ID: 929195481

View in Genome Browser
Species Human (GRCh38)
Location 2:39180362-39180384
Sequence TGCCTGAGGCTGCCCCAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 0, 2: 16, 3: 163, 4: 567}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929195475_929195481 25 Left 929195475 2:39180314-39180336 CCAGCACAAACATTGTTTTGAGG 0: 1
1: 0
2: 1
3: 8
4: 151
Right 929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG 0: 1
1: 0
2: 16
3: 163
4: 567
929195478_929195481 -9 Left 929195478 2:39180348-39180370 CCAGACAATTGCGTTGCCTGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
Right 929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG 0: 1
1: 0
2: 16
3: 163
4: 567
929195474_929195481 28 Left 929195474 2:39180311-39180333 CCACCAGCACAAACATTGTTTTG 0: 1
1: 0
2: 1
3: 15
4: 222
Right 929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG 0: 1
1: 0
2: 16
3: 163
4: 567
929195477_929195481 -8 Left 929195477 2:39180347-39180369 CCCAGACAATTGCGTTGCCTGAG 0: 1
1: 0
2: 1
3: 4
4: 176
Right 929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG 0: 1
1: 0
2: 16
3: 163
4: 567

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929195481 Original CRISPR TGCCTGAGGCTGCCCCAGCC GGG Intronic
900179532 1:1305151-1305173 GGCACCAGGCTGCCCCAGCCAGG + Intronic
900358935 1:2278734-2278756 TGCTGGAGGCTGCCCCAGGCTGG + Intronic
900409717 1:2507132-2507154 GGCCTGAGCCTGGCCCAGACAGG - Intergenic
900616928 1:3569624-3569646 TCCCTGTGCCTGCCCCAGGCCGG - Intronic
900617902 1:3573524-3573546 AGCCTGCAGCAGCCCCAGCCTGG - Intronic
900628287 1:3619665-3619687 TTCCTGAGGCCTCCCCAGCCGGG + Intergenic
900636778 1:3669783-3669805 TCCCTGAGGATTCCCCAGCCTGG - Intronic
900740079 1:4325760-4325782 AGCCTCAGGCTGCCCCTGCAGGG + Intergenic
901060273 1:6468632-6468654 GGCCTGAGGCAGCCCCAGGCTGG + Intronic
901951186 1:12748180-12748202 TCCCTCAGGCAGCCCCAGACAGG - Intronic
902113969 1:14106134-14106156 TGCCTGAGGCTACCCCTTCTGGG - Intergenic
902375272 1:16027451-16027473 TGCCTGACCCTGGCCCTGCCTGG + Intronic
902380234 1:16049261-16049283 TGCCTGACCCTGGCCCTGCCTGG + Intronic
902517971 1:17000079-17000101 TGCCTGGTGCTGCCCCAGGAGGG - Exonic
902927215 1:19703920-19703942 TGGTTGAAGCTGTCCCAGCCGGG - Intronic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
903395308 1:22997573-22997595 GGCCTCAGCCTGCCTCAGCCAGG - Intergenic
903948268 1:26978146-26978168 TGCCTGAGGACGCGCCTGCCTGG - Intergenic
904038684 1:27572030-27572052 TGCCAGACCCTGCACCAGCCTGG + Intronic
906140814 1:43532347-43532369 AGAGGGAGGCTGCCCCAGCCTGG + Intronic
906482062 1:46205676-46205698 GGCCTGAGGCTGCCCGAGAAAGG + Intronic
906688726 1:47778937-47778959 TGCTGGAGGCTGTCCCAGCCTGG - Intronic
906914172 1:49990486-49990508 TTCCTGAGGCCTCCTCAGCCAGG + Intronic
907979897 1:59471301-59471323 TTCCTGAGGCCTCCCAAGCCAGG + Intronic
909542626 1:76807663-76807685 TGCCTGCAGCTTCCCCAGGCTGG - Intergenic
911026006 1:93435679-93435701 TGCCTGAGGCCACTCCAGACAGG + Intergenic
911529526 1:99028172-99028194 TCCCTGAGGCTGCCCTGTCCTGG + Intergenic
911708414 1:101041306-101041328 TGTCTGAGACTACCTCAGCCTGG + Intergenic
911968454 1:104398222-104398244 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
911982549 1:104584675-104584697 TTCCTGAGGCTTTCCCAGCCAGG - Intergenic
912073304 1:105840447-105840469 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
912382603 1:109255423-109255445 TGGCTGCAGCTGCCCCAGCCTGG + Intronic
913397019 1:118382543-118382565 TTCTTGAGGCCTCCCCAGCCAGG + Intergenic
913398714 1:118403732-118403754 AGCCTGAAGCTGCACCAGGCAGG + Intergenic
913651127 1:120914083-120914105 GGCCGGAAGCAGCCCCAGCCGGG - Intergenic
914169985 1:145214984-145215006 GGCCGGAAGCAGCCCCAGCCGGG + Intergenic
914449626 1:147779246-147779268 TTCCTGAGGCCTCCCTAGCCAGG + Intergenic
914525102 1:148458947-148458969 GGCCGGAAGCAGCCCCAGCCGGG + Intergenic
914641301 1:149608187-149608209 GGCCGGAAGCAGCCCCAGCCGGG - Intergenic
915323784 1:155070293-155070315 TGCCTCTCGCTGCCGCAGCCGGG - Intergenic
915361452 1:155288414-155288436 TGCCTGAGCCAGCCACACCCCGG + Exonic
916590530 1:166185777-166185799 TGGCTGAGCCTGGCCCAGGCTGG + Intergenic
916594813 1:166233871-166233893 TGCTTGAGGCTGCCCCGGCTGGG + Intergenic
917495190 1:175534165-175534187 TGGCTGAGGCTGGCCATGCCTGG + Intronic
917652821 1:177095831-177095853 TGCCTGGGGCTGTTCCAGACTGG - Intronic
917846827 1:179026411-179026433 AGCCTGAGGCGGCCCCAGGTGGG - Intronic
918322915 1:183382103-183382125 TTCCTGAGGCTTCCTCAGTCAGG - Intronic
918580384 1:186120102-186120124 TGCCCAAGGCTGTACCAGCCGGG - Exonic
918822079 1:189268808-189268830 TCCCTGAGGCAGCACCATCCAGG + Intergenic
919579163 1:199349694-199349716 TTCTTGAGGCCTCCCCAGCCAGG + Intergenic
919767585 1:201137134-201137156 TGCCTGAGCCTCACCTAGCCTGG - Intronic
920051164 1:203165979-203166001 TCCCTGAGCCTGCCCCAGCTGGG + Exonic
920117079 1:203628745-203628767 TTCCTGGGCCTGGCCCAGCCTGG - Intronic
920183516 1:204146993-204147015 TCCCTGAGGCAGCCCCAGCCTGG - Intronic
920784167 1:209024598-209024620 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
920964428 1:210690369-210690391 TGCCTGAGTCAGCACCAGCATGG - Intronic
921176036 1:212595415-212595437 TGCCTCCAGCAGCCCCAGCCCGG + Intronic
921797057 1:219358521-219358543 TTCCTGAGGCCTCCCCAGCCTGG - Intergenic
921859742 1:220029810-220029832 GGGCTGAAGCAGCCCCAGCCTGG + Intronic
921880378 1:220248942-220248964 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
922051910 1:221998849-221998871 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
922729199 1:227941212-227941234 AGCCTGAGGCTCTCCCTGCCAGG - Intronic
923013542 1:230108028-230108050 TGAATGAGTCTGCCCAAGCCTGG - Intronic
923865418 1:237934181-237934203 TTCCTGAGGCCTCCCCAGCCCGG - Intergenic
1062908789 10:1199095-1199117 TGCCTGATTCTGCCACAGGCAGG + Intronic
1063425858 10:5949557-5949579 TGGCTGAGGCTGCCACCTCCTGG - Intronic
1063551185 10:7035186-7035208 TTCCTGAGGCCGCCCCAGCACGG - Intergenic
1063813678 10:9745190-9745212 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1064322880 10:14322027-14322049 TTCCTGAGGCTTCTCCAGCCAGG + Intronic
1064340283 10:14479398-14479420 TTCCTGAGGCCTCCTCAGCCAGG - Intergenic
1064464013 10:15561873-15561895 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1064547528 10:16465787-16465809 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1064904469 10:20330824-20330846 TGCCTGAAGCTTTCCCAGGCTGG - Intergenic
1065573299 10:27094172-27094194 TTCCTGAGGCCTCCCCAACCAGG + Intronic
1067432627 10:46253863-46253885 CACCTGAGGCTGCTCCAACCCGG - Intergenic
1067440634 10:46307601-46307623 CACCTGAGGCTGCTCCAACCCGG + Intronic
1067533560 10:47092081-47092103 TGTCTGCTGCTGCCCCAGCACGG + Intergenic
1067722592 10:48740454-48740476 TGCCTGTCCCTGCCCCATCCTGG - Intronic
1067808798 10:49411068-49411090 AGCCTGAAGATGCCCCTGCCTGG + Intergenic
1068252546 10:54462626-54462648 TGCCTCAGCCTTCCCCAGTCTGG + Intronic
1069642463 10:69964530-69964552 TGTCTGCTGCAGCCCCAGCCAGG + Intergenic
1069831658 10:71285615-71285637 TGCCTGTGGCAGACCCAGCTGGG - Intronic
1069859783 10:71463254-71463276 TGCCTGTCCCTGCTCCAGCCTGG + Intronic
1069926184 10:71852321-71852343 TGCCTGTGGCTGCCCCTGCCAGG + Intergenic
1071042729 10:81334132-81334154 TTCCTGAGGCCTCCCAAGCCTGG - Intergenic
1071526894 10:86364424-86364446 TGCCTGGGGCCACCCCAGCTTGG - Intronic
1072317236 10:94214901-94214923 GGCCAGAGGCTTCCCCATCCAGG + Intronic
1074312044 10:112330331-112330353 TCCCAGAGGCAGCCCCAGCCAGG - Intergenic
1074484414 10:113859933-113859955 TACCTGAAGCTTCCTCAGCCAGG - Intronic
1075037365 10:119080583-119080605 GGCCTCGGGCCGCCCCAGCCCGG + Intronic
1075404275 10:122184133-122184155 TGGCTGAGGCACCCCCATCCTGG + Intronic
1075573447 10:123561266-123561288 AGCCTGAGGCAGGCCCATCCAGG - Intergenic
1075651629 10:124131282-124131304 TTTCTCAGGCTGCCCCAGCCTGG - Intergenic
1075714739 10:124549710-124549732 GGCCAGAGGCAGGCCCAGCCTGG - Intronic
1076092773 10:127702761-127702783 TACCTGTGGCTGGCCCAGCTCGG + Intergenic
1076101017 10:127778180-127778202 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1076315444 10:129536904-129536926 TGGCTGAGGATGGCCCTGCCAGG + Intronic
1076481365 10:130787042-130787064 TCCCTGAGGCAGCCGCAGTCGGG - Intergenic
1076729638 10:132431966-132431988 TGCCTGGGACAGCCCCTGCCAGG - Intergenic
1076769886 10:132657085-132657107 GGCAGGAGGCTGCCTCAGCCAGG + Intronic
1076843258 10:133056907-133056929 GGCCTGAGCCTGCCCCACCCCGG - Intergenic
1077193189 11:1264491-1264513 TTCCTGAGGCCTCCTCAGCCAGG - Intergenic
1077228681 11:1449234-1449256 TGCCAGCAGCTGCCCCAGCCTGG + Intronic
1077335198 11:2000333-2000355 AGCCTGAGCCCGCCCCAGCTGGG - Intergenic
1077396623 11:2327001-2327023 TGCCTGTGGCTTTCCCAGGCTGG + Intergenic
1077486684 11:2841931-2841953 TTCCTGGGGCTGCCGCTGCCTGG - Intronic
1077909000 11:6558166-6558188 TGCCTGAGGTTGCCAGGGCCAGG - Exonic
1078097779 11:8311229-8311251 GGACTGACGCAGCCCCAGCCTGG + Intergenic
1078846984 11:15127211-15127233 GGCCTGAGGCTGCTCCTGCAGGG + Intronic
1079132162 11:17753396-17753418 TTCCTGTGGCTGTCCAAGCCGGG - Intronic
1079346846 11:19660261-19660283 TCCCAGGGGCTGCCCCAGCAGGG + Intronic
1080890263 11:36403029-36403051 TGACTGTGGCTGCACCAGCAGGG + Intronic
1081158792 11:39728399-39728421 TTCCTGAGGCCTCCCCAGCCTGG - Intergenic
1081271588 11:41090870-41090892 TTCCTGAGGCCTCCTCAGCCAGG + Intronic
1081445015 11:43122758-43122780 TTCCTGACGCCTCCCCAGCCAGG + Intergenic
1081661311 11:44889966-44889988 TGGCTGGGGCTGCCCTAGGCAGG + Intronic
1081978241 11:47249329-47249351 TCCTTGAGGTTGCCCCAGTCTGG + Intronic
1082692742 11:56325520-56325542 TTCCTGAGGCCTCCTCAGCCAGG + Intergenic
1082890976 11:58138253-58138275 AGCCTCAGGCAGCCCCAGCTGGG - Intronic
1083614936 11:64021627-64021649 TGCCTGGAGGGGCCCCAGCCAGG + Intronic
1083694928 11:64436470-64436492 TGCCTGATGCAGTCCCAGCCTGG - Intergenic
1084225132 11:67711020-67711042 TGCCTTTGCCAGCCCCAGCCAGG - Intergenic
1084262951 11:67990862-67990884 TGCCTTTGCCAGCCCCAGCCAGG - Intergenic
1084586518 11:70065696-70065718 AGCTGGAGGGTGCCCCAGCCTGG + Intergenic
1084810442 11:71608254-71608276 TGCCTTTGCCAGCCCCAGCCAGG + Intergenic
1085256250 11:75175252-75175274 TCCCTGAGGCTGCCTTGGCCGGG + Intronic
1085327049 11:75614235-75614257 TCCCTGCGGCTGCTCCAGCCAGG + Intronic
1085518055 11:77122751-77122773 AGCCTGAGGCTTCCCCACTCAGG + Intronic
1085554983 11:77411738-77411760 TGCCTGGGGCTCCCCTAGCTGGG - Intronic
1085626612 11:78078837-78078859 TGCCTCAGCCTCCCTCAGCCTGG + Intronic
1085701830 11:78752435-78752457 TCCCTGAGGCTGACCCAGCTGGG + Intronic
1085810072 11:79671972-79671994 TGCCCGAGGCTGCCACTGTCAGG + Intergenic
1085811231 11:79683122-79683144 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1086037865 11:82438714-82438736 TGCCTGAGGCTGCACAAGGTGGG + Intergenic
1086347760 11:85914836-85914858 TTCCTGAGTCCTCCCCAGCCTGG - Intronic
1086442863 11:86846589-86846611 TGCCAGAGGCTCCCCCTGCATGG + Intronic
1087877624 11:103376182-103376204 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1088866697 11:113854429-113854451 GGCCTGAGGCTTGCCCAGGCTGG + Intronic
1089270918 11:117300672-117300694 TGCCTGCGGCTGCCCCTTCCAGG + Intronic
1090028337 11:123186332-123186354 CAACTTAGGCTGCCCCAGCCTGG - Intronic
1090785401 11:130043799-130043821 TGCCTTGGGCAGCTCCAGCCTGG - Intergenic
1091182372 11:133618508-133618530 TACCTGAGGGTTCCCCAGCCTGG - Intergenic
1091310652 11:134573192-134573214 TGCCTCAGGCGGCCCAGGCCAGG + Intergenic
1091335377 11:134762353-134762375 TGTCTGAGCCTTCCCCAGTCCGG - Intergenic
1202810487 11_KI270721v1_random:25245-25267 AGCCTGAGCCTCCCCCAGCGAGG + Intergenic
1202818181 11_KI270721v1_random:55515-55537 AGCCTGAGCCCGCCCCAGCTGGG - Intergenic
1092057116 12:5516732-5516754 TGCTTGAGGCTGTCACAACCAGG + Intronic
1093372308 12:18379707-18379729 TGACTGGGGCTCCCCCAGCTTGG + Intronic
1093373252 12:18389384-18389406 TGGCTGTGGCTGACCAAGCCTGG - Intronic
1094496519 12:30992502-30992524 AGCCTGTGGCTGCCCTACCCAGG - Exonic
1096001964 12:48137669-48137691 TGGCTCAGGCTGCCCCATCTTGG - Intronic
1096104171 12:48986860-48986882 TGAGTGGGGCTCCCCCAGCCGGG - Intergenic
1096241286 12:49961666-49961688 GGCCGGCGGCTGCCCCGGCCGGG + Intergenic
1096700664 12:53380589-53380611 CGCCTGAGGCTCCTCCCGCCGGG + Intronic
1097160108 12:57040067-57040089 TACCTGAGAATGTCCCAGCCTGG - Intronic
1097681982 12:62657450-62657472 TGTTAGAGGCTGCCACAGCCAGG + Intronic
1098029640 12:66240646-66240668 TGCCTCAGGCTGTCCCAGAGGGG + Intronic
1098241069 12:68467811-68467833 AGCCTGAGGCAGCCCAAGTCAGG - Intergenic
1098241551 12:68472520-68472542 GGGCTGAGGCTGCCCCTGCTTGG - Intergenic
1098956871 12:76696949-76696971 TGCCAGAGGCTCCCCCTGCATGG - Intergenic
1100981453 12:100165883-100165905 AGCCAGAGGCAGCTCCAGCCTGG - Intergenic
1101071079 12:101076671-101076693 GGCCTGAGGCTGTCCCAGAATGG + Intronic
1102236762 12:111298618-111298640 TGCCAGAGGCTCCCTCTGCCTGG + Intronic
1102298480 12:111754965-111754987 TGGGTGAGGCTGCCCCTGCCTGG - Intronic
1102671530 12:114623392-114623414 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1102806303 12:115783723-115783745 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1102822389 12:115918796-115918818 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1104240935 12:126988647-126988669 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1104742136 12:131185375-131185397 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
1104887441 12:132118950-132118972 GCCGGGAGGCTGCCCCAGCCGGG + Intronic
1105295525 13:19085582-19085604 TGAATGAGGCTTCCCCAGGCAGG + Intergenic
1106046636 13:26148054-26148076 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1106411438 13:29514163-29514185 TGCCTGAGGCTGCGGCAGCTCGG + Exonic
1107432564 13:40352979-40353001 TGCCCACAGCTGCCCCAGCCTGG + Intergenic
1109730088 13:66401443-66401465 TTCCTGAGGCCTCCCTAGCCAGG + Intronic
1109861240 13:68201612-68201634 TGCCTGTGGCTTTCCCAGGCAGG + Intergenic
1110044655 13:70812903-70812925 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1110341551 13:74397676-74397698 AGACTGAGGCTGCAGCAGCCTGG - Intergenic
1110401215 13:75093953-75093975 TTCCTGAGGCCTCCCCAGCTAGG + Intergenic
1110619255 13:77577297-77577319 TTCCTGAGGCCTCCCCAGCAAGG - Intronic
1110914745 13:81008098-81008120 TTCCTGAGGCTTCCCCAGTCAGG + Intergenic
1111441515 13:88287140-88287162 TTCTTGAGGCCTCCCCAGCCGGG - Intergenic
1112436093 13:99392308-99392330 TGTCAGAGGCTCCCCCAGACGGG - Intergenic
1113078740 13:106493731-106493753 TCCCTGCCGCTGCCCCAGGCTGG - Intronic
1113113307 13:106847507-106847529 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1113841377 13:113363604-113363626 TCCCTGCGGCTGCCCTAGCTCGG + Intronic
1114065241 14:19054357-19054379 GGCCTGAGGCTGCCCAAGGGTGG + Intergenic
1114097022 14:19345645-19345667 GGCCTGAGGCTGCCCAAGGGTGG - Intergenic
1115054533 14:29106582-29106604 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1115846386 14:37540064-37540086 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1117632877 14:57711290-57711312 TCCCTGAGGCCTTCCCAGCCAGG + Intronic
1118151598 14:63195895-63195917 ATCCTGAGGCCTCCCCAGCCAGG + Intergenic
1118722510 14:68604439-68604461 CGCCAGTGGCTGCACCAGCCAGG + Intronic
1119271796 14:73312336-73312358 TGACCGAGACTGCACCAGCCTGG + Intronic
1119438207 14:74611655-74611677 CTCCTGGGGCTCCCCCAGCCCGG + Exonic
1120380663 14:83774966-83774988 TGCCTCAGCCTCCCCAAGCCTGG - Intergenic
1121127717 14:91418321-91418343 TACCTGGGGCTGCACCTGCCAGG - Intergenic
1122018821 14:98819769-98819791 TCCCTGAGGCTCCCCCCGACCGG + Intergenic
1122430231 14:101635629-101635651 TGCCTGCTGCTCCCCCAGCGTGG + Intergenic
1122448482 14:101784415-101784437 TTCCTGAGGCCTCCCCAGCTAGG - Intronic
1122829687 14:104389688-104389710 TGTCGGAGCCTGCACCAGCCTGG - Intergenic
1123473158 15:20569489-20569511 GGCCAGAGGCAGCTCCAGCCCGG + Intergenic
1123644848 15:22430864-22430886 GGCCAGAGGCAGCTCCAGCCCGG - Intergenic
1123733459 15:23164500-23164522 GGCCAGAGGCAGCTCCAGCCCGG + Intergenic
1124564047 15:30798860-30798882 AGCCAGAGGCAGCTCCAGCCTGG + Intergenic
1125331894 15:38590601-38590623 TCTCTGAAGCTGCCTCAGCCAGG + Intergenic
1126232088 15:46339007-46339029 TTCCTGAGGCCTCCACAGCCAGG + Intergenic
1126940337 15:53759544-53759566 GGCGTGCGGCTGCACCAGCCAGG + Intronic
1127078104 15:55348100-55348122 TGCCTCAGCCTGCCTCAGCTGGG + Intronic
1127165756 15:56243743-56243765 TGCCTGGGGCTGCAGCAGCACGG - Intergenic
1127773019 15:62245593-62245615 GGCCAGAGGCAGCTCCAGCCTGG - Intergenic
1128082027 15:64862416-64862438 TGTCTGAGGTTCCCCAAGCCTGG + Intronic
1128129261 15:65214856-65214878 TGGCTGAGGCTGACCCACCCAGG - Intergenic
1128544538 15:68558269-68558291 TGTCTGCTGCTGCCCCTGCCTGG + Intergenic
1129107037 15:73317733-73317755 GGCCTGTGGCTTCCCCAGCCTGG - Intergenic
1129113873 15:73354055-73354077 TGTCTGAGGCAGCCCTAGGCAGG - Intronic
1129183585 15:73892124-73892146 TGCCTGAGGCTGGCTGAGTCTGG - Intergenic
1129231527 15:74199633-74199655 GGCCAGAGGCTCCCCCAGGCAGG - Intronic
1129520117 15:76180541-76180563 TGACCCACGCTGCCCCAGCCGGG - Intronic
1129538641 15:76334013-76334035 AGCCTGGGGCTGCCCCCTCCTGG + Intergenic
1129788122 15:78322696-78322718 CTCCTGAGGCTGTCCCAGACTGG - Intergenic
1130085658 15:80776995-80777017 TGCCTCAAGCTGCCCAAGTCTGG - Intergenic
1131399580 15:92113683-92113705 GGCCGGAGGCTGCCCCATCTGGG + Intronic
1132247654 15:100309909-100309931 TCCCTGAAGCTGCCCCTGCAAGG - Intronic
1132316979 15:100897517-100897539 AGACTGAGGCTGCCGCAGACAGG - Intronic
1132403476 15:101528090-101528112 TGCCTGGAGATGCCCCAGGCAGG - Intergenic
1132413903 15:101606730-101606752 TGCCTGTGGCTGCCCTATGCCGG - Intergenic
1132467124 16:82483-82505 TGCCCCACGGTGCCCCAGCCTGG - Intronic
1132545936 16:533487-533509 TGCCTGTGCCTGCCCAAGCTGGG + Intronic
1132579369 16:678058-678080 TACCTGAGGCTGCACAGGCCAGG + Exonic
1132677020 16:1125065-1125087 TGTCAGAGGCGGCCCCACCCGGG - Intergenic
1132723448 16:1327989-1328011 TGCCTGTCTCTGGCCCAGCCTGG + Intergenic
1132809021 16:1788804-1788826 TGCCTGGGCCTGCCCCTGCAGGG - Exonic
1133038379 16:3046854-3046876 TCCCCGGGGCGGCCCCAGCCAGG + Exonic
1133247711 16:4460315-4460337 TGCCTGGGGGTGCCAGAGCCAGG + Intergenic
1133390589 16:5407060-5407082 TTCCTGAGGCCTCCCCACCCAGG - Intergenic
1133618335 16:7501040-7501062 TTCCTGAGGCCTCTCCAGCCAGG + Intronic
1133763491 16:8818940-8818962 TGGCTGAGGGTGATCCAGCCAGG - Intronic
1133933738 16:10252481-10252503 TGCCCGAAGCTGCCCTAGCCGGG + Intergenic
1134596057 16:15496902-15496924 TGCCTGGCTCTGCCCCTGCCTGG - Intronic
1135630962 16:24035372-24035394 TGGCTTAGGCTGGCCCAGGCTGG - Intronic
1135701298 16:24634755-24634777 GGGCTGATGCTGCCCCACCCTGG - Intergenic
1136183351 16:28570139-28570161 TGCCTGTGGCTCTCCCAGGCTGG - Intronic
1136226835 16:28865488-28865510 TGGCTGAGGCTGGCCCAGCCGGG + Intronic
1137054272 16:35735891-35735913 AGCCCGAGGACGCCCCAGCCCGG + Intergenic
1137054347 16:35736143-35736165 AGCCTGAGGGTGCGCCATCCTGG + Intergenic
1137055894 16:35746552-35746574 AGCCTGAGGGTGCTCCAGCCCGG + Intergenic
1137056149 16:35747546-35747568 TGACTGAGGACGCCCCAGCCCGG + Intergenic
1137056363 16:35748303-35748325 AGCCTGAGGGTGCTCCAGCTTGG + Intergenic
1137056433 16:35748562-35748584 AACATGAGGGTGCCCCAGCCCGG + Intergenic
1137056565 16:35749062-35749084 AGCCTGAGGGCGCCCCAGGCAGG + Intergenic
1137056968 16:35750579-35750601 AGCCTGAGGGTGCTCCAGCCCGG + Intergenic
1137057749 16:35753585-35753607 AGCCTGAGGGCGCCCCAGCGTGG + Intergenic
1137057812 16:35753837-35753859 AGCCTGAGGGCACCCCAGCCTGG + Intergenic
1137988687 16:53131191-53131213 CGCCTGAGGCCGCCCCCGCCCGG + Intronic
1138432527 16:56978093-56978115 TGTCGGCGGCTTCCCCAGCCAGG + Exonic
1139657099 16:68395596-68395618 GGCCTGTGGCCGCCCTAGCCTGG + Intronic
1140277386 16:73522804-73522826 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1140479450 16:75254494-75254516 AATCTGAGGCTGCCCCAGTCTGG + Intronic
1141384143 16:83603841-83603863 TTCCTGAGGTCTCCCCAGCCAGG - Intronic
1141485741 16:84339237-84339259 TGCCTGTCGCTGTTCCAGCCTGG + Intergenic
1141885722 16:86890926-86890948 TGCTAGAGGCTGACCCAGGCAGG + Intergenic
1142024496 16:87805144-87805166 TGCCTGTGGCTCACCCAGCTGGG + Intergenic
1142133234 16:88440372-88440394 TGCATGAGGGTGCCCTGGCCAGG - Exonic
1142144545 16:88487457-88487479 TGCGTGGGGCTGCCCCTGACGGG + Intronic
1142284944 16:89167852-89167874 GGCCTGAGGGAGCCCCAGACAGG + Intergenic
1142671744 17:1490887-1490909 CACCTGCGGCTTCCCCAGCCCGG + Intronic
1142683263 17:1562399-1562421 TGCCTGAGGCGGGCCCAGCGGGG - Intronic
1143097867 17:4488108-4488130 CGCTCAAGGCTGCCCCAGCCTGG + Exonic
1143681097 17:8476622-8476644 TGCCTGACCCAGCTCCAGCCTGG + Intronic
1145035839 17:19539965-19539987 TGCATGAGGCTGCCCGACTCAGG + Intronic
1145909669 17:28535088-28535110 TGGCCGAGCCTTCCCCAGCCAGG + Exonic
1146158799 17:30547953-30547975 TGCCTGAGGCTCTCCCAGGGTGG + Intergenic
1146257072 17:31397762-31397784 GGCCAGAGGGTGCCCCAGCTAGG - Intronic
1146306432 17:31733239-31733261 TGCCTCAGACTCTCCCAGCCTGG - Intergenic
1146716236 17:35089164-35089186 TGCCTGAGGCGTCCGCGGCCGGG - Exonic
1146844231 17:36173486-36173508 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1146856536 17:36261421-36261443 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1146864081 17:36326954-36326976 GGCCTGGAGCGGCCCCAGCCTGG - Intronic
1146872446 17:36385332-36385354 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1146879804 17:36436417-36436439 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1147066941 17:37927542-37927564 GGCCTGGAGCGGCCCCAGCCTGG - Intronic
1147075330 17:37985956-37985978 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1147078473 17:38007103-38007125 GGCCTGGAGCGGCCCCAGCCTGG - Intronic
1147086855 17:38065502-38065524 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1147094411 17:38131038-38131060 GGCCTGGAGCGGCCCCAGCCTGG - Intergenic
1147102800 17:38189465-38189487 GGCCTGGAGCGGCCCCAGCCTGG + Intergenic
1147358001 17:39912563-39912585 TCCCTGGGGCAGCCCCATCCTGG + Intronic
1148475056 17:47923137-47923159 TGCCAAAGATTGCCCCAGCCGGG + Exonic
1148486968 17:47996756-47996778 TGACTGGGGCTGCCCCAGCCTGG - Intergenic
1148779371 17:50112847-50112869 AGCCAGTGGCTGCCCCTGCCGGG + Exonic
1148895639 17:50837589-50837611 TCCCTGGGGATGCCCCAGCCTGG - Intronic
1149371067 17:55993750-55993772 TTTCTGAGACTGCCTCAGCCTGG + Intergenic
1149656075 17:58310216-58310238 TGGCTGGGGCTGACCCTGCCTGG - Intronic
1149847373 17:60015932-60015954 GGCCTGGAGCGGCCCCAGCCTGG + Intergenic
1150085732 17:62272549-62272571 GGCCTGGAGCGGCCCCAGCCTGG + Intronic
1150285307 17:63950725-63950747 AGGCTGAGGCTGACCCTGCCTGG - Intronic
1151146381 17:72045460-72045482 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1151575139 17:74949410-74949432 GGCCTGAGGCTGCCCACCCCCGG + Exonic
1151657371 17:75502289-75502311 TGTCTGACGCGGGCCCAGCCGGG + Exonic
1152135254 17:78499816-78499838 TGCAAGAGGCTGCTGCAGCCTGG + Intronic
1152238090 17:79148814-79148836 GGCCTTAGCCTACCCCAGCCAGG - Intronic
1152608095 17:81303054-81303076 TTCCTGACCCTGCCCCGGCCTGG + Intergenic
1152635726 17:81429818-81429840 TTCCTGGGGCTACCCCAACCTGG - Intronic
1152639426 17:81443500-81443522 TGCCGTAGGCTGCCTCAGACCGG - Exonic
1152740084 17:82014941-82014963 TGTCTCAGGCTGCCCCTGCCTGG - Intronic
1152879650 17:82807864-82807886 TGCCTCTGGCTGGCCCTGCCGGG + Intronic
1152946700 17:83201838-83201860 TGCCCCATGCTGCCCCATCCTGG + Intergenic
1153987196 18:10362933-10362955 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1154104739 18:11512244-11512266 AGCTTGAGGCAGCCCCAGCGAGG + Intergenic
1154178502 18:12108287-12108309 TTCCTGAGGCTTCCCCAGCCAGG - Intronic
1154411538 18:14144615-14144637 TGGCTCTGGCTGCCTCAGCCTGG + Intergenic
1155087507 18:22472607-22472629 TGCCTGGGTCTGCCTCAGCTGGG + Intergenic
1155161145 18:23196801-23196823 TGACTGAGGCTGCGCAAGCAGGG - Intronic
1155773127 18:29725294-29725316 TGTCTGAGTCTACCACAGCCTGG + Intergenic
1156169221 18:34462433-34462455 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1156460503 18:37319014-37319036 GGCCTCTGGCTGCCCCCGCCTGG + Intronic
1156836501 18:41561544-41561566 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1157561112 18:48647129-48647151 TGCCTGATGATGCAGCAGCCTGG + Intronic
1158306171 18:56108204-56108226 GGCTTGAGAATGCCCCAGCCTGG - Intergenic
1158879212 18:61760478-61760500 TTCCTGAGGCCTCCCCATCCAGG + Intergenic
1159023846 18:63165440-63165462 TGCCTGCGGCTCCCCAAGCCAGG - Intronic
1159498568 18:69238383-69238405 TTCCTGAGCCCTCCCCAGCCAGG - Intergenic
1159787667 18:72733627-72733649 TCCTGGAGGCTGCCCCTGCCTGG + Intergenic
1159962511 18:74566626-74566648 TACCTGAGGCCACCTCAGCCTGG + Intronic
1160106452 18:75982724-75982746 TGCCTCACGCTGCACCAGACAGG - Intergenic
1160332446 18:78006932-78006954 TGCATGAGGCTGGCCCTGCAGGG - Intergenic
1160612505 18:80099462-80099484 TTCCTGAGACCTCCCCAGCCAGG - Intergenic
1161001264 19:1912380-1912402 GGCCCGAGGCCGGCCCAGCCAGG - Exonic
1161112352 19:2477377-2477399 TGGGTGAGGAGGCCCCAGCCCGG - Intronic
1161208886 19:3056225-3056247 TGCCTGGGGGTGCCCAAGGCGGG + Intronic
1161393743 19:4034148-4034170 TGCCTGATGCGGCTCCTGCCCGG + Intronic
1161431398 19:4234375-4234397 TGCCTGGGGCTGCCACAGAGGGG - Intronic
1161808561 19:6458989-6459011 TGTCCCGGGCTGCCCCAGCCAGG - Intronic
1161809691 19:6464712-6464734 CGCCAGAAGCAGCCCCAGCCCGG - Exonic
1163026892 19:14517901-14517923 TGTCTGGGGCTGCCCCTCCCCGG - Intronic
1163390334 19:17026804-17026826 GGCCCGGGGCTGCCCCAGCTTGG - Exonic
1163678733 19:18668753-18668775 CCCCTGAGGCGGCCCCAGCATGG - Exonic
1164305987 19:24004073-24004095 TTCCTGTGGCTGCCACAGTCCGG - Intergenic
1164599006 19:29548688-29548710 CTCCTGAGCCTGCCCCACCCTGG - Intronic
1165924257 19:39317424-39317446 AGCCTGAGTCTGCCCCTGCTTGG + Intergenic
1166123388 19:40699385-40699407 TGCCTGTGCCTCCCCCATCCCGG + Intronic
1168085234 19:54041011-54041033 TGTCTGAAGCTGCCTCAGACAGG + Exonic
1168102857 19:54150179-54150201 TCCCTGCAGCTGCCCCAGCAGGG - Intronic
1168133367 19:54335396-54335418 TTCCCGAGGCCTCCCCAGCCAGG + Intronic
1168330335 19:55564286-55564308 TGCCTGGGGAGGGCCCAGCCTGG + Intergenic
1202647092 1_KI270706v1_random:152770-152792 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
925001329 2:405154-405176 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
925084786 2:1099545-1099567 TGGTTAAGGCTTCCCCAGCCTGG - Intronic
925331621 2:3063053-3063075 GGCCAGAGGCTGACTCAGCCAGG + Intergenic
925427347 2:3761579-3761601 AGCCTGAGGATGCAACAGCCAGG + Intronic
925839633 2:7979516-7979538 TTCCTGAGGCCTCCACAGCCAGG - Intergenic
925922568 2:8647246-8647268 TGGCTGCAGCTGCCCAAGCCAGG + Intergenic
926052368 2:9753232-9753254 TGCCTGAGCCTGCACCAAGCAGG - Intergenic
926171824 2:10557615-10557637 TCCCTTAGGCTGCCCTTGCCAGG + Intergenic
926456628 2:13074978-13075000 TTCCTGAGGCCTCCCAAGCCAGG - Intergenic
927187435 2:20491946-20491968 TGCCTGCGACTCCCTCAGCCTGG - Intergenic
927202778 2:20588864-20588886 AGGCTGAGCCTGCCTCAGCCTGG - Intronic
927269139 2:21187103-21187125 TTCCTGAGGCCTCCACAGCCAGG - Intergenic
927751252 2:25673056-25673078 GGGCTGATGCTGCCCGAGCCCGG - Intronic
927867389 2:26598832-26598854 GGCATGAGGCTGCCCCACCAGGG - Intronic
928308805 2:30193276-30193298 TCCATGAGGCTGGCCCTGCCTGG - Intergenic
928385925 2:30867984-30868006 TGGCTGAGGCAGCCTCAGCCTGG + Intergenic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
929442781 2:41978520-41978542 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
929780915 2:44956291-44956313 TGCCTGACGCTGCCACACCTTGG + Intergenic
932619786 2:73258720-73258742 TGCCAGAGGCTACTCCAGCCGGG + Exonic
933794022 2:85905949-85905971 GGCATGAGGCTGCATCAGCCAGG - Intergenic
933933717 2:87181966-87181988 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
935783004 2:106524383-106524405 TGCCTTAGGCTTCCCAGGCCTGG - Intergenic
935855031 2:107264273-107264295 CTCCTGAGGCTGGCCCAGCTCGG + Intergenic
936359393 2:111783478-111783500 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
937069742 2:119053954-119053976 TGCCTGAGGCTGCCCAATTCTGG - Intergenic
937174222 2:119910794-119910816 TTCCTGAGGTCTCCCCAGCCAGG + Intronic
937380617 2:121373296-121373318 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
939666985 2:144964601-144964623 TTCCTGAACCTGCCCCAGCCAGG + Intergenic
939895973 2:147791717-147791739 TTCCAGAGGCCTCCCCAGCCAGG + Intergenic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
940173713 2:150855551-150855573 TGTGTGAGGTTGCCTCAGCCTGG - Intergenic
940691237 2:156923372-156923394 TACCTGAGACAACCCCAGCCTGG - Intergenic
942133961 2:172906998-172907020 GGCCTGGGGCTGCTCCTGCCTGG - Intronic
943667005 2:190619454-190619476 TGCATCAGTGTGCCCCAGCCTGG + Intergenic
943722683 2:191221388-191221410 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
946510550 2:220350885-220350907 TTCCTGAGGCCTCCCAAGCCAGG + Intergenic
947931484 2:233968545-233968567 TGCCTAGGGCTACTCCAGCCAGG - Intronic
948481860 2:238255200-238255222 GCCCTGAGGCTGGCCCAGTCAGG + Intronic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
949039426 2:241840720-241840742 GACCTGAGGCTGCACCAGGCAGG - Intergenic
1169143688 20:3239349-3239371 CGCGGGAGGCTGCTCCAGCCGGG + Intergenic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1169635718 20:7689390-7689412 TGCCTGTGGCTTTCCCAGGCTGG - Intergenic
1172829441 20:37820740-37820762 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1172836754 20:37878097-37878119 TGCTTGAGCCAGCCCCATCCAGG + Intergenic
1172881296 20:38201521-38201543 GCCCTGAGGCTGCCCTGGCCTGG + Intergenic
1173087161 20:39934106-39934128 TTCCTGAGTCCTCCCCAGCCAGG - Intergenic
1173499170 20:43539879-43539901 TCTCTGAGGCTGCACCACCCTGG - Intronic
1173691143 20:44962077-44962099 TGCCTGAGACTCTCCCAGCCTGG + Intergenic
1174195198 20:48767854-48767876 TGGGTGAGGCTGCTTCAGCCAGG - Intronic
1174320630 20:49739139-49739161 TGCCTGTGGCTGTCCCAGCCTGG + Intergenic
1174410297 20:50330759-50330781 TGCCTGGCCCTGCTCCAGCCAGG + Intergenic
1175066306 20:56291504-56291526 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1175220583 20:57414365-57414387 TGCCTGCAGCTGGCCCAGGCTGG - Intergenic
1175936440 20:62516389-62516411 AGCCCGAGTCTGCCCCATCCTGG + Intergenic
1176002748 20:62840321-62840343 TGCCTGGGGCTGGCCGCGCCTGG + Intronic
1176861517 21:14013809-14013831 TGGCTCTGGCTGCCTCAGCCTGG - Intergenic
1176883919 21:14230776-14230798 TTCCTGAGGCCTCCCCAGCAGGG + Intergenic
1176913697 21:14599429-14599451 TTCCTGAGGCCTCCCCAGCAAGG + Intronic
1177765113 21:25449269-25449291 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1178903326 21:36615268-36615290 TGCCTGTGGCTCTCCCAGACTGG + Intergenic
1179233199 21:39523810-39523832 TGCCTAACCCTGCCCCAACCTGG - Intergenic
1179942913 21:44651107-44651129 TCCCTGTGGCTCCCCCAGCCTGG - Intronic
1179951015 21:44708853-44708875 GGCCTGTGGCTGCCACATCCCGG + Intronic
1180173917 21:46078364-46078386 CCCCTGAGGCTGCCCCACACCGG - Intergenic
1180483730 22:15776977-15776999 GGCCTGAGGCTGCCCAAGGGTGG + Intergenic
1180983665 22:19891570-19891592 TTGCTCAGGATGCCCCAGCCTGG + Intronic
1181027732 22:20135458-20135480 TGCCTGGGGCTGAGCCAGGCTGG + Intronic
1181138016 22:20782839-20782861 TCCCTGAGTCTGCCTCACCCAGG - Intronic
1181261539 22:21601672-21601694 TGCCTGGCCCTGCCCCAGGCTGG - Intronic
1181463670 22:23099431-23099453 TGCCTGAGGAAGCCCCAGCTGGG - Intronic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1181674274 22:24441633-24441655 GGCCTCATGCTGCTCCAGCCTGG - Exonic
1182083625 22:27546226-27546248 TACCTGAGGCCTCCCCAGCCGGG - Intergenic
1182459905 22:30476192-30476214 TACCTGAGCCTGGCTCAGCCTGG - Intergenic
1182555296 22:31125720-31125742 GGCCTGAGGGGGCCCCAGGCCGG - Exonic
1183459992 22:37944094-37944116 GGCCTGAGGATGGCCCTGCCTGG + Exonic
1183726064 22:39590295-39590317 TGCCTCAAGGTCCCCCAGCCAGG - Intronic
1183831621 22:40421124-40421146 AGCCTGAGGCTGCCCCTGAATGG - Intronic
1184213512 22:43051247-43051269 TGGCTGAGGTCGCACCAGCCAGG + Intronic
1184229862 22:43152549-43152571 TGCCTCAGGCTGCCCTGTCCCGG - Intronic
1184249180 22:43250574-43250596 CCCCTGAGGCTGCTCCTGCCTGG - Intronic
1184588913 22:45467785-45467807 TTCCGGAGGCCTCCCCAGCCAGG - Intergenic
1184592548 22:45494732-45494754 TTCCTGAGGCCTCCCCAGACAGG - Intergenic
1184686936 22:46100492-46100514 CGGCTGAGGCTTCCCCATCCTGG - Intronic
1185275200 22:49947711-49947733 TGCCTGGGTCTGCCCCAGCTGGG - Intergenic
1185341589 22:50293553-50293575 TGGCAGAGGCAGCCTCAGCCAGG + Intronic
950467820 3:13165739-13165761 TGCCTGGGGCTGCAGCAGCGAGG - Intergenic
950730811 3:14955284-14955306 TTTCTGAGGCTGCTCCACCCAGG - Intronic
951385116 3:22032275-22032297 TTCCTGAGTCCTCCCCAGCCTGG - Intronic
952667523 3:35924332-35924354 TTCCTGAGGCCTCCCCAGCTAGG + Intergenic
952898990 3:38097306-38097328 TTCCTGAGCCAGCCCCAGGCAGG - Intronic
953192545 3:40701279-40701301 TGCCTGAAGCTTTCCCAGGCAGG - Intergenic
954389477 3:50261085-50261107 TGCCTGGAGCTGTCCCAGGCTGG + Intergenic
954579768 3:51696914-51696936 GGCCTGAGGCTGCCCCTCCAGGG + Intronic
954635998 3:52071201-52071223 AGGCTCAGCCTGCCCCAGCCAGG - Intergenic
955537019 3:59934653-59934675 TTCCTGAGGCCTCCCTAGCCAGG - Intronic
955990416 3:64621153-64621175 TGCGATCGGCTGCCCCAGCCTGG - Exonic
956546502 3:70408907-70408929 ATTCTGAGGCTTCCCCAGCCAGG - Intergenic
957018817 3:75101000-75101022 TTCCTGAGGCTGCCCCAGTCAGG + Intergenic
957139806 3:76338630-76338652 TGCCCCAGTATGCCCCAGCCTGG + Intronic
957445245 3:80308031-80308053 TGCCAGAGGCTCCCCCTGCAGGG + Intergenic
957680629 3:83428578-83428600 TGCCTCAGCCTGCCTCAGCTGGG - Intergenic
959862901 3:111235904-111235926 TGCCTGTGGCTCTCCCAGGCTGG + Intronic
960928775 3:122823031-122823053 TGCCTGAGGGTGTCCCATTCTGG + Intronic
961239580 3:125398778-125398800 TGCCTAAGGCTGACCAAGCATGG - Intergenic
961453576 3:127013572-127013594 TGCCTGTCTCTGCCCCAGTCCGG + Intronic
961624804 3:128254566-128254588 TGCCTCAGGCTGCCATTGCCTGG + Intronic
961666740 3:128497493-128497515 TCCCTGTCGCTTCCCCAGCCCGG - Intergenic
961669560 3:128519129-128519151 TCCCTCAGGCAGCCCCATCCTGG + Intergenic
962947374 3:140184341-140184363 TTCCTGAGGCCTCCCCATCCAGG - Intronic
963973268 3:151452913-151452935 TACCTGCTGCTGCCCCTGCCTGG - Intronic
964619440 3:158706434-158706456 TCACTGAGGCTGCCCCTGCCTGG - Intronic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
964926548 3:161964640-161964662 TTCCTGAGGCCTCCCCAGCTGGG + Intergenic
965302621 3:167021137-167021159 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
965691969 3:171366974-171366996 TTCCTGAGGCCTCCTCAGCCAGG + Intronic
965931245 3:174044971-174044993 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
966734826 3:183180145-183180167 TCCCTAAGGCTGCTCCAGCAGGG - Exonic
966761229 3:183420673-183420695 CTCCTGAGGCTTCCCCAGCCAGG - Intronic
967648007 3:191950263-191950285 TGGCTGGGGCTGCTCCAGGCTGG - Intergenic
968006684 3:195247779-195247801 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
968228890 3:196992709-196992731 CTCCTGCGTCTGCCCCAGCCTGG + Intronic
968489726 4:883550-883572 TGCCGGAGGCTGCGCTTGCCCGG - Intronic
968490112 4:885537-885559 TGCCTGAGGCCTACACAGCCAGG - Intronic
968584891 4:1411718-1411740 TGCCTGCCACTGCCCCAGACTGG + Intergenic
968645203 4:1737212-1737234 TGACTGAGGCTGCCTCTGCTTGG + Intronic
968663871 4:1810316-1810338 TCCCTGAAGCTGCCCCACCAGGG + Intergenic
968908933 4:3466868-3466890 CGCGTGAGGGTGCCCCTGCCCGG - Intronic
968974817 4:3816533-3816555 TGCCCCAGGCTGGCCCAGCAGGG - Intergenic
969021460 4:4142778-4142800 TGCCTTTGCCAGCCCCAGCCAGG - Intergenic
969053044 4:4386381-4386403 TGCCTGGGGCAGCCTCACCCTGG + Exonic
969189109 4:5502672-5502694 TTTCTGAGGCCTCCCCAGCCAGG - Intergenic
969274929 4:6128589-6128611 TGCCTGACAAAGCCCCAGCCCGG + Intronic
969732404 4:8964638-8964660 TGCCTTTGCCAGCCCCAGCCAGG + Intergenic
969791986 4:9498721-9498743 TGCCTTTGCCAGCCCCAGCCAGG + Intergenic
970150364 4:13082783-13082805 TGTCTGAGACCGCCTCAGCCTGG + Intergenic
970649294 4:18159362-18159384 TGCCTGAGCCTTCCCCCGCCTGG - Intergenic
970894793 4:21089365-21089387 TTCCTGAGGCCTCCACAGCCAGG + Intronic
971061653 4:22978497-22978519 TGCCTGACCCAGCCCCAACCTGG + Intergenic
971642500 4:29153816-29153838 TTCCTGAGTCCCCCCCAGCCAGG - Intergenic
972875903 4:43359580-43359602 TTCTTGAGGCCTCCCCAGCCAGG + Intergenic
973138210 4:46732978-46733000 TGCGAGAGGGTGCCCCAGACAGG - Intergenic
973373347 4:49270933-49270955 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
973387661 4:49524275-49524297 TGCCAGACCCTGCCCCGGCCTGG - Intergenic
973931075 4:55793697-55793719 TCCCTGAGGCCGCGCCCGCCCGG - Intergenic
974679155 4:65138194-65138216 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
974742102 4:66020890-66020912 TTCCTGAGGCTTCCCCAGCAAGG - Intergenic
974815080 4:66994023-66994045 TTCCTGAGGCCTCCTCAGCCAGG - Intergenic
975374859 4:73631826-73631848 TGCCTGACCCAGCCCCAGTCTGG + Intergenic
976720499 4:88164590-88164612 TTCCTGAGGCCTCCCTAGCCAGG + Intronic
977136793 4:93315027-93315049 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
978902087 4:113963345-113963367 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
978925434 4:114237227-114237249 TGCCTTAGCATGCACCAGCCTGG + Intergenic
980153554 4:129078886-129078908 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
980318731 4:131239989-131240011 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
980468097 4:133212726-133212748 TTCCTGAGGCCTCCCAAGCCAGG - Intergenic
980795659 4:137679491-137679513 ATTCTGAGGCTTCCCCAGCCAGG + Intergenic
981123009 4:141073986-141074008 TTCCTGAGACTCCCCCATCCTGG + Intronic
981205474 4:142034896-142034918 GGGATGAGGGTGCCCCAGCCAGG - Intronic
982103186 4:151988896-151988918 TGCCTGCGGCTGCCCTTCCCAGG + Intergenic
982212674 4:153051848-153051870 TTCTTGAGGCCTCCCCAGCCAGG - Intergenic
983006265 4:162489447-162489469 TTCCTGAGGCCCCACCAGCCAGG + Intergenic
983062570 4:163175579-163175601 TCCCTGAGGCAGCACCATCCAGG - Intergenic
984576333 4:181452581-181452603 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
984891610 4:184498868-184498890 CTCCTAGGGCTGCCCCAGCCTGG + Intergenic
985037582 4:185856789-185856811 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
985356617 4:189126685-189126707 TTCCTGAGGCCTTCCCAGCCAGG - Intergenic
985478926 5:95214-95236 TTTCTGAGGCTGACACAGCCTGG + Intergenic
985493635 5:193029-193051 TGCCTGAGGCTGCCTTGGCCTGG - Intronic
985541816 5:490913-490935 TGGGTGAGGCGGCCCCAACCCGG + Intronic
985727036 5:1522083-1522105 TGCCTGAGGCAGCCATAGCTGGG + Intronic
985967937 5:3351918-3351940 AACCTGAGGCTGCCCCTGCTTGG - Intergenic
986093557 5:4534841-4534863 TTCCTGAGGCCTCCCCAACCAGG - Intergenic
986525747 5:8673206-8673228 TCCCTGAGGCCTCCCCAGCCAGG - Intergenic
986661216 5:10061912-10061934 TTCCAGAGGCCTCCCCAGCCTGG + Intergenic
987584939 5:19842829-19842851 TATCTGAGACTGCCTCAGCCTGG - Intronic
987674934 5:21062600-21062622 TCCCTGAGTCCTCCCCAGCCAGG + Intergenic
987675190 5:21064492-21064514 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
988078371 5:26382494-26382516 TGCCTGTGGCTCTCCCAGGCTGG - Intergenic
988867828 5:35354818-35354840 GGCCTGAGCCTGCCCAACCCTGG + Intergenic
988942769 5:36162828-36162850 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
990032900 5:51283273-51283295 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
990645159 5:57835395-57835417 TGCCTGGGCAAGCCCCAGCCTGG - Intergenic
991184977 5:63795873-63795895 TTCCTGAGGCCTCCCCAGACAGG - Intergenic
992557674 5:77919012-77919034 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
993769703 5:91910956-91910978 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
994908313 5:105868768-105868790 TGCCTGACCCAGCCCCAGTCTGG - Intergenic
995336164 5:111002177-111002199 TGCCTGTGGCTCTCCCAGGCTGG - Intergenic
995585337 5:113642686-113642708 TGCCTGTGGCTGTCCCAGGCTGG - Intergenic
996256028 5:121403673-121403695 TTCCTGAGGCCTGCCCAGCCAGG + Intergenic
997243072 5:132322420-132322442 AGCCTGATGCTGACCTAGCCTGG + Intronic
997303524 5:132823267-132823289 TGTCTGAGGCCGCCCGGGCCAGG + Exonic
998413063 5:141925525-141925547 TGGGTAAGGCTTCCCCAGCCTGG + Exonic
998461630 5:142314318-142314340 TGCGTGAAGCTGGCCCAGCGTGG - Exonic
999082914 5:148861177-148861199 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
999093634 5:148958804-148958826 TGCATGAGGCTGCGGGAGCCTGG - Intronic
999258367 5:150222459-150222481 TGCCTGAGGAAGCCCCAGCCTGG + Intronic
1000015663 5:157273444-157273466 GTCCTGGGGCTGCCCCACCCTGG - Intronic
1000728585 5:164802503-164802525 TGTCTGAGACTACCTCAGCCTGG + Intergenic
1001109670 5:168885333-168885355 TGTCTCAGGCTCCCCCAGCCAGG + Intronic
1001586182 5:172834909-172834931 AGCCTGAGGCTCCCCCAGGCCGG + Intronic
1002047849 5:176552102-176552124 GGCCTGAGGCTGCCCCAGCAGGG + Intronic
1002091733 5:176810321-176810343 TGCCTGAGGCTCCCCCAGGGAGG - Intergenic
1002173058 5:177386012-177386034 TGCCTATGCCTTCCCCAGCCTGG + Exonic
1002276417 5:178107101-178107123 TGACTGGGGCAGCCCCAGGCAGG - Intergenic
1002338912 5:178501713-178501735 TGTCTGAGGCTACCCCAGCAGGG - Intronic
1002430265 5:179199297-179199319 TGCCTGATCCTGCCCCTGCTGGG - Intronic
1002613680 5:180437219-180437241 AGCCTGAGGCTGCCCTGGGCTGG - Intergenic
1002898830 6:1393969-1393991 TCCCTGAGGTAGCCCCAGGCTGG - Intronic
1003280857 6:4690252-4690274 TGCCTGAGGCCTCCCCAGCCAGG - Intergenic
1004043966 6:12009201-12009223 TGCCTGAGCCGGGCCCGGCCGGG + Intronic
1005499447 6:26417330-26417352 TTCCTAAGGCCTCCCCAGCCAGG - Intergenic
1006735544 6:36270299-36270321 AGCCTGTGGTTGCTCCAGCCGGG + Intronic
1006844848 6:37055120-37055142 TGCGTGTGGCTTCCCCTGCCTGG + Intergenic
1006911363 6:37565775-37565797 TCCCTGAGGCTGCTGCTGCCGGG + Intergenic
1007255488 6:40525235-40525257 TTTCTGAGACTGCTCCAGCCAGG - Intronic
1007462841 6:42030696-42030718 AGTCTGAGGGTGGCCCAGCCCGG + Intronic
1007664947 6:43508573-43508595 TTCCTCTGCCTGCCCCAGCCTGG + Intronic
1007680028 6:43627671-43627693 TACCTGAGGCTTCCCCTCCCAGG + Intronic
1007787050 6:44286592-44286614 TGCCTCAGGCTGGGCCTGCCTGG + Intronic
1011845113 6:91553259-91553281 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1013230385 6:108157314-108157336 TGCCTGCGCTTCCCCCAGCCGGG + Intronic
1013485708 6:110594218-110594240 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1014211678 6:118715109-118715131 TTCCTGAGGCCTCCCAAGCCAGG - Intergenic
1014705174 6:124737413-124737435 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1015055817 6:128901978-128902000 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1017703320 6:157096654-157096676 TGCCAGAGGCAGTGCCAGCCTGG - Intronic
1017928479 6:158931093-158931115 GGCTTGAGGCTTCCCCAGCCAGG + Intergenic
1018138706 6:160805464-160805486 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1018470790 6:164096237-164096259 TTCCTGAGGCTTCCTCAGCTGGG - Intergenic
1018664907 6:166126548-166126570 TCACTGGAGCTGCCCCAGCCTGG - Intergenic
1018947273 6:168356628-168356650 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947289 6:168356683-168356705 TGCCTGGGGCTGCCCCTGCTGGG - Intergenic
1018947338 6:168356848-168356870 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947371 6:168356958-168356980 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947453 6:168357233-168357255 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947470 6:168357288-168357310 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947503 6:168357398-168357420 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947536 6:168357508-168357530 TGCCTGGGGCCACCCCTGCCGGG - Intergenic
1018947568 6:168357618-168357640 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947586 6:168357672-168357694 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947603 6:168357727-168357749 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947635 6:168357837-168357859 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947667 6:168357947-168357969 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947687 6:168358002-168358024 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947705 6:168358057-168358079 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947725 6:168358112-168358134 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947758 6:168358222-168358244 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947776 6:168358276-168358298 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947793 6:168358331-168358353 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947826 6:168358441-168358463 TGCCTGGGGCCGCCCCTGCCAGG - Intergenic
1018947876 6:168358606-168358628 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947894 6:168358661-168358683 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947914 6:168358716-168358738 TGCCTGGGGCCGCCCCTGCTGGG - Intergenic
1018947963 6:168358881-168358903 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1018947981 6:168358935-168358957 TGCCTGGGGCCGCCCCTGCCGGG - Intergenic
1019150717 6:170003835-170003857 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1019210947 6:170404156-170404178 TTTCTGCGGCTGGCCCAGCCTGG - Intronic
1019267059 7:123564-123586 GCCCTGAGGGTGCCCCAGCCTGG + Intergenic
1019352326 7:560249-560271 TTCCTGAGACCTCCCCAGCCAGG + Intronic
1019425797 7:975953-975975 TGCCTGCGGCTGCTGGAGCCAGG + Intergenic
1020560516 7:9726057-9726079 GGCCCGGGGCTGCCCCAGCTTGG + Intergenic
1020608246 7:10363736-10363758 TTCCTGAGGTTTCCCCAGTCAGG + Intergenic
1020806286 7:12794381-12794403 TTCCTGAGGCCTACCCAGCCAGG - Intergenic
1020958927 7:14777631-14777653 TTCCTGAGGGTTCCCTAGCCAGG + Intronic
1021342397 7:19480560-19480582 TACCTGAGGCTCTCCCAGCCTGG - Intergenic
1021435650 7:20612274-20612296 TTCCTGAGGGTTCCCCAGCCAGG - Intergenic
1021761916 7:23910613-23910635 TGCCTGTGGTTCTCCCAGCCTGG - Intergenic
1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG + Intronic
1022945581 7:35280536-35280558 TGCCTGGAGCTGCCTCAGCAAGG + Intergenic
1023060866 7:36325184-36325206 TGGCACAGTCTGCCCCAGCCTGG + Exonic
1023141255 7:37104630-37104652 GGCCTGAGGCCTCCGCAGCCTGG - Intronic
1023225440 7:37964368-37964390 TTCCTGAGGCCTTCCCAGCCAGG - Intronic
1023527401 7:41118998-41119020 TTCCTGGGGCCTCCCCAGCCAGG - Intergenic
1023812938 7:43926482-43926504 CGCCTCAGGCAGCCCCGGCCGGG + Exonic
1024051728 7:45627990-45628012 AGCATGAGGCTGCCCCTGGCAGG + Intronic
1024124481 7:46278464-46278486 TTCCTGAGGCCTCCTCAGCCAGG + Intergenic
1025301497 7:57822196-57822218 TGCCTGGGGCTTCCTCATCCTGG - Intergenic
1025777368 7:64570545-64570567 CGCCTGCGGCTGCACCGGCCCGG + Intergenic
1026878796 7:73895044-73895066 GGCATGAGGCAGCCCCAGCCAGG - Intergenic
1028646019 7:93097566-93097588 TGCCTGAGGCTCTCTCAGGCTGG - Intergenic
1029286360 7:99468651-99468673 TCCCGGAGGCTGCCTCTGCCCGG - Intergenic
1029374653 7:100170404-100170426 GGGCTGTGGCTCCCCCAGCCCGG - Exonic
1029461002 7:100693936-100693958 TCCCCGAGGCCGCCGCAGCCCGG - Intergenic
1029597946 7:101547479-101547501 TGCATGAGGCTGCCCTTGCATGG + Intronic
1029609777 7:101620703-101620725 ACCCTCAGGCTGCCCCTGCCAGG - Intronic
1031041268 7:116840610-116840632 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1033097301 7:138442501-138442523 TGCTTCAGCCTGCTCCAGCCTGG + Intergenic
1034250869 7:149689640-149689662 TGCTTGAGGCTGCCAGAGCCTGG + Intergenic
1035790633 8:2301257-2301279 TTCCTGAGGCTTCCTCAGGCAGG - Intergenic
1035802172 8:2420448-2420470 TTCCTGAGGCTTCCTCAGGCAGG + Intergenic
1035953418 8:4049964-4049986 TCCGAGAAGCTGCCCCAGCCAGG - Intronic
1035957978 8:4104014-4104036 GGCCTGTCCCTGCCCCAGCCTGG + Intronic
1036122497 8:6033568-6033590 TTCCTCAGGCCTCCCCAGCCAGG + Intergenic
1036501569 8:9319272-9319294 TGCCTAAGTCTTCCCCAGGCAGG - Intergenic
1036757825 8:11483111-11483133 TTTCTGAGGCTTCCCCAGCCAGG - Intergenic
1036987957 8:13557698-13557720 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1037108270 8:15136729-15136751 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1037297142 8:17413316-17413338 TGCGTGAGGCCGCGCCCGCCCGG - Exonic
1038242016 8:25818709-25818731 TGTCTGTAGCAGCCCCAGCCTGG - Intergenic
1038953284 8:32440029-32440051 TTCCTGAGGCCTCCCCAGCCAGG - Intronic
1039078630 8:33714756-33714778 TTCCTGAGGCCTCCTCAGCCAGG - Intergenic
1039092991 8:33852357-33852379 TGCCTGGAGCTGCTCCAGCCTGG - Intergenic
1039374155 8:37016417-37016439 TTCCTGTGGCTGCTCCATCCAGG + Intergenic
1039595195 8:38785465-38785487 TGCCTGAGGTCACCCCTGCCTGG - Intronic
1039711772 8:40062173-40062195 TGGATGGGGCTGCCCCAGCAGGG - Intergenic
1041113099 8:54506206-54506228 TGCCTGAAGTTGGACCAGCCTGG - Intergenic
1041186705 8:55308343-55308365 TTCCTTAGGCCTCCCCAGCCAGG - Intronic
1042168877 8:65973348-65973370 TGCCTGTGGCTTTCCCAGGCTGG - Intergenic
1042385472 8:68169040-68169062 TGCCTGAAGTGGCCACAGCCTGG - Intronic
1043022869 8:75026288-75026310 TGCTTGAGGCCACACCAGCCTGG - Intronic
1043624887 8:82244197-82244219 TGCCTGCAGCTCTCCCAGCCTGG - Intergenic
1044220273 8:89662467-89662489 TTCCTGAGGCCTCCCCAGCCTGG - Intergenic
1044349132 8:91142816-91142838 TGACAGAGACTGCCCCAACCTGG - Intronic
1045244108 8:100428099-100428121 TTCCTGAGGCTCACCCTGCCTGG + Intergenic
1045294570 8:100862128-100862150 TGTGTGAGGCTGGCTCAGCCAGG + Intergenic
1045389512 8:101701464-101701486 GCCCTGACTCTGCCCCAGCCAGG + Intronic
1047309454 8:123679469-123679491 TTCCTGAGACCTCCCCAGCCAGG + Intergenic
1047594848 8:126368074-126368096 TTGCTGAGGCCTCCCCAGCCCGG - Intergenic
1047965917 8:130046683-130046705 TGGCTGTGGCTGGCCCAGCCAGG + Intergenic
1048256615 8:132909694-132909716 TGACTGAGGCTTACCAAGCCTGG - Intronic
1049352596 8:142172056-142172078 AGCCTGTGGGTGCCCCAGCTGGG - Intergenic
1049580191 8:143407533-143407555 TGCCCGGGGCTGCCCCGACCTGG - Intergenic
1049591328 8:143464342-143464364 GGTCTGGGGCTGCCCCAGCCAGG + Intronic
1049611036 8:143555456-143555478 TGCCCAACTCTGCCCCAGCCAGG + Intronic
1049615117 8:143572604-143572626 TCCCTGGGGCTGCCCCTGCCTGG + Exonic
1049646457 8:143738016-143738038 TGCCTGTGGCTGCTCTGGCCTGG + Intergenic
1049773980 8:144396297-144396319 TGGCTGATGCTGCCCCAGCTGGG - Intronic
1049849468 8:144823090-144823112 TTCCTGAGGCTGCCTCCCCCTGG + Intergenic
1050643277 9:7692146-7692168 TTCCTGAGGCTTCCCCAGCCAGG + Intergenic
1051047600 9:12893757-12893779 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1051107177 9:13593475-13593497 TTCCTGAGGCCTCCCTAGCCAGG + Intergenic
1051389056 9:16543770-16543792 TGCCTGAGGCCTCCCCATCACGG + Intronic
1053105647 9:35405736-35405758 GGACTGAGGCTGCCACAGACAGG + Intergenic
1053528098 9:38849533-38849555 TGTCTGAGGCTTCCCCAGGCTGG + Intergenic
1054638035 9:67514398-67514420 TGTCTGAGGCTTCCCCAGGCTGG - Intergenic
1054988831 9:71297453-71297475 TTCCTGAGGCCTCCCCAGGCTGG - Intronic
1055453814 9:76454785-76454807 TTCCTGAGGCCCCCCCAGCCAGG + Intronic
1055829266 9:80359945-80359967 TCCCGGAGGCTGCCGCACCCAGG - Intergenic
1055836889 9:80454530-80454552 TTCCTGAGGCCTCCTCAGCCAGG + Intergenic
1056767554 9:89454375-89454397 TGGCTGAGGCTCCCCTAGCTTGG + Intronic
1057694642 9:97314537-97314559 TGGCTGGGCCTGCCCCACCCAGG + Intronic
1057922177 9:99105748-99105770 TGCCAGAGGCTGCCGAACCCGGG + Intronic
1058419021 9:104817278-104817300 TGCCTGAGCTTCCCCCAGCTGGG - Intronic
1059256779 9:112938088-112938110 TGCCTGAGCCTGCCTCAGTGAGG + Intergenic
1059354006 9:113685954-113685976 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1059401052 9:114070925-114070947 GGCCTGAGGCTCCCCTTGCCTGG - Intronic
1059422418 9:114200546-114200568 TGCCTGAGACGGCTCCAGGCAGG - Intronic
1059425855 9:114220530-114220552 TCCCTGAGCCTGACCCAGCCAGG + Intronic
1059471065 9:114505215-114505237 TGCCCGGGGCTCCCCCAGCCGGG + Intronic
1060898684 9:127238292-127238314 TGGCTGTGGCTGCCACAGCTAGG + Intronic
1061062973 9:128259988-128260010 GGCCAGAGGCAGCTCCAGCCTGG - Intronic
1061077472 9:128350397-128350419 TGCCTGTGCCTACCCCACCCTGG - Intronic
1061233988 9:129331857-129331879 GCCCTGCCGCTGCCCCAGCCTGG - Intergenic
1061478955 9:130887012-130887034 TCCCCGAGGCTGCCCCAGGCCGG + Intronic
1061483403 9:130908458-130908480 TGCCTCAGGCTCCCCAAGCTGGG - Intronic
1062172107 9:135140555-135140577 TTCCTCAGGTTGCCCCAGCCTGG + Intergenic
1062309930 9:135930123-135930145 GGGCTGAGGCTGACCCAGGCAGG + Intergenic
1062452484 9:136621440-136621462 GGGCTGTGGCAGCCCCAGCCTGG + Intergenic
1062528248 9:136987232-136987254 CCCCAGAGGCTGCCCCACCCTGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062583149 9:137237087-137237109 GGCCTCAGTGTGCCCCAGCCTGG - Intergenic
1203697056 Un_GL000214v1:108936-108958 TGCCAGACCCTGCCCCGGCCCGG + Intergenic
1203552153 Un_KI270743v1:172093-172115 TGCCAGACCCTGCCCCGGCCCGG - Intergenic
1185749259 X:2597520-2597542 TTCCTGAGGCTTCCCCAGTCAGG - Intergenic
1185779287 X:2830494-2830516 TGCCTGAGACTGTCACTGCCTGG + Intronic
1185938741 X:4289064-4289086 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1186057976 X:5671683-5671705 TTCCTGAGGCTTCCCCAGCCAGG - Intergenic
1186294266 X:8131770-8131792 TTCCTGAGGCCTCCCCAGCCAGG + Intergenic
1186822444 X:13304359-13304381 TGCCTTACGGTGCTCCAGCCTGG - Intergenic
1187438603 X:19295776-19295798 TTCCTGAGGTCTCCCCAGCCTGG + Intergenic
1187612219 X:20955195-20955217 TGCCTGAGGTTCTCCCAGTCTGG + Intergenic
1188333448 X:28899041-28899063 TTCCTGAGGCCTCCCCAGACAGG - Intronic
1188704038 X:33303778-33303800 TTCCTGAGGCCTCCCCAGCCAGG + Intronic
1188813971 X:34688121-34688143 TTCCTGAGACCTCCCCAGCCAGG + Intergenic
1188856863 X:35208153-35208175 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1189553220 X:42114551-42114573 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1189808916 X:44762948-44762970 TGCCTCAGCCTCCCTCAGCCTGG - Intergenic
1190276368 X:48902137-48902159 TGCCTGAGGCTGGGCCCGCCTGG - Intronic
1190506986 X:51136131-51136153 TTCCTGAGGCCTCTCCAGCCAGG - Intergenic
1192177519 X:68895195-68895217 CGCCTGAGCCTGCACCCGCCTGG - Intergenic
1192219268 X:69186151-69186173 AGGCTGAGGCTGCACCTGCCAGG + Intergenic
1193256409 X:79354311-79354333 TTTCTGAGACTGCCTCAGCCTGG - Intergenic
1194259569 X:91677144-91677166 TTCCTGAAGCCTCCCCAGCCAGG - Intergenic
1194435220 X:93860975-93860997 TCCCTGAGGCCTCCCCAGCCAGG + Intergenic
1195697366 X:107676901-107676923 TGCCTTACGCTCCCCAAGCCGGG + Intergenic
1196309941 X:114151836-114151858 TTCCTGAGGCCTCCCTAGCCAGG + Intergenic
1196817489 X:119676900-119676922 TGTCTGAGGGTGACACAGCCAGG - Intronic
1196911174 X:120485939-120485961 TGCCTGAAGGCGCGCCAGCCGGG - Intergenic
1197016360 X:121631314-121631336 TTCCTGAGGCCTCCCCAGCCAGG - Intergenic
1198952129 X:142083201-142083223 GGTCTGAGACTACCCCAGCCTGG + Intergenic
1198979757 X:142381438-142381460 TGCCTGCAGCTTCCCCAGGCTGG - Intergenic
1199435687 X:147810106-147810128 TTCCTGAGGCTTCCTCAGCCAGG + Intergenic
1199732435 X:150649318-150649340 TGCCTGCTGCTGCCTCAGTCTGG + Intronic
1200578271 Y:4916337-4916359 TTCCTGAAGCCTCCCCAGCCAGG - Intergenic
1201982031 Y:19918453-19918475 TGCCAGTGGCTCCCCCAGCATGG - Intergenic