ID: 929188137

View in Genome Browser
Species Human (GRCh38)
Location 2:39116572-39116594
Sequence CCAGCCAATAAGTTTTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 220}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929188137_929188146 22 Left 929188137 2:39116572-39116594 CCTACTTAAAACTTATTGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 220
Right 929188146 2:39116617-39116639 CCTAGCACTTTGGGAAGCTGAGG 0: 372
1: 12313
2: 110809
3: 227930
4: 245179
929188137_929188147 26 Left 929188137 2:39116572-39116594 CCTACTTAAAACTTATTGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 220
Right 929188147 2:39116621-39116643 GCACTTTGGGAAGCTGAGGCAGG 0: 2808
1: 67620
2: 185230
3: 236623
4: 274998
929188137_929188143 13 Left 929188137 2:39116572-39116594 CCTACTTAAAACTTATTGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 220
Right 929188143 2:39116608-39116630 CCCTGTAATCCTAGCACTTTGGG 0: 320
1: 26620
2: 324181
3: 265271
4: 141348
929188137_929188141 12 Left 929188137 2:39116572-39116594 CCTACTTAAAACTTATTGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 220
Right 929188141 2:39116607-39116629 ACCCTGTAATCCTAGCACTTTGG 0: 25
1: 1284
2: 35979
3: 333317
4: 262219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929188137 Original CRISPR CCAGCCAATAAGTTTTAAGT AGG (reversed) Intronic
903803392 1:25986825-25986847 TCGGCCAAAAATTTTTAAGTGGG + Intronic
905487688 1:38315551-38315573 CCAACCAACCAGCTTTAAGTTGG - Intergenic
905719969 1:40189913-40189935 ACAGCCAATCAGTTTTAGCTGGG + Intronic
905964354 1:42079063-42079085 CCAGTCTATATCTTTTAAGTTGG + Intergenic
906507157 1:46388796-46388818 CCAGCCACTAAGTTGTGACTGGG - Intergenic
907505507 1:54915247-54915269 CCAGCCACTAAGTTGTGACTGGG - Intergenic
908360468 1:63364019-63364041 CCAGCCAACAACTTTTAAGATGG + Intergenic
909840220 1:80311636-80311658 GCAGCCAGTGAGTTTTGAGTGGG + Intergenic
910844743 1:91594256-91594278 AGAGCCAAAAAATTTTAAGTCGG + Intergenic
910975243 1:92899503-92899525 CCAGTCTATACTTTTTAAGTGGG + Intronic
913468927 1:119171313-119171335 CCAGCCACTAAGTTGTGACTGGG - Intergenic
915750803 1:158208336-158208358 CCAGTCTATATGTTTTAAATGGG + Intergenic
919381746 1:196869037-196869059 CCAGCCTATAGGATTTATGTGGG + Intronic
920389384 1:205589448-205589470 GAAGCCAATAGGTTTTAAGCAGG + Intronic
921083425 1:211763764-211763786 CCAACAAATAAATTTTAAATAGG - Intronic
922348932 1:224720221-224720243 CCACTTAATAAGTGTTAAGTAGG + Intronic
1063702488 10:8399278-8399300 CCAGCCAATTATTTTCAAGGTGG - Intergenic
1063906014 10:10780893-10780915 CATGCCAATGAGTATTAAGTTGG + Intergenic
1064435526 10:15307760-15307782 CCAACCAATAAGTCTTATTTAGG + Intronic
1064621698 10:17224146-17224168 CCTGCCAAGAAGTTTAAAGAAGG + Intergenic
1065199479 10:23299579-23299601 CCAGCCACTAAGTTGTGACTGGG - Intronic
1066165174 10:32779941-32779963 CCAGCCTAGAAGTTTTAACAGGG - Intronic
1067815051 10:49467862-49467884 CCAGCCAGTAATTTTTTATTGGG + Intronic
1068791727 10:61037165-61037187 CCAGCCACTAAGTTGTAACTGGG - Intergenic
1071326925 10:84527151-84527173 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1071773038 10:88751519-88751541 CCAGCCAAAAAATTTTAATGTGG + Intronic
1077359057 11:2132628-2132650 AAAGCCAATTAGTTTTAAGAGGG + Exonic
1079887243 11:26003672-26003694 CCAGACACTAAGTTGTGAGTGGG + Intergenic
1079954374 11:26844254-26844276 CCATCCAATAATTTGAAAGTTGG - Intergenic
1082857706 11:57823892-57823914 CCAGCTAATATGTATTAGGTTGG - Intergenic
1086441905 11:86836592-86836614 CCAGCCACTAAGTTGTGACTAGG - Intronic
1086530696 11:87781407-87781429 CCAGTCTATAACTTTTAATTGGG - Intergenic
1087765523 11:102148856-102148878 ACAGCCAATAAGTTATCAATCGG - Intronic
1088523792 11:110729346-110729368 CCTGCCAATATGTTTAATGTAGG + Intergenic
1090158468 11:124466191-124466213 CCAGCCTATAAGTCTGAAATTGG - Intergenic
1090225755 11:125071319-125071341 GCAGCCAACAGGTTTTAAGTTGG - Intronic
1091072400 11:132580091-132580113 CCAGCAAACAAGTTTTTATTTGG + Intronic
1092294150 12:7184880-7184902 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1093348652 12:18070326-18070348 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1093429995 12:19073705-19073727 TAAGCCACTAAGTTTTAAGGTGG - Intergenic
1095124154 12:38455903-38455925 CCAGCCTGTAAGTTTTAAGGAGG + Intergenic
1095284011 12:40387953-40387975 CCAGCCACTAAGTTGTGACTAGG + Intergenic
1095843351 12:46718935-46718957 CAAGCCAATAAGTTTTGGGGTGG + Intergenic
1097377174 12:58855319-58855341 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1099399840 12:82189909-82189931 CCAGTGAATATCTTTTAAGTGGG - Intergenic
1099605350 12:84796169-84796191 CCAGCCACTAAGTTGTAAATGGG + Intergenic
1106369266 13:29115744-29115766 CCAGCCAGTTAGTTTTAAGAGGG - Intronic
1107489111 13:40863270-40863292 CTCTCCAATAAGTTTTAAGATGG + Intergenic
1108252573 13:48581813-48581835 CCTGACAATCAGTTTTAAGGAGG + Intergenic
1109212589 13:59551070-59551092 CCAGTCTATATCTTTTAAGTGGG - Intergenic
1109749327 13:66669355-66669377 CCAGCCATTGTGTTTTATGTCGG + Intronic
1110804508 13:79738651-79738673 CCAGTCCATATCTTTTAAGTGGG + Intergenic
1110827572 13:79990474-79990496 TCTGCCAATACCTTTTAAGTTGG + Intergenic
1114215219 14:20653256-20653278 TCGTCCAATAAGCTTTAAGTTGG + Intergenic
1115746287 14:36441061-36441083 CCAGCCAATCAGGTTTTACTGGG + Intergenic
1116505621 14:45676084-45676106 CCAGTCTATATCTTTTAAGTGGG + Intergenic
1117184329 14:53225003-53225025 CCAGTCTATAGCTTTTAAGTGGG + Intergenic
1119769705 14:77212851-77212873 CCAGCCACTAAGCTTGGAGTTGG - Intronic
1120170322 14:81242566-81242588 CCAGTCTATATGTTTTAAATGGG + Intergenic
1121177247 14:91899738-91899760 CCAGACAGTAAGCTTTACGTGGG + Intronic
1121378464 14:93436584-93436606 CCAATAAATAAGCTTTAAGTTGG + Intronic
1122090813 14:99338860-99338882 CCACGCACTAAGTTTTAATTTGG - Intergenic
1124545710 15:30625158-30625180 CCAATGAATGAGTTTTAAGTAGG - Intronic
1124779230 15:32614544-32614566 CCAATGAATGAGTTTTAAGTAGG - Intergenic
1126336366 15:47589877-47589899 TAAGCCACTAAGTTTTATGTTGG - Intronic
1128362538 15:66972525-66972547 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1128779174 15:70346723-70346745 CCAGCCTATATTTTTTAAATGGG + Intergenic
1131932289 15:97456615-97456637 CCAGGCCAGAAGTTTTATGTTGG - Intergenic
1133859817 16:9584002-9584024 AGAGCTAATAAGTTTTAGGTCGG + Intergenic
1135224816 16:20646590-20646612 CCAGCCACTAAGTTGTGACTGGG + Intronic
1140017761 16:71205110-71205132 CCAGCCAATGAGATAGAAGTCGG + Intronic
1146392463 17:32435429-32435451 CCAAAAAATATGTTTTAAGTTGG + Intergenic
1147638434 17:41978561-41978583 CCAGCCGTGAAGTTTTAAGTAGG - Intronic
1149274001 17:55014428-55014450 CCAGCCACTAAGTTGTAACTAGG - Intronic
1150884381 17:69068560-69068582 TAAGCCAGTAAGTTTTAAGGTGG + Intergenic
1153401633 18:4689007-4689029 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1158052858 18:53244425-53244447 TAAGCCACTAAGTTTTAAGGTGG - Intronic
1158559781 18:58504283-58504305 CCATCCAATGACTTTTTAGTGGG + Intronic
1160362435 18:78295318-78295340 CCAGCCAATTAGTTTCAGGCTGG + Intergenic
1161427436 19:4211340-4211362 CCAGCCAGAAAGTTTTTACTGGG - Intronic
1161912157 19:7202454-7202476 CCAACCCCTAAGTCTTAAGTTGG - Intronic
1162002551 19:7756125-7756147 CCAGTCTATATCTTTTAAGTGGG + Intergenic
1163219625 19:15907367-15907389 CCAGTCTATATATTTTAAGTGGG + Intergenic
1164057433 19:21633515-21633537 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1164173643 19:22749043-22749065 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1164323056 19:24167934-24167956 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1166165883 19:40988048-40988070 CCAGCCACTAAGTTGTAACTGGG - Intergenic
924974051 2:156983-157005 CCAGCCACTAAGTTGTGACTGGG - Intergenic
925795511 2:7537936-7537958 CCATTCAATATATTTTAAGTGGG + Intergenic
926864554 2:17343221-17343243 CCAGCCACTAAGTTGTGACTGGG + Intergenic
927176042 2:20408808-20408830 CCAGTCTATATCTTTTAAGTGGG + Intergenic
928585209 2:32752941-32752963 TAAGCCACTAAGTTTTGAGTGGG - Intronic
928677128 2:33661116-33661138 CCAGCCACTAAGTTGTGACTGGG + Intergenic
929188137 2:39116572-39116594 CCAGCCAATAAGTTTTAAGTAGG - Intronic
930252957 2:49056172-49056194 CCAGTCTATATGTTTTAAATGGG - Intronic
931400050 2:61923707-61923729 CCAGTGAAAAAGTTTTAATTGGG + Intronic
932917762 2:75876030-75876052 CCAGCCACTAAGTTGTGACTGGG + Intergenic
934671977 2:96219972-96219994 CCAGCCACTAAGTTGTGACTGGG - Intergenic
935288586 2:101589083-101589105 CCAGCATATATCTTTTAAGTGGG + Intergenic
935617771 2:105103363-105103385 ACAGCCATCAAGTTTAAAGTAGG + Intergenic
935748773 2:106212315-106212337 CCAGCCACTAAGTTGTGACTGGG + Intergenic
936434776 2:112494972-112494994 CCAGCTGGTAAGTCTTAAGTAGG - Intronic
937941027 2:127286252-127286274 CCGGCCAGTAATTCTTAAGTGGG - Intronic
940765070 2:157781501-157781523 CCAGCCAAAAATTCTTAAGCAGG - Intronic
942580338 2:177410590-177410612 CCAGCCACTAAGTTGTGACTGGG - Intronic
942718692 2:178924146-178924168 TCAGAATATAAGTTTTAAGTGGG + Intronic
942816581 2:180059989-180060011 CCAGCCACTAAGTTGTGACTGGG + Intergenic
942830878 2:180236640-180236662 CCAGCCACTAAGTTGTGACTGGG + Intergenic
946720667 2:222603613-222603635 CCAGCCAATTAGTTTGACTTTGG - Intronic
946720898 2:222606136-222606158 CCAGCCAATCAGTGTGGAGTTGG - Intronic
1168741313 20:193720-193742 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1169891678 20:10460301-10460323 CAAGCCACTAAGTTTTAAGGTGG - Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174933726 20:54844490-54844512 ACAGCTAATAAGTTTTAAAGAGG - Intergenic
1174977199 20:55349180-55349202 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1176881022 21:14193437-14193459 TCTGCCAATATGTTTTCAGTTGG - Intronic
1177112494 21:17045520-17045542 CCAGCCAATATTTTCCAAGTAGG + Intergenic
1177455492 21:21332202-21332224 CCAGCCAGGAATTTTTAATTGGG + Intronic
1179259043 21:39742294-39742316 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1180098619 21:45573981-45574003 ACAGCCCAGAAGTTTTAGGTGGG + Intergenic
1182987923 22:34738586-34738608 CAAGCCATTAAGTTTTAGGGTGG + Intergenic
949641024 3:6036151-6036173 GCAGCCAGGAAGTTTAAAGTGGG - Intergenic
951200595 3:19872443-19872465 CCAGCCACTAAGTTGTGACTGGG - Intergenic
952922135 3:38292878-38292900 CCAGCCACTAAGTTGTGACTGGG - Intronic
954949464 3:54458035-54458057 CCAGCCTATATCTTTTAACTGGG + Intronic
955368192 3:58329188-58329210 TCATCCAATAATTTTTAAGGAGG - Intergenic
955711196 3:61780795-61780817 CCTGCCAATGAGCTTTAAATAGG + Intronic
957961430 3:87258345-87258367 CCAGTTAATGTGTTTTAAGTAGG + Intergenic
958016161 3:87942252-87942274 CCAGCCACTAAGTTGTGACTGGG - Intergenic
958629715 3:96670296-96670318 CCAGCCACTAAGTTGTGACTGGG - Intergenic
958666213 3:97140860-97140882 CCAGTCTATATGTTTTAAGTGGG - Intronic
961113111 3:124302294-124302316 CAAACCAATAAGTCTTATGTTGG + Intronic
961841871 3:129720992-129721014 TAAGCCACTAAGTTTTAAGGTGG + Intronic
962509257 3:136082538-136082560 CAGGCCAATAATTTTTAAGAGGG + Intronic
963188045 3:142440246-142440268 CCAGCCACTAAGTTGTGACTGGG + Intronic
963915861 3:150858307-150858329 CCAGCCACTAAGTTGTGACTGGG + Intergenic
964679923 3:159327294-159327316 CCACCCAATAACTTCTGAGTAGG - Intronic
964869247 3:161295218-161295240 TCAGTCACTAAGTTTTAAGGTGG - Intergenic
965054709 3:163697944-163697966 CCAGCCACTAAGTTGTGACTGGG - Intergenic
965771788 3:172189294-172189316 CCAGCTAATTTGTTCTAAGTGGG - Intronic
965795715 3:172436734-172436756 CCAGCCCATAATTTTTAACTTGG - Intergenic
966498069 3:180602747-180602769 TCAGACAAAAAGTTTTAACTAGG - Intronic
969645043 4:8423184-8423206 CCAGCCACTAAGTTGTGACTGGG + Intronic
971339369 4:25753681-25753703 CCTATCAATAATTTTTAAGTAGG - Intronic
972206996 4:36785740-36785762 CAAGCCAATGAGTTTTAAGGAGG + Intergenic
972517616 4:39822720-39822742 CCAGCCAGGAAGTTTGAAGGTGG + Intergenic
972641603 4:40930633-40930655 TCAGCATGTAAGTTTTAAGTAGG + Intronic
972643198 4:40943825-40943847 CCAGCCCATCACTTTCAAGTTGG + Intronic
972781261 4:42288805-42288827 CCAGCCACTAAGTTGTGACTGGG - Intergenic
974520561 4:62975976-62975998 CCAGCCACTAAGTTGTGACTGGG + Intergenic
976129062 4:81865223-81865245 GTAGCCAATTATTTTTAAGTTGG - Intronic
977169453 4:93742717-93742739 TCAGTCAATAAGTGTTATGTGGG + Intronic
977388017 4:96369664-96369686 CCAGTCTACATGTTTTAAGTGGG + Intergenic
977617920 4:99106116-99106138 CCAGCCACTAAGTTGTGACTGGG - Intergenic
978586708 4:110282222-110282244 CCAGCCACTAAGTTGTGAGTGGG - Intergenic
978909652 4:114048782-114048804 CCAGCCACTAAGTTGTGAGTGGG + Intergenic
980614695 4:135204327-135204349 TAAGCCACTAAGTTTTAGGTTGG + Intergenic
983661172 4:170132116-170132138 CCATCCACTAGGTTTTAAATTGG + Intergenic
984380303 4:178984605-178984627 CCTGCCATTAAATTTTAACTAGG - Intergenic
986403664 5:7404695-7404717 CCAGTCATTAAGTTTTATGGTGG - Intronic
987152190 5:15054485-15054507 CCAGTCTATGATTTTTAAGTGGG + Intergenic
988456997 5:31395423-31395445 CCAGCCACTAAGTTGTGACTGGG - Intergenic
988957090 5:36330885-36330907 CCAGCCACTAAGTTGTGACTGGG - Intergenic
990288052 5:54320167-54320189 CCAGCCCTTAGGTTTAAAGTTGG - Intergenic
995574138 5:113512148-113512170 TAAGCCACTAAGTTTTAGGTTGG - Intergenic
995599383 5:113779163-113779185 AAAGCCAATAAGTGATAAGTGGG - Intergenic
996386622 5:122915675-122915697 CCACTCAATGATTTTTAAGTGGG - Intronic
996959206 5:129224232-129224254 GCAGCCAATATGGTTTTAGTAGG + Intergenic
998031371 5:138871905-138871927 CTAGCCAATTATTTTTAACTTGG + Exonic
999594354 5:153185541-153185563 TAAGCCACTAAGTTTTATGTTGG + Intergenic
1000383568 5:160651202-160651224 CCAGCCCATGAGATTTAAATAGG - Intronic
1002945067 6:1753066-1753088 CCAGTCTGTAAGTTTTAATTGGG - Intronic
1004236909 6:13882354-13882376 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1004946950 6:20625962-20625984 CCAGCCATTAAATTCTAACTAGG + Intronic
1005183455 6:23135291-23135313 CCAGACTATATATTTTAAGTGGG + Intergenic
1006709353 6:36052349-36052371 CCAGAAAATAAGTTTTAAAATGG - Intronic
1008222784 6:48875421-48875443 CCATCCACCAGGTTTTAAGTTGG - Intergenic
1008322598 6:50135231-50135253 TCAGCCAGAAACTTTTAAGTAGG + Intergenic
1008743915 6:54645308-54645330 CCAGCCAATGAGATATAAGTAGG + Intergenic
1009850726 6:69194782-69194804 ACAGCCAATAAGTTCACAGTTGG - Intronic
1009853403 6:69227698-69227720 CCAGTCAATATGTATTTAGTGGG - Intronic
1010272327 6:73928656-73928678 CCACCCTATAACTTTTAATTGGG - Intergenic
1010893589 6:81341340-81341362 CCAGCCACTAAGTTGTGACTAGG + Intergenic
1011076868 6:83447359-83447381 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1011100529 6:83715614-83715636 CCAGCCCATAAATTTTAAAAAGG - Intergenic
1011933947 6:92751815-92751837 CTAGCCTATACCTTTTAAGTGGG + Intergenic
1013022331 6:106232313-106232335 CCAGCCACTAAGTTGTGACTGGG + Intronic
1013543638 6:111135024-111135046 CCAGCCACTAAGTTGTGACTGGG + Intronic
1014368499 6:120575567-120575589 CAAGCCAATAAGATTTACATTGG + Intergenic
1015424938 6:133054763-133054785 CCAGGCAAAAAGTTTTAAGGCGG - Intergenic
1015865391 6:137721964-137721986 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1016343156 6:143083987-143084009 CCAGCCAATAAGTTGTAACTGGG - Intronic
1016444623 6:144119349-144119371 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1017831543 6:158134933-158134955 TCAGCCAATAAGTGTTGAGCTGG + Intronic
1018687615 6:166316123-166316145 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1018691318 6:166346357-166346379 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1019201367 6:170318832-170318854 CCAGGCAAGAAGTTTTAATACGG + Exonic
1020705123 7:11534599-11534621 GCAGCCACTAAGTTTTGAGGTGG + Intronic
1021372266 7:19863371-19863393 CCAACCAATAAATTTTAAGTTGG - Intergenic
1023337971 7:39189694-39189716 CCAGCCAAATAGTTTTAAATTGG + Intronic
1023439211 7:40169259-40169281 CCAGCCACTAAGTTGTGACTGGG - Intronic
1026205200 7:68251251-68251273 CCAGCCAATAAGCTCAATGTTGG - Intergenic
1026766567 7:73163877-73163899 CCAGCCATTAAGCATTAACTGGG + Intergenic
1027043045 7:74973576-74973598 CCAGCCATTAAGCATTAACTGGG + Intronic
1027080601 7:75228783-75228805 CCAGCCATTAAGCATTAACTGGG - Intergenic
1028304385 7:89245512-89245534 GAAACCAATAAGTTTTAAGTAGG + Intronic
1028420091 7:90622871-90622893 TCAGACAATATTTTTTAAGTAGG - Intronic
1028588489 7:92473662-92473684 CCAGCCACTAAGTTATGACTGGG - Intronic
1029389801 7:100267395-100267417 CCAGCCATTAAGCATTAACTGGG - Intronic
1030337388 7:108341435-108341457 CCAGCCACTAAGTTGTGACTGGG + Intronic
1030843398 7:114382109-114382131 CCAGCCACTAAGTTGTGACTGGG - Intronic
1031023615 7:116655243-116655265 CAAGCCATTAAGTTTTGAGAGGG + Intergenic
1031264650 7:119567798-119567820 CCAGCCACTAAGTTATGACTGGG + Intergenic
1031471623 7:122174637-122174659 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1032201877 7:129827896-129827918 CCAGCACATAATTTTCAAGTTGG + Intergenic
1032426005 7:131822632-131822654 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1034151213 7:148916838-148916860 CCATCTAATAATTTTTAAATTGG + Intergenic
1034909319 7:154980833-154980855 CCAGCCCTTAATTTTTAAGAAGG - Intronic
1040527656 8:48238946-48238968 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1042056208 8:64766995-64767017 CCAGCCACTAAGTTGTGACTGGG + Intronic
1042862302 8:73326943-73326965 CGAGCCAAGTGGTTTTAAGTGGG + Intergenic
1045511543 8:102815709-102815731 CCAGCCAACGAGTTTTTATTTGG - Intergenic
1045790087 8:105973222-105973244 CTAGCCCATAAGTTCTCAGTGGG - Intergenic
1046696206 8:117342564-117342586 CCTGCCAAGAATTCTTAAGTTGG + Intergenic
1048356428 8:133657494-133657516 CCAGCCCCCAAGTTTTAAATTGG - Intergenic
1048854475 8:138674551-138674573 CCAGCCAATTACTTTTCAGGTGG + Intronic
1057465416 9:95309936-95309958 CTAGCCAATAGATTTTAAGCAGG - Intronic
1058131154 9:101254973-101254995 ACAGCCAAGAGATTTTAAGTTGG - Intronic
1058344797 9:103948101-103948123 CCCGCCAAAAAAATTTAAGTTGG + Intergenic
1060079977 9:120634682-120634704 CCAGTCCATATCTTTTAAGTGGG + Intronic
1061026964 9:128055964-128055986 TCAGCCACTAAGTTTCAAGTTGG + Intergenic
1186254154 X:7701394-7701416 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1186530824 X:10293833-10293855 CTAGCCAAAAAATTTTTAGTGGG + Intergenic
1187866483 X:23727619-23727641 CCAGCCAAGAATTTTTAACTGGG + Intronic
1189370072 X:40420962-40420984 CAAGCCATTAAGTTTTGAGGTGG - Intergenic
1189946630 X:46187066-46187088 CCAGCCACTAAGTTGTGACTGGG + Intergenic
1191167000 X:57401932-57401954 CCAGCCACTAAGTTGTGACTGGG - Intronic
1195148376 X:102041684-102041706 CCAGTCTATACGTTTTAAGTGGG - Intergenic
1196321829 X:114350217-114350239 TCAGACAATAAGTATTAGGTAGG + Intergenic
1196527251 X:116740921-116740943 CCAGCCACTAAGTTGTGACTGGG - Intergenic
1197043948 X:121973603-121973625 ACACCTAATAAGTTTTAAGAGGG + Intergenic
1197764721 X:130052590-130052612 CCATCAAATAAGTATTAAATTGG - Intronic
1198257976 X:134941695-134941717 CCAGCCAATAACTTTTTAAAAGG - Intergenic
1198378187 X:136060190-136060212 CCAGCCAATACGGTTTTGGTCGG - Intergenic
1200379380 X:155819005-155819027 CCAGTCTATATCTTTTAAGTGGG - Intergenic