ID: 929191773

View in Genome Browser
Species Human (GRCh38)
Location 2:39146925-39146947
Sequence CAGTGGGACTGGGGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929191773_929191786 17 Left 929191773 2:39146925-39146947 CCTGCTTTCCCCCAGTCCCACTG No data
Right 929191786 2:39146965-39146987 CCTGATTGGTTGTAGCATGTTGG No data
929191773_929191781 3 Left 929191773 2:39146925-39146947 CCTGCTTTCCCCCAGTCCCACTG No data
Right 929191781 2:39146951-39146973 GCCCACTGACTCCACCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929191773 Original CRISPR CAGTGGGACTGGGGGAAAGC AGG (reversed) Intergenic
No off target data available for this crispr