ID: 929179522

View in Genome Browser
Species Human (GRCh38)
Location 2:39020599-39020621
Sequence CAGTAGTTCTTAAAAACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929179519_929179522 26 Left 929179519 2:39020550-39020572 CCTTTTCTCTTTGGGGAGGCTGA 0: 1
1: 0
2: 4
3: 34
4: 283
Right 929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG 0: 1
1: 0
2: 2
3: 46
4: 371
929179518_929179522 27 Left 929179518 2:39020549-39020571 CCCTTTTCTCTTTGGGGAGGCTG 0: 1
1: 1
2: 3
3: 28
4: 301
Right 929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG 0: 1
1: 0
2: 2
3: 46
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929179522 Original CRISPR CAGTAGTTCTTAAAAACAAA TGG Intronic
902744366 1:18463603-18463625 CAGGAGTCCTTAAAAGCAGAAGG - Intergenic
904762566 1:32816663-32816685 CTGTAGTTCTTGGTAACAAACGG + Intronic
907529573 1:55080870-55080892 AAGTACTTTGTAAAAACAAAGGG - Intronic
907854646 1:58290548-58290570 CAGTAGTTGTAAAAAAAAATTGG + Intronic
908085464 1:60627822-60627844 CAGTAGTTGCCAAAGACAAAGGG - Intergenic
908329263 1:63054552-63054574 CAGTAGTTCGGAAAAACCAAAGG - Intergenic
908575660 1:65456672-65456694 CAGTATAGATTAAAAACAAATGG - Intronic
909070960 1:70993183-70993205 CAGTAATACTGAAAAACAAATGG - Intronic
909274228 1:73664845-73664867 CAGTACTATTTAAAAACAAAGGG - Intergenic
909472362 1:76042855-76042877 CAAATGTTCTTAAAAATAAATGG - Intergenic
909504906 1:76377669-76377691 CAGTAGGTCATAAAAAAACAAGG - Intronic
909605631 1:77505564-77505586 AAGTATTTCTTTAAAACAAGAGG + Intronic
910781309 1:90937636-90937658 TAGAACTTCTTAAAAATAAAAGG - Exonic
911372537 1:97011174-97011196 GAGTAGTTGATGAAAACAAAGGG + Intergenic
911618676 1:100042061-100042083 CAGGAATGCTTAAAAACAAGTGG - Intronic
911882551 1:103259756-103259778 TATTAATTCTTAAAAAAAAATGG + Intergenic
912626824 1:111212463-111212485 CAGTGGTTAATAAACACAAAAGG - Intronic
913031776 1:114913472-114913494 CATAAGTTCTTAAAGAGAAAGGG - Intronic
915377203 1:155406993-155407015 CAGTATTACTTACAAAAAAAAGG + Intronic
916275024 1:162984638-162984660 CAGTAGATGTCAGAAACAAATGG + Intergenic
917639195 1:176966181-176966203 TTGTAGTCCTTGAAAACAAAAGG - Intronic
917766598 1:178226617-178226639 TAGTAATTCTTACAGACAAATGG - Intronic
919007806 1:191921947-191921969 GAGGAATTCTCAAAAACAAAAGG - Intergenic
919628585 1:199936890-199936912 AAATAGTTTTTAAAAACAAGTGG - Intergenic
921053851 1:211529509-211529531 TAGTAGTTCTTAAAATTAATTGG + Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921989587 1:221350166-221350188 CAGCTGTGCTTAACAACAAATGG - Intergenic
923026768 1:230210643-230210665 TAGTAATTCTTCTAAACAAAGGG - Intronic
923507604 1:234619187-234619209 CAGAACTTCCTAAAAACAGAAGG - Intergenic
924135419 1:240961009-240961031 CAAAAGCTCTGAAAAACAAATGG + Intronic
924879991 1:248150531-248150553 CAGTAGTTAAAAAAGACAAAAGG - Intergenic
1063268828 10:4484748-4484770 CAGAAGTTCTGAAAAAGAAATGG + Intergenic
1063941370 10:11133575-11133597 CATCAATACTTAAAAACAAAGGG + Intronic
1065813317 10:29462523-29462545 CAGTAGTTCATAACAACACATGG + Intronic
1065958318 10:30712414-30712436 GAGTAGTTCATAACAACACATGG - Intergenic
1067528500 10:47052940-47052962 CAGTATTTCTTTAAAATAAATGG - Intergenic
1067805449 10:49389269-49389291 TAGTATCTCTTAAAAACCAATGG - Intronic
1068016458 10:51522899-51522921 CTGTATTTATTAAAAACCAAGGG + Intronic
1068021746 10:51594029-51594051 CCCTAATTCTTAAAAAAAAATGG - Intronic
1069401822 10:68056047-68056069 TAGTACTTCTTTAAAAGAAAAGG - Intronic
1071116038 10:82221629-82221651 CAGTCTGTATTAAAAACAAAAGG + Intronic
1071690453 10:87813160-87813182 CAGGAGTTCTTAGAAGCCAAGGG + Intronic
1072362738 10:94675557-94675579 AAGTAGTTTTTAAGAACAAATGG + Intergenic
1072888629 10:99301803-99301825 CAGGAGGTCTTAGCAACAAAAGG + Intergenic
1073743366 10:106437176-106437198 CAGTGGTTCTTAAAAGCCTATGG - Intergenic
1073779426 10:106821119-106821141 CAGAAATTCTCAAATACAAAAGG - Intronic
1074418825 10:113291269-113291291 CAGAAATTCTTACAAAGAAATGG + Intergenic
1074662835 10:115681815-115681837 CAGTGGTTCTCAAAAAGAAGTGG - Intronic
1075623387 10:123944383-123944405 CTGTGGGTCTTTAAAACAAAGGG + Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077848620 11:6052476-6052498 CAGAACTGCATAAAAACAAAGGG - Intergenic
1077877829 11:6322461-6322483 CACAAGATCTTAAAAAAAAAAGG + Intergenic
1077905784 11:6532429-6532451 CTTTAATCCTTAAAAACAAAAGG + Intronic
1078048171 11:7937316-7937338 CAATTGTTCTTAAAAATAATTGG - Intergenic
1079100128 11:17536005-17536027 AAGGAGTTCTTGAAAGCAAAGGG - Intronic
1079912160 11:26324087-26324109 GAGTATTTCTCAAAAACAATTGG + Intronic
1079951498 11:26810507-26810529 AAGTAAATTTTAAAAACAAATGG - Intergenic
1080871879 11:36243555-36243577 CTGTAGGTCTTTTAAACAAAGGG + Intergenic
1082013233 11:47465136-47465158 CACTTGTTCTCAAAAACAAGTGG - Intergenic
1082090904 11:48089063-48089085 AAGTGGTTCTTAAAGACAACAGG - Intronic
1082118515 11:48353932-48353954 CAGTAGTTCTTAGCAACATCTGG + Intergenic
1083313422 11:61798529-61798551 CAGTAGCTCTTAATAATTAAGGG + Intronic
1086183364 11:83983604-83983626 TAATAGTTGTTAAAAATAAATGG + Intronic
1087441507 11:98189437-98189459 CAGAAGTTCTTGAAATCACAAGG + Intergenic
1087636576 11:100708584-100708606 CACTAGTTTTTAAATAGAAAAGG + Intronic
1090632529 11:128662693-128662715 AAGGAATTCTTAAAAATAAAAGG + Intergenic
1091145448 11:133275368-133275390 CATTAATTCTTAAAAACTAAGGG + Intronic
1093638681 12:21501157-21501179 CAGTAGTATTTACCAACAAATGG + Exonic
1093898938 12:24607414-24607436 CAGTAGTTGTTAATAACAGTTGG + Intergenic
1096850387 12:54431985-54432007 CAGCAGTTGGTAGAAACAAAGGG - Intergenic
1098026935 12:66213875-66213897 AAACAGTTCTCAAAAACAAATGG + Intronic
1098543374 12:71684536-71684558 CAGTAGTTCTTATATGCAATAGG - Intronic
1098605301 12:72382301-72382323 CAGGTGTGCTTAAAAGCAAATGG + Intronic
1099471425 12:83053941-83053963 CTGTGGTTCTCTAAAACAAAGGG - Intronic
1099584421 12:84498826-84498848 CAGTTATTCTTTGAAACAAATGG - Intergenic
1100546047 12:95603491-95603513 CAGTAGATCTTAAAATCAACAGG - Intergenic
1101654088 12:106704760-106704782 CAGTGGTTGTTAATAACAATTGG + Intronic
1103174653 12:118852199-118852221 CCCTAGTGCTTGAAAACAAAGGG - Intergenic
1104378833 12:128289336-128289358 CCCTTGTTCTTAAAAACTAACGG - Intronic
1105988634 13:25595272-25595294 CATTAATTCTTTAACACAAAAGG + Intronic
1106016764 13:25876661-25876683 AAGTAATTCTTAGAAATAAAAGG + Intronic
1106491511 13:30228324-30228346 CAGTATTTTTTAAAAAAACAAGG + Intronic
1109192015 13:59336678-59336700 TAGAAGTTGTTAAAAACAATAGG + Intergenic
1109224178 13:59672458-59672480 AAGTAATAGTTAAAAACAAAAGG - Intronic
1109752974 13:66720543-66720565 CAGTAGTTTTTTATAAAAAATGG + Intronic
1109994109 13:70100802-70100824 TGGTAGTTGTAAAAAACAAATGG - Intronic
1110120516 13:71874700-71874722 CAGTAATGCTAGAAAACAAAAGG + Intergenic
1110298943 13:73902928-73902950 CAGCAGTTCTCCAAAAGAAATGG - Intronic
1111545296 13:89725679-89725701 CAATAGTTATTAAAAACAACTGG - Intergenic
1111683056 13:91467635-91467657 CAGATGTTACTAAAAACAAAAGG - Intronic
1111762335 13:92481704-92481726 CAGTAGATCTTAGAAAAGAAAGG - Intronic
1112596777 13:100814813-100814835 CAGGAGTTCTTAAAAGTAGAAGG - Intergenic
1112910919 13:104483256-104483278 AACTAGTTCTGAAAAAAAAATGG + Intergenic
1112985518 13:105444836-105444858 CAGTCATTATTAAAAAGAAATGG + Intergenic
1113360168 13:109623219-109623241 CAGTATCTCTTGGAAACAAATGG + Intergenic
1113364441 13:109663001-109663023 CAGACATCCTTAAAAACAAAAGG - Intergenic
1114471434 14:22965626-22965648 AAGTAATTATTAGAAACAAAAGG - Intronic
1115158807 14:30369666-30369688 GAGAAGTTCTAAAAAAAAAAAGG - Intergenic
1115282682 14:31682252-31682274 GAGTATTTCATAACAACAAAAGG - Intronic
1115417925 14:33158528-33158550 CAGAAGTATTAAAAAACAAAAGG + Intronic
1116039674 14:39670328-39670350 GAGTTGTTCTGAAAAAGAAAAGG - Intergenic
1116163276 14:41298319-41298341 ATTTAGTTCATAAAAACAAATGG + Intergenic
1116968560 14:51040668-51040690 CACAAGTTCTTAAAAACTTAGGG - Intronic
1117325690 14:54667055-54667077 CAGTAGCTATTAAAAATAAATGG + Intronic
1117340958 14:54790754-54790776 CATTAGCTTTTAAAAAAAAAAGG - Exonic
1117636762 14:57752825-57752847 CAGTGTTTCTTAAACACAATAGG - Intronic
1118561030 14:67082997-67083019 CAATTATTCTTAAAAACCAAGGG - Intronic
1118849106 14:69571312-69571334 AAGTAAGTTTTAAAAACAAAGGG + Exonic
1119744989 14:77037877-77037899 CAGAAGATGTTTAAAACAAAAGG - Intergenic
1120158561 14:81120944-81120966 CAGAAGTTGTTAAAGATAAAGGG + Intronic
1120553355 14:85899279-85899301 CAGTAGTTCTCAAAAAGCTAGGG + Intergenic
1120784300 14:88517054-88517076 GACTATTTCCTAAAAACAAACGG + Intronic
1120880983 14:89415368-89415390 CAGTGTTTGTTTAAAACAAAAGG - Intronic
1121358358 14:93233171-93233193 GAGGAGTCCTTAAGAACAAATGG + Intergenic
1121589403 14:95090855-95090877 CATTATTTCATAAAAACAGAAGG + Intronic
1121902708 14:97708565-97708587 AAGTAGATATGAAAAACAAAAGG + Intergenic
1123909363 15:24951433-24951455 AAATAGTTCTTAAATACCAATGG - Intronic
1125245136 15:37627790-37627812 TTGTAGTTCTTACAAAGAAAAGG - Intergenic
1126275968 15:46881493-46881515 CAGTAGTCTTGAAAAACAATGGG + Intergenic
1126547492 15:49889102-49889124 CAGTATTTTTAAAAAAAAAAAGG + Intronic
1126744900 15:51816397-51816419 CAGTGTTTCTTTAAAACAAATGG + Intergenic
1127671845 15:61202339-61202361 CAGCATTTCTTAAAAACATAAGG + Intronic
1127943246 15:63722609-63722631 CAGTAGATCATAAAACCAAGAGG - Intronic
1128117074 15:65115348-65115370 GATTAGTTCTTAAATACTAAGGG - Intergenic
1128167203 15:65476053-65476075 CAGAAGCTCATAAAAACAAATGG - Intronic
1128289226 15:66464104-66464126 CAAAAGTTTTTAAAAAGAAAAGG - Intronic
1130415640 15:83692241-83692263 AAAGACTTCTTAAAAACAAAAGG - Intronic
1130581274 15:85139125-85139147 CATGATTTCTTAAAAAGAAATGG - Exonic
1131078789 15:89516443-89516465 AAATATTTTTTAAAAACAAAAGG + Intergenic
1131958023 15:97758775-97758797 CAATAGTGCTTGAAATCAAAAGG + Intergenic
1137900745 16:52266013-52266035 CAGTAGTGCTTATAAAATAATGG + Intergenic
1139120525 16:64010624-64010646 CAGCAGATCTAAAATACAAAGGG - Intergenic
1139266979 16:65649135-65649157 AAGCAGTTCTTCAAAACAAAAGG + Intergenic
1140585239 16:76282872-76282894 CAGTTTTTTTTCAAAACAAATGG + Intronic
1142668455 17:1475700-1475722 AAATAGTTCTTAAAAGCAAATGG - Intronic
1143529490 17:7493964-7493986 CAAGACTTCTTAAAAAAAAAAGG + Intronic
1144483710 17:15647921-15647943 CAGCTGCTCTTAAAACCAAAGGG + Intronic
1144914976 17:18717087-18717109 CAGCTGCTCTTAAAACCAAAGGG - Intronic
1146781383 17:35676456-35676478 GAGTATTACTTAACAACAAAAGG - Intronic
1148257931 17:46153028-46153050 CAGTATTTTTTAAAATCTAAAGG + Intronic
1149032191 17:52096547-52096569 TAGTAATTCTTAAAAACTGAAGG - Intronic
1149124009 17:53205963-53205985 GAGTAGTGCTAAAAAATAAAAGG + Intergenic
1149240996 17:54648949-54648971 AAGTATTCCTTAAAAGCAAAGGG + Intergenic
1149501839 17:57158681-57158703 CAGGAGCTCTTAAAAGCAGAAGG - Intergenic
1155461012 18:26083356-26083378 GTGGAGTTCTTAAAAACCAAAGG + Intronic
1155775619 18:29756767-29756789 CAATAATTCTTGAAAATAAACGG - Intergenic
1156290360 18:35743970-35743992 AAGAAGTTCTTGAAACCAAAAGG - Intergenic
1157136908 18:45064864-45064886 AATTATTTCTTAAAAGCAAATGG + Exonic
1157215524 18:45780159-45780181 CAGAAGTTTTTAAGAACAGAGGG + Intergenic
1157971787 18:52278508-52278530 CATTATTTTATAAAAACAAATGG - Intergenic
1158732837 18:60044736-60044758 CAGCAGTTCTTAAAAATGTAGGG - Intergenic
1158782834 18:60671562-60671584 AAGTATTTGTTAAAAACAACTGG + Intergenic
1159290180 18:66407465-66407487 CCCTATTTCTTAAAAAAAAAAGG - Intergenic
1159773136 18:72572215-72572237 CCTTAGTTCTTATAAATAAATGG - Intronic
1162855958 19:13468878-13468900 AATTAGTTCCTAAGAACAAAAGG + Intronic
1162984803 19:14262863-14262885 CATAAGATCTTAAAAACCAATGG - Intergenic
1165997077 19:39851496-39851518 AAATAATTCTTAAAAAAAAATGG - Intergenic
1166458367 19:42964075-42964097 CATGGGTTCTTAAAAACAAGAGG - Intronic
1167875719 19:52410615-52410637 CAGTAATACATAAACACAAAGGG - Intronic
926453208 2:13032848-13032870 CAGTAATACTGAAAAACAAAAGG + Intergenic
927817898 2:26236294-26236316 CACTGGTTCTTATAAACAAGGGG + Intronic
928598761 2:32883343-32883365 CACATGTTCTTAAGAACAAAGGG + Intergenic
928804805 2:35138110-35138132 CAGCAGATCTTAATGACAAAAGG - Intergenic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
930259773 2:49131925-49131947 CAGAAGTTCTTTAAAAGAAGAGG - Intronic
930545607 2:52763147-52763169 CAGTGGTCCTTATAAACAAGTGG + Intergenic
931221810 2:60295319-60295341 CAGAAATTGTTGAAAACAAAAGG + Intergenic
931364268 2:61605327-61605349 CAGTACTTCTTAACTAAAAAGGG - Intergenic
932097210 2:68861788-68861810 TAACAGTTCTTAAAAAAAAAAGG + Intergenic
932518550 2:72381109-72381131 TAGTACTTTTTAAAAACAAATGG - Intronic
932778722 2:74546294-74546316 AAGTAGTACTGAAAAAAAAATGG + Intronic
933431158 2:82181448-82181470 CAATAGTTCAAAAAAAAAAAAGG + Intergenic
933460803 2:82582397-82582419 CAGTAGGTCTTAATAATAAGTGG - Intergenic
933612821 2:84455212-84455234 TAGTACTTCTTAAAAATCAATGG - Intronic
934517189 2:94995961-94995983 AAGCAGTTTTTAAAGACAAAAGG + Intergenic
934586995 2:95509297-95509319 TAGTAGTTCATACAAACGAAAGG - Intergenic
936232510 2:110715639-110715661 CACTAATTCTGAAAACCAAAGGG - Intergenic
936557064 2:113505083-113505105 CAGTAGTTCCTAAAATTAAGGGG + Intergenic
937642820 2:124233079-124233101 AATTAATTATTAAAAACAAAAGG + Intronic
938165464 2:129021826-129021848 AATTAGTTCCTAAATACAAAGGG - Intergenic
938801483 2:134767333-134767355 CAGTTTTTCTTAAATACAAATGG - Intergenic
938809446 2:134839394-134839416 CAAAAGTTCTTAATGACAAAAGG - Intronic
939084419 2:137700903-137700925 CAGTGGTTCTGAAAAACTGATGG - Intergenic
939706074 2:145455430-145455452 AAGTGGTTATTAAAAAAAAATGG - Intergenic
940200591 2:151145909-151145931 CTGTAGTAGTTAAAAAAAAAAGG - Intergenic
940554200 2:155202384-155202406 CCCTAGTTATTAAAAAAAAAAGG - Intergenic
943595209 2:189847353-189847375 CAGGAGGTCTTAATAACAATAGG - Intronic
943812111 2:192199973-192199995 CAGTAGTTAAAAAAAAAAAAAGG + Intergenic
944036500 2:195300946-195300968 CAGAACTTGTTAAAAATAAAAGG + Intergenic
945206332 2:207336156-207336178 CAGTAGGTTATAAACACAAAAGG + Intergenic
945966445 2:216192375-216192397 CATTAAATGTTAAAAACAAAGGG + Intronic
946364505 2:219240440-219240462 TAGTGTTTCTTAAAAACAAATGG + Intronic
947317977 2:228883489-228883511 CAGTAATTATTAAAATCAATTGG + Intronic
1170013302 20:11751633-11751655 CAGTAGATGTTAAAAATGAATGG - Intergenic
1170220851 20:13940100-13940122 CTGTATTTCTTACAGACAAATGG - Intronic
1170371209 20:15650225-15650247 CAGGTTTTCTTAAAAATAAATGG + Intronic
1170874326 20:20236050-20236072 CACAAGTTCTTAAAATAAAAAGG - Intronic
1173997540 20:47350637-47350659 AAATAATTCTTAAAAAGAAAAGG + Intronic
1174855613 20:54042516-54042538 CACCATTTTTTAAAAACAAATGG - Intronic
1176015460 20:62928958-62928980 CAGCAATTCTTAAAAAAAAATGG + Intronic
1176741161 21:10603804-10603826 CAGTGGGTCTCAAGAACAAATGG - Intronic
1177233732 21:18358524-18358546 CATTTGCTCTTAAAAAAAAATGG - Intronic
1177516383 21:22156750-22156772 GCGTAGGTTTTAAAAACAAATGG - Intergenic
1177720090 21:24894545-24894567 CAGTAGTAATTAAAAAAAAGAGG - Intergenic
1179263043 21:39775485-39775507 TAGAATTTCTTAAAACCAAATGG - Intronic
1179772130 21:43629143-43629165 ATGTAGTTCTTAAAAAAAATAGG - Intronic
1181383329 22:22524651-22524673 CAGCAGTTCCTCAAAGCAAATGG + Intergenic
1181893664 22:26087208-26087230 CAGTAGGTCTTCAAAAGAACGGG - Intergenic
1182468927 22:30535193-30535215 CAGTGGATGTTATAAACAAATGG + Intronic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
949356039 3:3181585-3181607 CACTGGTTATTAAAACCAAAAGG + Intergenic
949765007 3:7516519-7516541 CATTAATTCTTAAAGAGAAATGG + Intronic
949825292 3:8158486-8158508 CAGTAGCTCTTGAATACAAAGGG + Intergenic
951262443 3:20526336-20526358 AAATAGTTCTTAAAACAAAAGGG - Intergenic
951604873 3:24422091-24422113 ATGTAGTTTTCAAAAACAAAGGG + Intronic
952005135 3:28835018-28835040 CAGCAGTTTTTAAAACAAAATGG - Intergenic
952653946 3:35761052-35761074 CAGTGGTTCTTAAATATTAATGG - Intronic
952786433 3:37160123-37160145 CAGAAGTTCTAGAAGACAAAGGG + Intronic
953184765 3:40627809-40627831 CAGTTGTCCTTGAAAACCAATGG + Intergenic
953632016 3:44626032-44626054 CAGAAGTTAAAAAAAACAAAAGG - Intronic
954276605 3:49546144-49546166 CAGTAGTACTTCAAAACCATAGG + Intergenic
955536841 3:59932667-59932689 CAGTAGGATTTAAAAAAAAAGGG - Intronic
955758810 3:62255849-62255871 CACCAGTTCTTAAAATCAGAAGG - Intronic
956539970 3:70325732-70325754 CAGATGTTTATAAAAACAAAGGG + Intergenic
957273584 3:78062368-78062390 CAGTAAGTCTTAGAAACAAACGG - Intergenic
957440080 3:80234269-80234291 TAAAAGTTCTTAAAAATAAAGGG + Intergenic
958537397 3:95422285-95422307 CAGTATTTAGTAAAAATAAAGGG - Intergenic
959302542 3:104621415-104621437 CAATACTACTTAAAAACCAATGG + Intergenic
959540721 3:107534788-107534810 CATTATTTCATAAAAACAACAGG - Intronic
959665159 3:108912164-108912186 AAGTGGCTCTTAATAACAAACGG - Intronic
959740546 3:109714232-109714254 CAGTAGTTCTGAAACAAAAAAGG + Intergenic
960373921 3:116875229-116875251 GAGTAGTTCATGAAAATAAAAGG - Intronic
961726882 3:128936755-128936777 CAGTATGTCTGAAAAACAGAAGG - Intronic
962323429 3:134410422-134410444 CAGTATGTCTGAAAAACAAACGG - Intergenic
962880722 3:139573962-139573984 CAATATTTCTCAAAAAAAAAAGG + Intronic
962918007 3:139924427-139924449 AAGAATTTCTTAAACACAAAAGG - Intergenic
963828266 3:149979339-149979361 CAGTAGTTCATAAAGAAAAGAGG - Intronic
964818828 3:160747531-160747553 TAGTTGTTCTTAAAAGAAAAAGG + Intergenic
964975173 3:162609809-162609831 TACTACTACTTAAAAACAAATGG - Intergenic
965033754 3:163407529-163407551 CCATAGATCTTAAAAAAAAATGG + Intergenic
965304815 3:167051219-167051241 CACTAGTAGTTACAAACAAATGG - Intergenic
965525654 3:169714956-169714978 AAATATTTGTTAAAAACAAACGG - Intergenic
965779370 3:172268016-172268038 CAATAATTATTAAAAACACAAGG - Intronic
966572457 3:181460785-181460807 CAGCAATTCTGATAAACAAAAGG - Intergenic
967588682 3:191246301-191246323 TACTAGTTCTTGAAAGCAAATGG - Intronic
968724559 4:2238546-2238568 TAGTATTTCGCAAAAACAAAAGG + Intronic
969537958 4:7768249-7768271 CAGTAGTTGATCAAAGCAAACGG - Intronic
969799329 4:9550349-9550371 AAATAGTTCAGAAAAACAAATGG - Intergenic
970213897 4:13738700-13738722 CAGTTGTTCTTTAAAAGAAATGG + Intergenic
970389321 4:15591526-15591548 CAGTAATGCTTAAAAAAAATAGG - Intronic
973200260 4:47493108-47493130 CAGAAGTTTTTAAAAAGCAAAGG - Intronic
973952543 4:56031206-56031228 CAGTACTTCTTAAATATAACTGG + Intronic
974326548 4:60422187-60422209 CAGTGGTCCTTAAAAGCAAGAGG + Intergenic
974902009 4:68012068-68012090 CAATAGTTACTCAAAACAAATGG + Intergenic
975407254 4:74003903-74003925 AAGTAGATCTTAAAGAGAAAAGG + Intergenic
975913177 4:79293261-79293283 CCTTAGTGTTTAAAAACAAAGGG + Intronic
976663503 4:87565226-87565248 CTGTAGTTCTAAAAAGCAAAGGG + Intergenic
977761963 4:100748670-100748692 CATTCTTTCTTAAAAAAAAAAGG + Intronic
977917521 4:102610804-102610826 CAGACTTTCTTAAAAATAAAAGG - Intronic
978727417 4:111985543-111985565 CAGGAGTCCTTGATAACAAATGG - Intergenic
978902573 4:113970503-113970525 CAGGATGTCTGAAAAACAAATGG + Intronic
980261320 4:130452272-130452294 AAGTAGTCTTTAGAAACAAAGGG + Intergenic
981586990 4:146314296-146314318 CAGTAGTTCTTAAATTCAATAGG - Intronic
982374642 4:154676534-154676556 AAGTGGTTCTTAAACATAAATGG + Intronic
982585091 4:157225760-157225782 CAGTAGTTCTTAAACACAAGCGG + Intronic
983050080 4:163035905-163035927 TATTTGTCCTTAAAAACAAATGG + Intergenic
983953084 4:173665013-173665035 CAGTAGATATTAAAAGTAAAGGG - Intergenic
984023101 4:174510210-174510232 CAGTAGCTCTTGAACAAAAAAGG + Intronic
984134507 4:175918893-175918915 CAGTAGCTCATAAAAAGTAAAGG - Intronic
984498406 4:180528427-180528449 CAGTAGTTATTAAAAACCATGGG + Intergenic
984611814 4:181848993-181849015 CTGTAGCTCACAAAAACAAATGG - Intergenic
984632537 4:182075918-182075940 CACTACCTCTTAAAAAGAAAAGG - Intergenic
985054374 4:186023617-186023639 CTCTAGTTCTTAAAATCACAAGG + Intergenic
985282127 4:188298155-188298177 CAATGGTTCTTAAGAAGAAATGG - Intergenic
987010165 5:13754841-13754863 GCTTAGTTCTTAAAAACAAATGG + Intronic
987392934 5:17393379-17393401 CAGTAGGTTTTAAAAAATAAGGG - Intergenic
987478645 5:18424884-18424906 CAGTAGTTATTGAAAAGAAATGG - Intergenic
988120471 5:26954728-26954750 GGGGAGTTCTTAAAACCAAATGG - Intronic
988517269 5:31915899-31915921 AATAAATTCTTAAAAACAAAAGG - Intronic
988856017 5:35229020-35229042 CAGTGGTTCTTAAAAATTAGGGG - Intronic
989076649 5:37570759-37570781 AAGTTGTGCTTAGAAACAAAGGG - Intronic
989095111 5:37774712-37774734 GAGTAGCTCTTAAAAAGATATGG - Intergenic
990286223 5:54303217-54303239 CAGTACCTCTTCAAAAGAAATGG + Intronic
990796545 5:59548662-59548684 TAGTTGTTTTTAAAAACAGATGG + Intronic
990813202 5:59752271-59752293 CAGTAGTACTTTCAAATAAAAGG - Intronic
991343278 5:65635674-65635696 CAATAATTCTTAAAAAAAAAAGG - Intronic
991989501 5:72323532-72323554 CAAGAGTTATTAAAAAAAAAAGG - Intronic
992851891 5:80818529-80818551 CACTAGTGCTTTAAAAAAAAAGG - Intronic
993141866 5:84044385-84044407 CAGTAATTCCAAAAAAAAAATGG - Intronic
993289336 5:86044254-86044276 CAGAAGTTCATAAAGACAATAGG - Intergenic
993363388 5:87004899-87004921 CAGTTTTTCTAAAAAAGAAAAGG + Intergenic
993716917 5:91284129-91284151 CAGTTTTTCTTGAAAACAAGAGG - Intergenic
993739910 5:91525795-91525817 CAGTAATTTTTAAACCCAAAAGG - Intergenic
993871479 5:93259815-93259837 CAGTCTTTATTACAAACAAAAGG - Intergenic
994976740 5:106817738-106817760 CAGCAGTTTTTTTAAACAAAAGG + Intergenic
995383123 5:111557700-111557722 CAATATTTCTTATGAACAAAAGG - Intergenic
995470322 5:112494912-112494934 GAAAAGTTCTTAAAAACAATTGG - Intergenic
995927343 5:117390097-117390119 GAGTAATTCATAAAAAAAAAAGG - Intergenic
996481496 5:123980653-123980675 CTGTAGATCTGAAAAACTAAAGG - Intergenic
996847679 5:127918324-127918346 CAGTTGTTCTCAAATAGAAAAGG - Intergenic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
1001050171 5:168407867-168407889 CCCTGGTTCTTAAAAAAAAAAGG - Intronic
1001211050 5:169810674-169810696 CAGTCTTTCTTAAAAACAGAAGG - Intronic
1001754878 5:174160536-174160558 AAGTTGTTCATAAAAACAGAAGG - Intronic
1003125825 6:3355218-3355240 CAGTAGCTCTTCAAATAAAATGG + Intronic
1004309357 6:14530850-14530872 AAGGTGTTCTCAAAAACAAAGGG + Intergenic
1004535361 6:16495496-16495518 TAGTAGTTCATAAAAAGAAAAGG - Intronic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1009530378 6:64804568-64804590 CTGTATTTCTTGAAACCAAAAGG - Intronic
1010478315 6:76317526-76317548 CAGTTGTTTTTGCAAACAAATGG + Intergenic
1010624387 6:78119032-78119054 CAGTAATTCTTTAATAGAAAAGG - Intergenic
1010661846 6:78580699-78580721 CAGCTGTTCTAAAAAACATAAGG + Intergenic
1010711833 6:79184134-79184156 CAATAGTTCTAAAAAATAATAGG + Intergenic
1011377873 6:86709650-86709672 AAATAGTCTTTAAAAACAAATGG + Intergenic
1011578861 6:88834724-88834746 TAGTAGTTCATAAAACCATAAGG - Intronic
1011968174 6:93186519-93186541 CAGGAATTTTTGAAAACAAAAGG + Intergenic
1012469572 6:99555954-99555976 CAGCAGTTCTTATAAAAAGAAGG - Intronic
1012667104 6:101985473-101985495 CACAAGTTCTTCAAATCAAAAGG - Intronic
1013434253 6:110085909-110085931 CAATAGTTCATAAAGAAAAATGG + Intergenic
1013725342 6:113088696-113088718 CAGAAGTTCTTAAAACAGAAAGG + Intergenic
1013856306 6:114577371-114577393 CAGTTGGCCTTAGAAACAAAAGG + Intergenic
1013870789 6:114757008-114757030 CATTAGTTCTTAAAAGAAACGGG - Intergenic
1014105951 6:117561294-117561316 CGGTAGTTCTTGAAAATCAAAGG + Exonic
1014854751 6:126385848-126385870 CAGTAATTTATAAAGACAAAAGG - Intergenic
1016725874 6:147366521-147366543 CAGCAGCTCCTAGAAACAAAGGG - Intronic
1016785610 6:148007542-148007564 CATTAGTTTTTAGAAACCAAAGG - Intergenic
1017953103 6:159154120-159154142 CAGTAGATATTAAAAAGAAAAGG - Intergenic
1021014388 7:15514775-15514797 CAGTAATTCTAAAAGACAAGAGG - Intronic
1021049803 7:15968877-15968899 CAGTAGTTCATAAAACAGAATGG + Intergenic
1021677876 7:23098988-23099010 AAGTAGTTATTTAAGACAAATGG - Intergenic
1021703270 7:23341364-23341386 CAGTAATTATTAAATACTAAAGG - Intronic
1023187095 7:37543429-37543451 CAATAATTGTTAAAAATAAATGG - Intergenic
1023202394 7:37712582-37712604 CAGGTGTGCTTAAAAACAAAAGG - Intronic
1023561739 7:41481119-41481141 AAATACTTCTTAAATACAAATGG + Intergenic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024473743 7:49789646-49789668 CTGTAATTCTTTAAAACAAAAGG + Intronic
1024481814 7:49871109-49871131 TAGTATTTCATAAATACAAAAGG + Intronic
1024687641 7:51764282-51764304 TAGTAGTTCTAATAATCAAAGGG + Intergenic
1024946515 7:54813237-54813259 CTGTAGTTGATGAAAACAAATGG - Intergenic
1026420634 7:70233451-70233473 CAGTAGTTGTGAAAGACACAAGG + Intronic
1026506076 7:70985217-70985239 CATTAGTTCTGTAAAACAATTGG - Intergenic
1026560957 7:71448659-71448681 CATTTTTTCTTGAAAACAAAAGG + Intronic
1027497672 7:78908375-78908397 CAGTAATTCTTAAATACAGCTGG + Intronic
1027943582 7:84716926-84716948 CAGTACTTCTCACAAATAAAAGG - Intergenic
1028757094 7:94450079-94450101 CAGTGGTAATTAAAACCAAATGG + Intergenic
1029862395 7:103586878-103586900 CTGTAGATCACAAAAACAAATGG + Intronic
1031033701 7:116764419-116764441 CAGTAATTGTTGAAAGCAAAAGG - Intronic
1031263648 7:119555619-119555641 CACTAATTTTAAAAAACAAATGG + Intergenic
1031383111 7:121112641-121112663 CAGAAGTCCTAAAAAGCAAAAGG + Intronic
1031426427 7:121610892-121610914 GAGTAGTTCTTGAAAACATTAGG + Intergenic
1032723682 7:134571396-134571418 CAGTAGTTTCTAAAAATATAGGG + Intronic
1036159329 8:6371812-6371834 TTGTAATTCCTAAAAACAAATGG - Intergenic
1036579385 8:10059057-10059079 CAGAAGTTCTTAAATACATAAGG + Intronic
1037074569 8:14698083-14698105 GAGTAGTTATTAAATACGAAGGG - Intronic
1037459162 8:19092069-19092091 CATGAGTTCTTAAAAACATTAGG - Intergenic
1038278289 8:26140070-26140092 CAGTAATACTTAAAATGAAATGG - Intergenic
1039673427 8:39631245-39631267 AAATATTTCTTAAAAACAAAAGG - Intronic
1040020023 8:42732736-42732758 AAGTAGTTCACAAAAACATAAGG + Intronic
1041492364 8:58448481-58448503 CAGCAGTTCTTAAGAAGATATGG + Exonic
1041553687 8:59128924-59128946 GAGTAAGTCTTAAAATCAAATGG - Intergenic
1041586160 8:59522354-59522376 CATTTGTTCTTGAAAAGAAAGGG - Intergenic
1042190779 8:66184972-66184994 CAGGAGTTATTAAAAAGGAATGG - Intergenic
1042810372 8:72819149-72819171 CAGTACTTGTTCAAAAGAAAGGG - Intronic
1042907617 8:73788376-73788398 CTGTAGTTCTGAATAATAAAAGG + Intronic
1043019853 8:74986402-74986424 CAAGAGCTCTTAGAAACAAAAGG - Intronic
1043079650 8:75750111-75750133 CAGTAATTCTTAAAAAAAAAAGG - Intergenic
1045144276 8:99322391-99322413 CTTGAGTTCTTGAAAACAAACGG - Intronic
1046005409 8:108475896-108475918 CATTAGTTCCTCTAAACAAAAGG - Exonic
1047846479 8:128811414-128811436 AAGTAATTATTAAATACAAAGGG + Intergenic
1049895931 9:112218-112240 CAGTAGTTCCTAAAATTAAGGGG - Intergenic
1050205642 9:3193806-3193828 GAGTAGTTGTGAAAATCAAATGG - Intergenic
1050222752 9:3412723-3412745 CAGTTATTCTTAGAAAGAAAGGG + Intronic
1050290076 9:4144991-4145013 CTGCAGTTGTTAAAAACAAAAGG - Intronic
1050956865 9:11673795-11673817 AAGTAGAACTTAAAAACAGAAGG - Intergenic
1052235115 9:26203709-26203731 AAGTAGTTTTTAAAAATAGAAGG + Intergenic
1052238339 9:26240716-26240738 CAGTAGTTTTGAAAGACAAATGG + Intergenic
1052937061 9:34101725-34101747 CAGTAATTCTTAATAAAGAACGG - Intronic
1053739113 9:41122401-41122423 CAGTAGTTCCTAAAATTAAGGGG - Intergenic
1053844698 9:42223878-42223900 TATTAGTTCTTAAAAACTTAAGG - Intergenic
1054337616 9:63820845-63820867 CTGCAGTTCTTAAAACAAAACGG + Intergenic
1054689237 9:68308921-68308943 CAGTAGTTCCTAAAATTAAGGGG + Intergenic
1055037979 9:71838485-71838507 AAGTGGTTGTTAAAAAAAAAGGG + Intergenic
1055043209 9:71898001-71898023 CAGTAGTGCTTAAGAAGAAATGG + Intronic
1055481069 9:76709727-76709749 CAGTAGTTCTGAAGAAGAAAAGG + Exonic
1055715965 9:79118264-79118286 CAGTAGATGTTTAAAAGAAATGG + Intergenic
1057554300 9:96075352-96075374 GAGTGCTTTTTAAAAACAAATGG - Intergenic
1058152157 9:101475572-101475594 AAGCAGAGCTTAAAAACAAATGG + Exonic
1058907390 9:109492774-109492796 CAGTAGTTATTAAATAAAACTGG - Intronic
1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG + Intergenic
1059670624 9:116488204-116488226 CACTACTTCTTAAAATCCAATGG - Intronic
1059714130 9:116897363-116897385 CAGTAATTCTGAAAACCAGATGG + Intronic
1059835938 9:118152626-118152648 TAGTAGGTCTTAACATCAAAAGG + Intergenic
1060721344 9:125981489-125981511 ATGTATTTCTTAAAAAAAAAAGG - Intergenic
1062298002 9:135844383-135844405 AAGAAGTTCTTTGAAACAAATGG + Intronic
1186406143 X:9305061-9305083 AATTGTTTCTTAAAAACAAAGGG - Intergenic
1187998157 X:24951505-24951527 CACCAGTATTTAAAAACAAATGG - Intronic
1190318469 X:49165738-49165760 GTCTAGTTCTGAAAAACAAAGGG + Intronic
1190447071 X:50536800-50536822 CAGCAGTACTTGAAACCAAAAGG + Intergenic
1190922489 X:54868945-54868967 AAGTTGTTCTTCAAAACATAAGG - Intergenic
1191644931 X:63470169-63470191 AAATAGTTCTTAAAACCCAAAGG + Intergenic
1193932143 X:87566338-87566360 CAATTGTTCCTAAAAACAAATGG + Intronic
1194062655 X:89223522-89223544 CTGTAGTACATAAAACCAAAAGG - Intergenic
1194141021 X:90209801-90209823 CAGTCTGTCTTAAAGACAAAAGG - Intergenic
1194375557 X:93128416-93128438 GAGTAATTTATAAAAACAAAAGG - Intergenic
1194693539 X:97016273-97016295 GAGTTGTTCTCTAAAACAAATGG - Intronic
1194791659 X:98158789-98158811 CATGTGTTCTTAAAAATAAAAGG - Intergenic
1195145589 X:102012829-102012851 AAGCAGTTCTCAAAAAGAAATGG + Intergenic
1195446197 X:104955727-104955749 CAGAAGCTTTTAAAACCAAATGG - Intronic
1195581536 X:106509555-106509577 GAGTATTTATTAAAAAGAAATGG + Intergenic
1195721871 X:107875871-107875893 AGGTAGTTCTGAAAATCAAAGGG - Intronic
1197159039 X:123303041-123303063 CAGTAGTCCTTAAAAGTAATAGG - Intronic
1197803626 X:130377975-130377997 CAGAAGTAGTTAAAAAAAAAAGG - Intergenic
1198513541 X:137379380-137379402 CAACAGTTCTTGAAAACAATTGG + Intergenic
1199114733 X:143977932-143977954 CATTAGTAATTAAAAACATATGG + Intergenic
1199287295 X:146067849-146067871 CAGTAGTCTTTAAGAACAAATGG + Intergenic
1199999090 X:153047825-153047847 CAGTGGTTCTTAGCAACTAAGGG - Intergenic
1200486786 Y:3778919-3778941 CAGTCTGTCTTAAAGACAAAAGG - Intergenic
1200716524 Y:6552503-6552525 CTGTAGTACATAAAACCAAAAGG - Intergenic
1200887764 Y:8286766-8286788 TAGCAGTTCTAAAAAAAAAAAGG - Intergenic