAATACAAAAAGTAGCTGG - Intronic
1050796171 9:9545749-9545771 CCAATAATGAACAAAGTTGGAGG - Intronic
1051093327 9:13436177-13436199 ACAAAAATACAAAAATAAGGAGG - Intergenic
1051300201 9:15642000-15642022 CCAAAAATACAAAAAGTAGCTGG + Intronic
1052162549 9:25284005-25284027 CCAAGCATTCTCAAAGAAGGTGG + Intergenic
1052735318 9:32335851-32335873 CCTATAATACAATGAGAAGGTGG + Intergenic
1052825789 9:33173240-33173262 CCAAAAATACAAAAAGTAGCTGG + Intergenic
1055078787 9:72246307-72246329 CCAAAAATACAAAAATTAGGTGG - Intronic
1056415648 9:86373291-86373313 CCAAAAATACAAAAATAAGCTGG + Intergenic
1056556964 9:87697650-87697672 CCACTAAGAAACAAAGAAAGAGG + Intronic
1057558166 9:96105071-96105093 CCAGTAATGCACAAAGGAGGTGG - Intergenic
1057602338 9:96469682-96469704 CCAAAAATACAAAAATTAGGTGG - Intronic
1058040994 9:100301835-100301857 TCACAAAAACACAAAGAAGGAGG + Intergenic
1058632876 9:107007651-107007673 CCAAGAATACACCTAGATGGTGG - Intronic
1059676197 9:116542753-116542775 CCAAAAATACAAAAAGTAGCTGG + Intronic
1060356696 9:122914859-122914881 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1060487154 9:124055006-124055028 CCAACAAACCACAAAGAGGGTGG - Intergenic
1060573504 9:124666438-124666460 CAAAAAATACACAAATTAGGTGG - Intronic
1060697239 9:125719874-125719896 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1060900663 9:127254806-127254828 CCAATAACATACAAAAAAGGAGG + Intronic
1060925606 9:127453241-127453263 CTAAAAATACACAAAGAAGCTGG - Intronic
1060956757 9:127646971-127646993 CCAAAAATACAAAAATTAGGTGG - Intronic
1061332161 9:129901748-129901770 CCAAAAATACAAAAAGTAGCCGG + Intronic
1061967123 9:134021452-134021474 CCAAAAATACAAAAAGTAGCTGG + Intergenic
1203458278 Un_GL000220v1:10947-10969 GGAGTAATACACAGAGAAGGAGG - Intergenic
1185555742 X:1019774-1019796 CCAATAATACAAAAATTAGCCGG + Intergenic
1186159969 X:6767204-6767226 CTAATGATACACAAAGAATCTGG + Intergenic
1187347306 X:18477979-18478001 CCACTAAAGCACAAAGGAGGTGG - Intronic
1187654782 X:21459183-21459205 CCAAAAATACAAAAAGTAGCCGG - Intronic
1187858240 X:23657436-23657458 CCAAAAATACAAAAATAAGCCGG + Intergenic
1187985970 X:24811449-24811471 CCAAAAATACAAAAATTAGGGGG - Intronic
1188199478 X:27281493-27281515 CCAAGAATAAACAAAAAAGTGGG - Intergenic
1189390324 X:40570882-40570904 CCCATTATAGAAAAAGAAGGTGG + Intergenic
1189635457 X:43003628-43003650 CAAATAATACAAAAAGTAGCTGG - Intergenic
1189693128 X:43637366-43637388 CCTATAATACTAAAAGAATGGGG - Intergenic
1189711777 X:43820260-43820282 CCAATAATTTACATAGAAGGTGG + Intronic
1190176202 X:48152241-48152263 CCAATAATACAAAAATTAGCTGG + Intergenic
1190523923 X:51309739-51309761 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1191110589 X:56800653-56800675 CCAAAAGTACACAAAGAATCAGG - Intergenic
1191703557 X:64069122-64069144 CAAATAAGAAACAAAGAATGAGG - Intergenic
1191850743 X:65584180-65584202 CCAAAAATACAAAAAGTAGCTGG - Intergenic
1191943441 X:66503924-66503946 ACAATAATAAACACAGAAGAAGG - Intergenic
1192223623 X:69213941-69213963 CCAAAAATACACAAATTAGTGGG + Intergenic
1192889752 X:75377333-75377355 CCAAAAATACAAAAAGCAGCCGG + Intronic
1192924708 X:75743463-75743485 CCAATACTAGAAAAAGCAGGAGG - Intergenic
1193049351 X:77084223-77084245 CCAAAAATACAAAAATTAGGTGG + Intergenic
1193118938 X:77803191-77803213 CTAATAATACACAAATTAGCTGG - Intergenic
1194081143 X:89466558-89466580 CCAAGAATACACAATGGGGGAGG + Intergenic
1194113207 X:89863825-89863847 CTAACATAACACAAAGAAGGTGG - Intergenic
1194250093 X:91563600-91563622 CAAAGAATTCACAAAGAAAGAGG - Intergenic
1194883453 X:99282830-99282852 CTAAAAATACAAAAATAAGGCGG + Intergenic
1195342103 X:103916354-103916376 CCAGTTTTACACAAAAAAGGTGG + Intergenic
1196272719 X:113731457-113731479 CCAATAATAGACAAACAGAGAGG - Intergenic
1197422385 X:126254504-126254526 CCAAAAAATCACAGAGAAGGAGG - Intergenic
1197745126 X:129927666-129927688 CTAATAATACAAAAATAAGCTGG - Intronic
1197821476 X:130545087-130545109 CCAAAAATACAAAAATAAGCCGG - Intergenic
1197842689 X:130766326-130766348 TCAAGAATACATAAAGAAGTTGG - Intronic
1198840241 X:140848698-140848720 CAGATAAAAAACAAAGAAGGAGG + Intergenic
1199257649 X:145734731-145734753 GCAGTATTACACAAATAAGGTGG - Intergenic
1199721570 X:150546363-150546385 CCAAAAATACAAAAAGTAGCAGG - Intergenic
1200301958 X:154985272-154985294 CTAAAAATACACAAATTAGGCGG + Intronic
1200465893 Y:3518884-3518906 CTAACATAACACAAAGAAGGTGG - Intergenic
1200569055 Y:4804849-4804871 CAAAGAATTCACAAAGAAAGAGG - Intergenic