ID: 929195650

View in Genome Browser
Species Human (GRCh38)
Location 2:39181679-39181701
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1407
Summary {0: 1, 1: 2, 2: 12, 3: 249, 4: 1143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929195646_929195650 -6 Left 929195646 2:39181662-39181684 CCAATTACAGTTGGTTTCCTTAT 0: 1
1: 0
2: 3
3: 20
4: 245
Right 929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG 0: 1
1: 2
2: 12
3: 249
4: 1143
929195643_929195650 0 Left 929195643 2:39181656-39181678 CCCAACCCAATTACAGTTGGTTT 0: 1
1: 1
2: 0
3: 12
4: 167
Right 929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG 0: 1
1: 2
2: 12
3: 249
4: 1143
929195642_929195650 1 Left 929195642 2:39181655-39181677 CCCCAACCCAATTACAGTTGGTT 0: 1
1: 0
2: 2
3: 8
4: 132
Right 929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG 0: 1
1: 2
2: 12
3: 249
4: 1143
929195641_929195650 2 Left 929195641 2:39181654-39181676 CCCCCAACCCAATTACAGTTGGT 0: 1
1: 0
2: 0
3: 10
4: 89
Right 929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG 0: 1
1: 2
2: 12
3: 249
4: 1143
929195645_929195650 -5 Left 929195645 2:39181661-39181683 CCCAATTACAGTTGGTTTCCTTA 0: 1
1: 0
2: 2
3: 12
4: 195
Right 929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG 0: 1
1: 2
2: 12
3: 249
4: 1143
929195644_929195650 -1 Left 929195644 2:39181657-39181679 CCAACCCAATTACAGTTGGTTTC 0: 1
1: 0
2: 0
3: 8
4: 106
Right 929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG 0: 1
1: 2
2: 12
3: 249
4: 1143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900761406 1:4473962-4473984 CCTTATAAGAAGAGGAGACTAGG - Intergenic
900779946 1:4611572-4611594 CCCTAAAGGAGGAGGGAAGATGG + Intergenic
900847331 1:5114433-5114455 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900848025 1:5119182-5119204 GCTTATAAGATGAGGGAAGCAGG + Intergenic
900893072 1:5463604-5463626 CCTTGTAAGAAGAGCCAGGAGGG + Intergenic
900901714 1:5521158-5521180 CCTTATAAGAAGAGGAGATTTGG - Intergenic
900909069 1:5581525-5581547 CCTTATAAAAAGAGGAAACGTGG + Intergenic
901165627 1:7219733-7219755 CCTTATAAGAAGAGGAAGAGGGG + Intronic
901197579 1:7448720-7448742 CCTTATAAAAAGAGGCTGGAGGG - Intronic
901311741 1:8274868-8274890 ACTTATCAGAAGAGAGAAAATGG - Intergenic
901473564 1:9473909-9473931 GCTTATAAGAAGAGGAGACATGG - Intergenic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901692787 1:10984459-10984481 CTTTATAAGAAGAGGAAAATTGG - Intergenic
901723493 1:11219721-11219743 CCTTAAAAAAAGTGGGAATAAGG + Intronic
901773766 1:11545080-11545102 CCTGATAAAAAGAGGGAATTTGG + Intergenic
902041939 1:13499020-13499042 CCTTATAAAAAGGGGGAATTTGG - Intronic
902246701 1:15125334-15125356 CCTTATAAGAAGAGGCGATTTGG - Intergenic
902666180 1:17940259-17940281 CCTTATAAGAAGGAGGCAGGAGG - Intergenic
902753238 1:18532017-18532039 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
902999181 1:20252552-20252574 CCTTAAAAGAAGAGGAAATTTGG + Intergenic
903041176 1:20531890-20531912 CCTTATAAGAAGGAGGCAGAAGG + Intergenic
903072976 1:20736978-20737000 CCTTATAGGAAGAGGAAATTTGG + Intergenic
904213909 1:28904595-28904617 CCTTATAAGAAGAGACACCAAGG + Intronic
904252236 1:29233339-29233361 CCTTGAGAGAAGAAGGAAGAAGG - Intergenic
904916236 1:33972529-33972551 CCTTATAAGAGGGGGGCAGGAGG + Intronic
905136795 1:35806754-35806776 CCTTATAAGAAGAGGAAATTTGG + Intergenic
905277850 1:36830504-36830526 CCGTATAAGAAGAGGAAAAGAGG + Intronic
905475963 1:38228240-38228262 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
906052350 1:42886294-42886316 TCATATAAGAAGAGGGAAAGAGG - Intergenic
906301723 1:44687257-44687279 CCTTATAAGAAGAGGTGACTAGG - Intronic
907153740 1:52312977-52312999 CCTTATAAGAAGGGGAAATATGG + Intronic
907182670 1:52584527-52584549 GCTTATAAGAAGAGGAAATTTGG + Intergenic
907740150 1:57157609-57157631 CTTTGTAAGAAGAGGAAAGGAGG - Intronic
907957527 1:59244395-59244417 CCTTTTAAGAAAAGGGAAATTGG - Intergenic
908061320 1:60352772-60352794 CCTTATATGAAGAGGAAATTTGG + Intergenic
908067219 1:60419850-60419872 TCTTTTAGGAAGAGAGAAGATGG + Intergenic
908414178 1:63896690-63896712 GCTTATAAGCAGAGGGGAGCAGG + Intronic
908713216 1:67041320-67041342 CTTTAAAAGAAGAGGTATGATGG + Intronic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
908769102 1:67580378-67580400 CCTTACAAGAAGAGGAAATGTGG - Intergenic
908886165 1:68791369-68791391 CCTTATAAGAAGAGGAGATGAGG + Intergenic
909041189 1:70654198-70654220 CCCAAGAAGAAGAGGAAAGAAGG + Intergenic
909042808 1:70674223-70674245 CCTTATAAGAGGGGCGCAGAAGG - Intergenic
909408557 1:75321486-75321508 CCTTGTAAGAAGAGACAATAGGG - Intronic
909471498 1:76033941-76033963 CCTTATAAGAAGAGGAGACATGG + Intergenic
909588012 1:77312837-77312859 CCTAATTAGGACAGGGAAGAAGG - Intronic
909875441 1:80797066-80797088 CCCTAACAGAAGAGAGAAGAAGG - Intergenic
910016383 1:82529948-82529970 CCTTTTAAAAAGTGGGCAGAGGG - Intergenic
910112904 1:83701297-83701319 CCTTGTAAGAAGAGGAAATCTGG + Intergenic
910270840 1:85392295-85392317 CTTTATAAGAAGAGGAAATTTGG - Intronic
910301377 1:85710436-85710458 CTTTATAAGAAGAGGAAATTTGG + Intergenic
910498164 1:87856728-87856750 CCTTATAAGAGGAAAGCAGAGGG - Intergenic
910551565 1:88481329-88481351 CCTTATAAGAAGAGGAGATGAGG + Intergenic
910816370 1:91295470-91295492 TCTTATAAGAAGAGGAAATTAGG - Intronic
911506373 1:98757466-98757488 CCTTATAAGAAGAGGAAATCTGG - Intronic
912405084 1:109430906-109430928 TTTTATAAGAAGAGGGAATTTGG + Intergenic
912450300 1:109764131-109764153 CCTAAAAGGCAGAGGGAAGAGGG - Intronic
912477130 1:109945971-109945993 CCTTATAAGAGGAAGGCAGGGGG - Intergenic
913066180 1:115257531-115257553 CCTTGTAAGAAGAGGAAATTAGG - Intergenic
913170776 1:116230171-116230193 CCTTATAATATCAGGGCAGAGGG - Intergenic
913965068 1:143370059-143370081 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914059444 1:144195661-144195683 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914119706 1:144770710-144770732 CTTTATAACAAGAGGAGAGAAGG - Intergenic
914315636 1:146508910-146508932 CCTTATAAGAAGAGGAAATTTGG - Intergenic
914433897 1:147643040-147643062 CCTTATAAGAAGAGGAAATGAGG - Exonic
914456825 1:147844154-147844176 CCTTATAAAAAGGGGAAAAATGG + Intergenic
914498719 1:148224451-148224473 CCTTATAAGAAGAGGAAATTTGG + Intergenic
914739488 1:150451838-150451860 CCATATAAGAAGAGGGAAACTGG + Intronic
914949973 1:152104703-152104725 CCTTATAAGAAGATGAAATTTGG - Intergenic
915661402 1:157408675-157408697 CCTTATAAAAAGAGGGAATCTGG - Intergenic
915719967 1:157977768-157977790 TCTTATAAGAAGAGGAAATTAGG + Intergenic
915921779 1:159981193-159981215 CCTTATAAGAAAAGGAAACCAGG + Intergenic
916002635 1:160631618-160631640 CCTTATAAGAAGAGGAAATCTGG + Intronic
916002671 1:160631929-160631951 CCTTATGAGAAGAGGAAATTTGG + Intronic
916292760 1:163184649-163184671 CCTTGTAAGAAGAAGGCAGGAGG + Intronic
916655323 1:166870279-166870301 CCTTATAAGAAGAGGCAATTAGG + Intronic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
916881474 1:169023382-169023404 CCTTATAAGAAGAGAAAATGTGG - Intergenic
916885102 1:169059825-169059847 CCTTATAAGAAGAGGAAATTTGG + Intergenic
917187071 1:172369955-172369977 TCTTATAACAAGAGGCAATATGG - Intronic
917426584 1:174920717-174920739 CCTTGTAAGAAGAGGAAATTTGG + Intronic
917468272 1:175303929-175303951 CCTTATAAGAAGAGAGATCAGGG - Intergenic
917616768 1:176753888-176753910 CCATAAAATAAGAAGGAAGAAGG + Intronic
917625937 1:176846378-176846400 CCCTAACAGAAGAGGGAAGCTGG + Intergenic
917742343 1:177972857-177972879 CCTTATAAAAAGACACAAGAGGG + Intronic
917874011 1:179268993-179269015 CATTATAAAAAGAGTGAAAAAGG + Intergenic
918119699 1:181528048-181528070 CCATATCAGAAGTGGAAAGATGG - Intronic
918200987 1:182266678-182266700 CCGTATAAGAAGAGACATGAGGG + Intergenic
918404692 1:184200206-184200228 CCTAAAAAGAAGAGGGAGTAGGG - Intergenic
918484549 1:185015515-185015537 CCTTATAAAAAGAGATAAGAGGG + Intergenic
918706304 1:187667036-187667058 CCTTATAAGAAGAAGAAATTTGG - Intergenic
918743909 1:188173770-188173792 CCTTATAAGAGGGAGGCAGATGG + Intergenic
918861488 1:189831993-189832015 CCTTATAAGATGAAGGCAGAGGG - Intergenic
919261745 1:195205072-195205094 ACTTATAAGATGAGGGAGAACGG + Intergenic
919294573 1:195679674-195679696 CCTTACAAGAGGAAGGAAGAAGG + Intergenic
919760215 1:201093272-201093294 CCTTATAAGAAGAGGAACTCTGG + Intronic
919946580 1:202323443-202323465 CCTTCTCAGGGGAGGGAAGATGG + Intergenic
920007880 1:202846535-202846557 CCTTATAAGAGGAGGCAATAAGG + Intergenic
920236652 1:204511439-204511461 CCTCATAAGAAGAGGGGATTAGG + Intergenic
920282976 1:204858218-204858240 CCTTATAAGAAGAGGAGATTAGG - Intronic
920334433 1:205235141-205235163 CCTTATATGAAGCAGGCAGAGGG + Intronic
920446926 1:206024710-206024732 CCTTATAAGAAGAGGAAATGTGG - Intergenic
920718127 1:208360517-208360539 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
920755192 1:208723349-208723371 CCTTATGAGAAGAGGAAATTAGG + Intergenic
920818566 1:209358500-209358522 CCTTATAAGAAGAAGTTAGGAGG - Intergenic
920869144 1:209779033-209779055 CCTTATAAGAAGGGGAAATATGG - Intronic
920884462 1:209913088-209913110 CCTTGAAAGAACAGGGAAAAAGG - Intergenic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
921125098 1:212170512-212170534 CTTTATAAGAAGAGGAAAAGGGG + Intergenic
921510851 1:216027221-216027243 CCTTATAAGAAGAGAAAATTTGG + Intronic
921546206 1:216478009-216478031 CTTTATAAGAAGGAGGCAGAGGG + Intergenic
921891821 1:220361253-220361275 CTTTATAAGAAGAGGCAATTTGG + Intergenic
921892500 1:220367249-220367271 CCTTTTAAGAAGAGGTCAGAAGG - Intergenic
922141334 1:222890896-222890918 CCTTATAAAAAGAGGAAATCTGG - Intronic
922448535 1:225718044-225718066 CCATAACAGAAGATGGAAGAGGG + Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
922881646 1:228985650-228985672 CCTTATAAGAAGAGGAGATGAGG - Intergenic
923001031 1:230006563-230006585 CCTTATAAAAAGGGGGAATTTGG - Intergenic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923374767 1:233350055-233350077 GCTAATTAGAAGAGGGGAGAGGG - Intronic
923492645 1:234498058-234498080 CCTTATAAGAAGAGAAAATTAGG + Intergenic
923617358 1:235548890-235548912 CCATCTAAGAAGAGGGAACTAGG + Exonic
923656480 1:235921557-235921579 CCTTATAAAAAGAGGAAATTTGG + Intergenic
923889507 1:238196815-238196837 CCTTATAAGGAGAGGGGATTTGG + Intergenic
923972298 1:239218096-239218118 CCTTATAACAAGAGGAAATTAGG + Intergenic
924046996 1:240042026-240042048 TCTTACAAGAGGAGGGAAGAGGG - Intronic
924325973 1:242894135-242894157 CCTTATAAGGAGAGGCAGCAAGG + Intergenic
924513680 1:244749105-244749127 CCTTATAAGAAGAGGGGATTAGG + Intergenic
924815511 1:247438252-247438274 CCTAAAAATAAGAGCGAAGAAGG - Intronic
924842996 1:247734191-247734213 CCTTATTAGAACAGGGATTAGGG + Intergenic
1062789662 10:294201-294223 CCTTGGAAGAAGATGGAAGAGGG - Intronic
1062957675 10:1551119-1551141 CCTTATAAGAAGAGGAGATGAGG + Intronic
1063736546 10:8761944-8761966 TCTTATAAGAAGGGGGCAGGAGG - Intergenic
1064447895 10:15412768-15412790 CCTTATAAGAAAAGGAGATAAGG - Intergenic
1064651677 10:17516001-17516023 CCTTATAAAAAGAGGAAGGGAGG - Intergenic
1064726772 10:18288061-18288083 CCTTATAAAAAGAGGAAAGTTGG - Intronic
1064744212 10:18463184-18463206 TCTTCTAACAGGAGGGAAGAAGG - Intronic
1065002802 10:21352444-21352466 CCTTATAAGAAGAGGAGACTAGG - Intergenic
1065228703 10:23574576-23574598 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1065620496 10:27576207-27576229 CCTTATAAGAGGTAGGCAGAGGG - Intergenic
1065768568 10:29055206-29055228 ACTCATCAGAAAAGGGAAGAAGG + Intergenic
1065856570 10:29835832-29835854 CCTTAGATGAAGAGAGAATAAGG + Intergenic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066657313 10:37708285-37708307 CCTTATAAGAAAGAGGCAGAGGG + Intergenic
1067203503 10:44194808-44194830 CCTTATAAGAAGAGGATATTAGG - Intergenic
1067244048 10:44521460-44521482 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1067278032 10:44851732-44851754 CCTTGTAAGAAGAGGAGATAAGG - Intergenic
1067408835 10:46047223-46047245 CCTTATCAGAAGAGGAAATTTGG - Intergenic
1067460209 10:46452607-46452629 CCTTATAAGAAGGGGAAATTTGG - Intergenic
1067548421 10:47214415-47214437 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067549045 10:47220416-47220438 CCTTATAAGAAGAGGAGACTGGG + Intergenic
1067626981 10:47931996-47932018 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067658796 10:48218146-48218168 CCTTATAAGAAGAAGAAATTTGG - Intronic
1067914127 10:50377907-50377929 CCTTATAAGACAGGGGCAGAGGG - Intronic
1068731683 10:60365059-60365081 CCATACAAGATGAGGGAAAATGG - Intronic
1069062319 10:63906892-63906914 CCTTATAAGAGGAAGGCAGAAGG + Intergenic
1069268772 10:66497007-66497029 CCTTGCAAGAAGAGGGAATTAGG - Intronic
1069363747 10:67674229-67674251 CCTTCTAAGAAGAGGAAATTAGG + Intronic
1069464044 10:68622265-68622287 CCTTGTCCAAAGAGGGAAGAGGG - Intronic
1069869524 10:71524688-71524710 CCTTATAAGAAGCAGGTAGGAGG + Intronic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1070018447 10:72559243-72559265 CCTCTGAAGAAGATGGAAGATGG + Intronic
1070394709 10:76002184-76002206 CCTCAGAAGAAGAGTGAACAGGG - Intronic
1070489039 10:76958628-76958650 CCTTACAAGAAGAGGAAATTTGG + Intronic
1070548081 10:77468502-77468524 CCTTAGAAGAAGAGGAAATTAGG + Intronic
1070629443 10:78074475-78074497 CCTTATAAGAAGGAGGCAGGAGG + Intergenic
1071381268 10:85062707-85062729 CCTAAAAAGAAGAAGAAAGACGG - Intergenic
1071943936 10:90619486-90619508 CCTTATAAGAGCAGGGCAGGAGG - Intergenic
1072326896 10:94307685-94307707 CCTTATGAGAAGAGGGGATTAGG - Intronic
1072798118 10:98372184-98372206 CCTTATAAAATGAGGGAAGTTGG - Intergenic
1072918263 10:99553826-99553848 CCTCATAAGAAGAGGGGATCGGG - Intergenic
1073545993 10:104349456-104349478 CCTTACAAGAAGAGGAAAATTGG - Intergenic
1073570326 10:104575880-104575902 CCTTATAAGAAGAGGATATTTGG + Intergenic
1073885660 10:108036880-108036902 CCTTATATGAATAAGGCAGAGGG - Intergenic
1074044223 10:109821741-109821763 CCTTAGAGGAACAGGGAAGAGGG + Intergenic
1074578786 10:114696432-114696454 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1074657349 10:115607865-115607887 CCATATACGAAGAAGGAATAGGG - Intronic
1074899907 10:117807031-117807053 CCTTTTAAGAAGAGGGTATTTGG - Intergenic
1074912827 10:117927247-117927269 CCTTATAAGACGGAGGCAGAGGG - Intergenic
1075263971 10:120985144-120985166 GCTTATAAGAAGAGGAAATTTGG - Intergenic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1075955112 10:126516938-126516960 CCTTACAAGAGGGAGGAAGAAGG - Intronic
1076000865 10:126912117-126912139 CCTTGTAAGAAGAGGAAATGAGG - Intronic
1076183119 10:128426111-128426133 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1076299386 10:129413293-129413315 TCATCTCAGAAGAGGGAAGACGG + Intergenic
1076303044 10:129442243-129442265 CCTTATAAAAAGAGGGAGACTGG + Intergenic
1076327507 10:129637723-129637745 CCTTATAAGAAGAGGAGATTAGG + Intronic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1077336368 11:2006675-2006697 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1077527232 11:3074528-3074550 CCTTATAAGAAGAGTGACACAGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078320894 11:10333571-10333593 CCTTATAAGAAGAGGAGATTAGG + Intronic
1078361386 11:10670746-10670768 CCTTATAAGAAGAGGAAATTTGG + Intronic
1078864512 11:15284481-15284503 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1079072248 11:17357338-17357360 CCTTATAAGAAGAGGAAATTAGG - Intronic
1079293039 11:19205800-19205822 CCTTGTAAGAAGAGGAAATTAGG - Intronic
1079448936 11:20582476-20582498 CCTTATGAGAACATGGCAGAAGG + Intergenic
1079590299 11:22175359-22175381 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1079615582 11:22488626-22488648 CCTCATAAGAAGAGACATGAGGG + Intergenic
1079713530 11:23716796-23716818 CCATATAGGAAGAGGAAATATGG + Intergenic
1079875163 11:25847030-25847052 CCTTATAAAATGAGGAAATAAGG - Intergenic
1080051430 11:27862995-27863017 CCTTAGAAGAAGAGGCAATTAGG - Intergenic
1080151052 11:29052371-29052393 CCTCATATGAAGAGGAAAAATGG + Intergenic
1080160670 11:29171408-29171430 CCTTTGAAAAAGAGGAAAGAAGG - Intergenic
1080185779 11:29483706-29483728 CATAATAACAAAAGGGAAGAAGG - Intergenic
1080580413 11:33637751-33637773 CCTTCTAAGAAGAGGAAATTTGG - Intronic
1080931452 11:36815746-36815768 CCTTATAAGAAGACAGAGAAGGG + Intergenic
1080934021 11:36842776-36842798 CCTTATAAGAAAGAGGCAGAGGG - Intergenic
1081205494 11:40270398-40270420 CCTTTTAAGAAGAGGAAATCTGG - Intronic
1081222199 11:40475760-40475782 TCTGATAAGAAGAGGAAAGTTGG - Intronic
1081370940 11:42302239-42302261 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1081584941 11:44377718-44377740 CCTTATAAGAAGAGACACCAGGG + Intergenic
1082781057 11:57287681-57287703 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1082919936 11:58482049-58482071 ACTTATAAGAAGTAGGAAGCTGG + Intergenic
1083396202 11:62393964-62393986 CCTCATAAGAAGAGGGGATTAGG - Intergenic
1083792109 11:64992558-64992580 CCTTATAAGAAGAGGGAAGGAGG + Intronic
1084122249 11:67076502-67076524 CCAAATAAGAGGAGGGAAGTCGG + Intergenic
1084547888 11:69823468-69823490 CCTTATAAGAAGAGGTAATGAGG - Intergenic
1084706983 11:70821243-70821265 CCTTATAAGAAGAGGCGATGAGG + Intronic
1084712725 11:70853900-70853922 CTTTATAAGAAGAAGGAGGGGGG - Intronic
1084724167 11:70929636-70929658 CCTTATAAGAGGAAGGCAGAGGG - Intronic
1086037299 11:82432068-82432090 CCTTATAAGAGAAAGGCAGAGGG + Intergenic
1086184036 11:83991942-83991964 CCTTATAAGAAGAGGAAATTTGG + Intronic
1086428896 11:86716316-86716338 GTTTATACAAAGAGGGAAGAGGG + Intergenic
1086573483 11:88311753-88311775 CCTTATAAGAAGAGGACATTAGG + Intronic
1086738680 11:90340071-90340093 ACTTATAAGAAGAGGAAATTTGG - Intergenic
1086852432 11:91825703-91825725 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1086858569 11:91897175-91897197 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1086926029 11:92641603-92641625 CCTTATAAGAGAAAGGCAGAGGG - Intronic
1086932074 11:92704576-92704598 CCTTATAAGAAGAGGAAATTTGG + Intronic
1087608563 11:100406722-100406744 CCTTATAAGAAGAAGAAATGTGG + Intergenic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1088230951 11:107672700-107672722 CCTTATAAGAAGAGTCAAAGAGG - Intergenic
1088363073 11:109011436-109011458 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088433093 11:109779918-109779940 CCTTATAAGAAGAAGAAATTTGG + Intergenic
1088556931 11:111071265-111071287 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1088698376 11:112389805-112389827 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1088755559 11:112882411-112882433 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1088879364 11:113961518-113961540 CCTTATTAGAGGAAGGCAGAAGG - Intergenic
1089013990 11:115152024-115152046 CCTTATAAGAAGAGGACATTTGG + Intergenic
1089576742 11:119449765-119449787 CCTTATAAGAAGAGGAGATTTGG + Intergenic
1090036187 11:123251753-123251775 CCTTATAAGGAGGGGGAAATTGG + Intergenic
1090285983 11:125499798-125499820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1090396922 11:126425105-126425127 CCTTATGCGGGGAGGGAAGAGGG + Intronic
1090574857 11:128089682-128089704 GCTTATAGTAAAAGGGAAGAAGG - Intergenic
1090634412 11:128681697-128681719 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1090644443 11:128756368-128756390 TCTTATAAGAAGAGGGAATTTGG - Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091071585 11:132569256-132569278 CCTCATAAGAAGAGGAAATTAGG + Intronic
1091118332 11:133035774-133035796 CCTTATAAGAAGAGGACATTTGG + Intronic
1091269829 11:134300268-134300290 CCTTATAAGAAGAGGAGATTAGG - Intronic
1202819352 11_KI270721v1_random:61857-61879 CCTTATAGGAAGAGGAGAGGAGG + Intergenic
1091538769 12:1439810-1439832 CCTAATCTCAAGAGGGAAGAGGG - Intronic
1092071591 12:5635942-5635964 CTTGATAAGTAGAGGCAAGAAGG + Intronic
1092850685 12:12623858-12623880 CCTTATAAGACTAAGGTAGAGGG + Intronic
1093120359 12:15264027-15264049 CCTTATAAAAAGAGGAAATATGG + Intronic
1093378596 12:18461996-18462018 CCTTATAAGAGGGAGGCAGATGG - Intronic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1093830055 12:23744970-23744992 CTTTATAAGAAGAGGAAATTTGG - Intronic
1094080841 12:26533642-26533664 CCCTATAAGAAGAGGAAATTTGG + Intronic
1094083288 12:26561105-26561127 CCTTATAAGAAGAAGGGATTAGG + Intronic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1094277901 12:28699612-28699634 CCTTAAAAGAAGAGAGAACTTGG + Intergenic
1094310127 12:29071157-29071179 CCTTATAAGAACAGTGAAACTGG - Intergenic
1094318521 12:29159171-29159193 GCTAGTTAGAAGAGGGAAGAAGG - Intronic
1094457214 12:30649399-30649421 CCTTATAAGAAATGAGATGATGG - Intronic
1094488267 12:30941910-30941932 ATTTAAAAGAAGTGGGAAGAAGG - Intronic
1094620145 12:32073084-32073106 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1095494733 12:42772499-42772521 CCTTACAAGAAGGAGGCAGAGGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096635986 12:52959947-52959969 CCTTATAAGAAGGAGGCAGAAGG - Intergenic
1096794846 12:54070091-54070113 CCTTATAAGAAGAGATCAGCAGG - Intergenic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1097206368 12:57324934-57324956 CATTATAAGAAGAGGAAATTTGG + Intronic
1097350052 12:58538754-58538776 CCTTCTAAGAAGAAGGTAGTGGG + Intergenic
1098575906 12:72042195-72042217 CCTGTTAAAAAGAGGGAACAAGG + Intronic
1098591450 12:72218765-72218787 CCTTATAAGAAGAAGGGAGAGGG - Intronic
1098815798 12:75160181-75160203 CCTTATAAGAAGAAGAAATTTGG + Intronic
1098936089 12:76480976-76480998 CCTTATAAGAGGAAGCAAGAGGG + Intronic
1098938077 12:76503357-76503379 CCTTATAAGAAGAGGAAATTTGG - Intronic
1099230552 12:80019021-80019043 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1099360170 12:81690937-81690959 CCTTATAAGAAGGAGGCAAAAGG - Intronic
1099507452 12:83497253-83497275 CCTTATAAGAAGGGGACATATGG - Intergenic
1099563010 12:84202895-84202917 CCTTATAAGAAGAGGCACCTTGG - Intergenic
1100068293 12:90678703-90678725 CCTTATAAAAAGAGGAAATTTGG + Intergenic
1100216549 12:92455965-92455987 CCTTATAAGAAAAGGGAATTTGG - Intergenic
1100365088 12:93912936-93912958 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1100366614 12:93927083-93927105 CCTTATAACAAGAGGAAATTGGG + Intergenic
1100408707 12:94293918-94293940 CCTTATAAGAAGAGACACCAGGG - Intronic
1100434062 12:94555484-94555506 CCTTATAAGAAGAGAGGGCATGG - Intergenic
1100442741 12:94631430-94631452 CCTTATAAGAAGAGAAAATCTGG + Intronic
1100615662 12:96229828-96229850 CCTCATAAGAAGAGGAAAATCGG - Intronic
1100857643 12:98772307-98772329 CCTTACAAGAAGAGGAAATTTGG + Intronic
1100930137 12:99599076-99599098 CCTTATAAGAAGGAGACAGAGGG - Intronic
1100939356 12:99708683-99708705 CCTTATAAGAGGGAGGTAGAGGG - Intronic
1101006436 12:100405477-100405499 CCTTATAAAAGGAGGAAGGAGGG + Intronic
1101039854 12:100744466-100744488 CCTTATAATAAGAAGCCAGAGGG - Intronic
1101071642 12:101081863-101081885 CTTTATAAGAAGAGGAAATTTGG - Intronic
1101214472 12:102566838-102566860 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1101319807 12:103663647-103663669 CCTTATAAAAAGAGGAGAGGTGG - Intronic
1101552378 12:105774688-105774710 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1101607248 12:106256998-106257020 CCTTATGAGAAGAGGAAATTTGG - Intronic
1101890704 12:108712274-108712296 CCTTTTAAGAAGATGGAGGCCGG + Intronic
1102159836 12:110759731-110759753 TCTTATAAGAAGAGAGATTAGGG + Intergenic
1102448180 12:113019816-113019838 CCTTATAAGAGGGAGGAAGTGGG - Intergenic
1102598387 12:114010796-114010818 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1102659405 12:114512903-114512925 CCTTTTATGAAGGGGGAAGTAGG - Intergenic
1102663042 12:114546273-114546295 CCTTACAAGAAGAGGAAATCTGG + Intergenic
1102665010 12:114564357-114564379 CCTTACAAGAAGAGGAAATCTGG - Intergenic
1102749322 12:115278448-115278470 CCTTATAAGAAGAGGCAACTAGG - Intergenic
1102919558 12:116781645-116781667 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1102934495 12:116885012-116885034 CCTCATAAGAAGAGGAAATTAGG + Intergenic
1103015750 12:117493403-117493425 TCATATGAGAAGAGGGAAAATGG - Intronic
1103849495 12:123922779-123922801 CCTTATAAGAGGAGGAAATTTGG - Intronic
1103963759 12:124625227-124625249 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1104004588 12:124883040-124883062 CCTTATAAGAAGAGGGACATCGG + Intergenic
1104042555 12:125139960-125139982 CCTCATAAGAGGAAGTAAGATGG - Intronic
1104063961 12:125291135-125291157 CTTTATGAGAAGAGGTTAGAAGG + Intronic
1104211927 12:126697272-126697294 CCTCATAAGAAGAGGAAATTTGG + Intergenic
1104252064 12:127104622-127104644 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1104288286 12:127445389-127445411 ACTTATAAGAAGAGGAGAGTAGG - Intergenic
1104289074 12:127451984-127452006 CATTATAAGAAGGAGGCAGAAGG - Intergenic
1104337786 12:127916556-127916578 CCTTATTAGAAGGAGGAAGGAGG + Intergenic
1104389004 12:128375544-128375566 CCTTATAAAAAGAAAGGAGAGGG - Intronic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1104705292 12:130940830-130940852 CCTTACAAGAAGAGACATGAGGG - Intergenic
1105067876 12:133216190-133216212 CCTTATAAAAAGGGGGAATTTGG + Intergenic
1106219649 13:27735030-27735052 CCTTATAAGAAGAGGAAATGGGG + Intergenic
1106260516 13:28062445-28062467 CCTTATAAGAAGAGGAGGCAGGG + Intronic
1106407976 13:29490400-29490422 TGTTATAATGAGAGGGAAGAGGG - Intronic
1106454556 13:29915854-29915876 CCTTATAAGAAGAGGACATTTGG + Intergenic
1106507261 13:30381978-30382000 CCTCATAAGAAGAGGCAATTAGG - Intergenic
1106531749 13:30599693-30599715 CTTTATAAGAAGAGGAAATTTGG - Intronic
1106588839 13:31080757-31080779 CCTTATAAGAATAGGCAATGTGG + Intergenic
1106625781 13:31419459-31419481 CCTTATAAGAAGAGAGAATTTGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106760466 13:32862586-32862608 CCTGATAAGAAAAGGGAGGCTGG + Intergenic
1107634632 13:42379850-42379872 CCTTATAAGAAGAAGAGATAAGG - Intergenic
1107651135 13:42546385-42546407 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1107778687 13:43875955-43875977 CCTTATAAGAGAAAGGTAGAGGG + Intronic
1107917727 13:45169276-45169298 CCTTATAAGAAAAGGAAATTTGG + Intronic
1107978185 13:45710096-45710118 CCTGAGAAGAAAATGGAAGAAGG - Intronic
1108064343 13:46562475-46562497 CCTTATAAGAAGAGGAAATTTGG - Intronic
1108203362 13:48063447-48063469 CCTTATAAGAAGAGAAAATCTGG + Intronic
1108258444 13:48632849-48632871 CCTTAAAAGAAGAGGAAATTTGG + Intergenic
1108297487 13:49038418-49038440 CCTTATAAGAACAGGAAATTAGG + Intronic
1108299337 13:49058513-49058535 CCTTGTAAGAAGAGGAAATTTGG + Intronic
1108476053 13:50818858-50818880 GCTTATAAGAAGAAGGCAAAGGG - Intronic
1108529605 13:51316652-51316674 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1109376026 13:61494309-61494331 CCTTATAAGAAGAGGAAATCTGG - Intergenic
1109894365 13:68664794-68664816 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1110067984 13:71133128-71133150 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1110326805 13:74225838-74225860 CAGTCTAAGAAGAGGAAAGAGGG + Intergenic
1110441985 13:75536539-75536561 CCTTATAAGAGGGAGGAAAAAGG + Intronic
1110464247 13:75782814-75782836 CCTTATGAGAGGGAGGAAGAGGG - Intronic
1110605528 13:77427569-77427591 CCTTATAAGAAGAGGAGAATAGG - Intergenic
1110865870 13:80395491-80395513 CTTTATAAGAAAAGAGCAGAAGG + Intergenic
1111922932 13:94431317-94431339 CCTTGTGAGAAGAGGAAAGTTGG + Intergenic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1112246521 13:97740090-97740112 TTTTAGAAGAAGAGAGAAGAAGG + Intergenic
1112584795 13:100708773-100708795 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1112766661 13:102752945-102752967 CCTTGTAAGAAGAGGAAATTTGG + Intronic
1112829216 13:103428087-103428109 CCTGATAGGAAGAGGGAATTTGG + Intergenic
1112975678 13:105314604-105314626 CCTTACAAGAAGAGGAAATTTGG + Intergenic
1113508901 13:110836137-110836159 CCTTAAAAAGAGAGGAAAGAAGG + Intergenic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1114340029 14:21733627-21733649 CCTTACAAAAAGGGGGAATATGG - Intergenic
1114404518 14:22443605-22443627 CCTTATAAGAGGAGGAAATTTGG - Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1115049209 14:29035869-29035891 CCTTGTAAGAAGAGGAAATTCGG + Intergenic
1115141878 14:30181314-30181336 ACTTATAAGAAGAGACATGATGG + Intronic
1115268749 14:31527982-31528004 TCTTATAAGAAGAGGAAATCTGG - Intronic
1115306533 14:31939259-31939281 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1116062354 14:39939765-39939787 TCTTATAAGAAGAGGAAATTTGG + Intergenic
1116421314 14:44736083-44736105 CCTTAAAAGAAGAGGAAATCAGG - Intergenic
1116427125 14:44804990-44805012 CCTTATAAAAAGAGGAAATGTGG + Intergenic
1116589804 14:46757570-46757592 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1116870530 14:50065624-50065646 CCTTATAGGAAGAGGAAAATGGG - Intergenic
1117227207 14:53674374-53674396 CCTTACAAGAAGAGAGACCATGG + Intergenic
1117680296 14:58197025-58197047 CCTCAGAAGAAGAGGGAGGCCGG + Intronic
1117868244 14:60171479-60171501 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1117873545 14:60225612-60225634 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1118387492 14:65268383-65268405 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1118421156 14:65605478-65605500 CCTTATAAGAAGGGGTAATTTGG + Intronic
1118616715 14:67579115-67579137 ACTTCTAAAAAGACGGAAGAGGG - Exonic
1118742775 14:68752478-68752500 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1118926289 14:70192696-70192718 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118949490 14:70421257-70421279 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1119109206 14:71955898-71955920 CCCCATAAGAAAAAGGAAGATGG + Intronic
1119153476 14:72387245-72387267 CCTTATAAAAAAAAGGGAGAGGG + Intronic
1119343069 14:73897303-73897325 CTTTAAAGGAACAGGGAAGAAGG + Intronic
1119684799 14:76623058-76623080 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
1119754819 14:77108772-77108794 ACTCAAAAGAAGAGGGAGGAGGG - Intronic
1119925321 14:78488152-78488174 CCTTATAACAAGAGGAAATTTGG - Intronic
1119966062 14:78916948-78916970 CCTTATAAGAAGAGGAAACTTGG - Intronic
1120715633 14:87838081-87838103 CCTTATAAGAAGAGAAAATTAGG + Intronic
1120839082 14:89067365-89067387 CCTTATAAGAAGAGGACATGAGG + Intergenic
1121280013 14:92691360-92691382 CCTTATAAGAAGAGACACCAGGG - Intergenic
1121454468 14:94029523-94029545 CCTTATAAAAAGAGGAAATTAGG - Intronic
1121561958 14:94882501-94882523 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1121716145 14:96077466-96077488 CCTTATAAGAATAGGAAATTAGG + Intronic
1121794872 14:96726413-96726435 CCTTCTAAGAAGGAGGCAGAGGG + Intergenic
1121800417 14:96769693-96769715 CCTTATAAAAAGAGGAAACGTGG - Intergenic
1121880853 14:97499256-97499278 ATTTAGAAGAAGAAGGAAGAAGG + Intergenic
1121944070 14:98102544-98102566 CCTTATAAGACAAAGGCAGAGGG - Intergenic
1122161522 14:99787812-99787834 CCTTATAAGAAGGGGAAATTTGG - Intronic
1122186049 14:99996948-99996970 CCCTATAAAAAGAGGGCAGTAGG - Intronic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122483064 14:102060242-102060264 CCTTATAAGAGAAAGGCAGAAGG + Intergenic
1122837806 14:104438607-104438629 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1122907731 14:104809862-104809884 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1124028863 15:25991067-25991089 CCTTACAAGAAGAGGAAATTTGG - Intergenic
1124242365 15:28039732-28039754 CCTTATAAGAAGAGGAAGTTTGG + Intronic
1124444784 15:29721034-29721056 CCTTTTAAGCAAGGGGAAGAGGG + Intronic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1125033597 15:35097637-35097659 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1125283104 15:38064171-38064193 CCTTATAAGAAGAGGAAATCTGG + Intergenic
1125408995 15:39385010-39385032 CCTTATAAGAAGAAGGGACTAGG + Intergenic
1125427941 15:39568329-39568351 CCTTATAAGATGAGGGGATTTGG - Intergenic
1125517440 15:40330265-40330287 GCTTATAAGAAAAGGGAAAAAGG + Intergenic
1126176650 15:45742187-45742209 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1126382496 15:48063687-48063709 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1127112345 15:55688222-55688244 CCATAAAATAATAGGGAAGAAGG - Intronic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1127263457 15:57343097-57343119 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1127344738 15:58083149-58083171 CCTTATAAGAAGAAGAAATCTGG - Intronic
1127646746 15:60966167-60966189 CCTTATAAGAAGAGGAAATGTGG - Intronic
1127962586 15:63900756-63900778 CCTTCTAAGAAGAGGAAATATGG + Intergenic
1128458738 15:67850017-67850039 CCTTATTAGAAGAGGAAATCTGG + Intergenic
1129241873 15:74256753-74256775 CCTTCCCAGAAGAGGGTAGAAGG + Intronic
1129542127 15:76359000-76359022 CTTTATAAAATGAGGGTAGATGG + Intronic
1130189721 15:81722171-81722193 CCTTATAAGGAGAGGAAATATGG + Intergenic
1130222294 15:82029902-82029924 CCTTATAAGAAGTGGAAATCTGG + Intergenic
1130303224 15:82696079-82696101 CTTTATAAGAAGAGGAAATTTGG - Intronic
1130698600 15:86156379-86156401 CCTTATAAGAAGGGAGAATTTGG - Intronic
1130832148 15:87611888-87611910 TCTTATAAGAAGAGGCATGTTGG - Intergenic
1130905524 15:88238033-88238055 CCTTATAAGAAGAGGAGATTAGG + Intronic
1131327261 15:91459883-91459905 CCTTATAAGAGGAGGGGATCAGG - Intergenic
1131510324 15:93046212-93046234 CTTTATAAGAAGGAGGCAGAGGG + Intronic
1131751371 15:95511361-95511383 CCTTATAAGAAAAGACCAGAGGG + Intergenic
1131902533 15:97104035-97104057 GGTTATATGTAGAGGGAAGATGG + Intergenic
1132179792 15:99743656-99743678 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1132331420 15:101014708-101014730 CCTTATAAGAAGAGGAGATTAGG - Intronic
1133361349 16:5176352-5176374 CCTTATAGGAAGAGGAGAGTAGG + Intergenic
1133426366 16:5693775-5693797 ACTTATAAGAAGGGAGAGGAAGG - Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133703266 16:8329241-8329263 CTTTATAGGAGGAGGGGAGATGG + Intergenic
1133849512 16:9488883-9488905 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1133856106 16:9550719-9550741 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1133877983 16:9752694-9752716 CCTTATGGCAAGAGGGAAAAGGG - Intergenic
1133977180 16:10607551-10607573 CCTTATGAGAAGAGGAAATCTGG + Intergenic
1134077340 16:11301059-11301081 CCTTCTAAGAAGAGGTAATGGGG - Intronic
1134299951 16:12981805-12981827 CCTTATAAGAAGAGGAGATTAGG + Intronic
1134318204 16:13139281-13139303 AGTTAAAAAAAGAGGGAAGAAGG - Intronic
1134527583 16:14956308-14956330 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1134775853 16:16852823-16852845 CCTTATAAGAAGAGGATATTTGG + Intergenic
1135060932 16:19270814-19270836 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1135289821 16:21225702-21225724 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1135408249 16:22213833-22213855 CCTTATAAAAAGGAGGTAGAAGG - Intronic
1135519052 16:23159468-23159490 CCTTATAAGAAGAGAGATTGGGG - Intergenic
1136014431 16:27386303-27386325 CCTTATAAGAAGAGACACCAGGG - Intergenic
1137513611 16:49123303-49123325 CCTTATAAGAAGAGGAGACTTGG - Intergenic
1137539205 16:49350381-49350403 CCTTATGAGAAGAGGAAAAGGGG + Intergenic
1137573777 16:49584726-49584748 CCTCATAAGAAGAGGAAAATTGG - Intronic
1137664542 16:50242026-50242048 TCTAATTAGAAAAGGGAAGAAGG - Intergenic
1138010868 16:53378666-53378688 CCTTTTTAGAAAAGGGAAAATGG + Intergenic
1138145958 16:54612067-54612089 CCTTAGAAGAAGAGGAAATTAGG + Intergenic
1138710219 16:58962584-58962606 CCAGATAGGAAGAGAGAAGAGGG - Intergenic
1138785994 16:59847352-59847374 CCTTATGAGAAGAGGAAATTTGG - Intergenic
1138951080 16:61914041-61914063 CTTTATAAGAAGAGGTAATTTGG + Intronic
1139280294 16:65764774-65764796 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1139350213 16:66330238-66330260 CCTTAAAAGAAGAGGAAGGCCGG - Intergenic
1140350589 16:74258404-74258426 TCTTACAAGAAGAGGGAATTTGG + Intergenic
1140774841 16:78240176-78240198 CCTCATGAGAAGAGGAAAGCAGG + Intronic
1140826683 16:78713575-78713597 CCTTATAAAAAGAGGAAATTTGG + Intronic
1140837822 16:78811670-78811692 CCTTATAAGAAGAGGACAAGGGG - Intronic
1141170944 16:81691303-81691325 CCTTAGAAGAAGAGGAAACACGG - Intronic
1141276580 16:82593848-82593870 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1141277784 16:82603836-82603858 CCTTCTAAGAAGGAGGAAAAGGG + Intergenic
1141650725 16:85391599-85391621 CCTTATAAAAAGAGGGGAATTGG - Intergenic
1141778243 16:86138728-86138750 CCTTATAAGAAGAGGACAAGAGG - Intergenic
1141821196 16:86447216-86447238 CCTTATAAAAAGAGGAAAATTGG - Intergenic
1141837060 16:86548198-86548220 TATTGTAAGAAAAGGGAAGACGG - Intronic
1142112158 16:88338709-88338731 CCTTATCAGAAGGGGGGATATGG + Intergenic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143297512 17:5882592-5882614 CCTTATAAGACGGGGGCAGAGGG - Intronic
1143310594 17:5985381-5985403 CCTTATAAGAAGAGGAAATTTGG + Intronic
1143366362 17:6411172-6411194 CCTTATAAGACGGAGGCAGAAGG + Intronic
1143771955 17:9174625-9174647 CCTTATTAGAAGAGGGCATCGGG - Intronic
1143823399 17:9584101-9584123 CCTGGTAAGAACAGGGCAGATGG - Intronic
1143896911 17:10143628-10143650 CCTTATAAGAAGAGGAAATTAGG + Intronic
1144169038 17:12640920-12640942 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144749604 17:17639326-17639348 CTTTATAAGAATGGGGAAGCAGG + Intergenic
1144772094 17:17765657-17765679 CCGTTTCACAAGAGGGAAGACGG + Intronic
1145054924 17:19696149-19696171 CCTTATTAAAAGAGGGAATTTGG + Intronic
1145105036 17:20108024-20108046 CCTTTTAACAAGAGGGATGACGG - Intronic
1145950289 17:28812139-28812161 CCTTGTAAGAAAAGGGGAAATGG - Intronic
1146226249 17:31068946-31068968 CCTTATAAGAGGGGGCAGGAGGG + Intergenic
1146315042 17:31800215-31800237 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1147035694 17:37678650-37678672 CCTTATAAGAGGGAGGAAGAGGG + Intergenic
1148972778 17:51498818-51498840 CCTCTTAATAAGAAGGAAGAGGG - Intergenic
1148994946 17:51701285-51701307 CCTTATGAGAAGAGGGAAATTGG - Intronic
1149388117 17:56162485-56162507 CCTTATAACAAGAGGAAATGTGG - Intronic
1150050261 17:61955168-61955190 TCTTATAAGAAGGAGGCAGAAGG - Intronic
1150920948 17:69481710-69481732 CCTTATATGAAGAGGAAATTTGG - Intronic
1151080456 17:71323442-71323464 CGTTATAAGAAGAGGACAGTGGG + Intergenic
1151114797 17:71723878-71723900 CCTTATAAGAAGATAAGAGATGG + Intergenic
1151271844 17:73002918-73002940 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1151385302 17:73751685-73751707 CCTTATAAGAAGAGGATATGTGG - Intergenic
1151903169 17:77030923-77030945 CCTCATAAGAAGAGGAAATTAGG + Intergenic
1151998753 17:77631376-77631398 CTTTATATTAAGAGGGAAAAAGG + Intergenic
1153018350 18:604869-604891 CCTTATACGAACAGGGAACTCGG - Intronic
1153237150 18:2999293-2999315 CCTTATAAAAAGAGGAAATCTGG + Intronic
1153415460 18:4841128-4841150 CATTATAAAAAGAGACAAGAAGG - Intergenic
1153663717 18:7349589-7349611 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1154055540 18:11009805-11009827 CCTTGTAAGAAGAGGAGAGTAGG + Intronic
1154088095 18:11327064-11327086 CCTTATAAGAAGGAGGCAAAAGG + Intergenic
1154129608 18:11725276-11725298 CCTTATAAGAAGAGGAGATTAGG + Intronic
1155318410 18:24594831-24594853 TCCTATAAGAAGAGGGAATTTGG + Intergenic
1155326529 18:24670500-24670522 CCTTATAAGAAGAGGAAACTTGG + Intergenic
1155337937 18:24784489-24784511 CCTTATAAGAAGAGGTGATAAGG - Intergenic
1155491128 18:26402990-26403012 CCTTATAAGAGGAGGAGATAAGG + Intergenic
1156093088 18:33494819-33494841 CCTTATAAGAAGCAGGCAGAGGG - Intergenic
1156253177 18:35371611-35371633 CTTTATAAGAAGAGGAAGAAAGG - Intronic
1156617928 18:38810080-38810102 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1157017563 18:43735665-43735687 CCATATAAGAACATGTAAGAAGG - Intergenic
1157145090 18:45154328-45154350 CCTTATAAGAAAAGAAAATATGG - Intergenic
1157245097 18:46046636-46046658 GCTTATAAGAAGAAGAAAGCAGG + Intronic
1157872840 18:51246383-51246405 CTTTATAAGAAGAGGAAGGCCGG + Intergenic
1157883055 18:51340592-51340614 CCTTAGAAGAAGAGGAAATGTGG - Intergenic
1157932137 18:51834761-51834783 CCCTATATGAAGAGGGCAAAAGG - Intergenic
1158274669 18:55754455-55754477 CCTTACAAGAAGAGGAAATTTGG + Intergenic
1158492012 18:57918601-57918623 CCTTACAAGAGGAGGGCAGAGGG - Intergenic
1158518265 18:58148625-58148647 CCTTCTAAGAAGAGGAAATTTGG - Intronic
1158623795 18:59054786-59054808 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1158696521 18:59708845-59708867 CCCTATAAGAAGAAGGAAGGTGG - Intergenic
1158747486 18:60218193-60218215 CCTTTTAAGAAGAGGAAATCTGG + Intergenic
1158839401 18:61367936-61367958 CCTTATAAGAAGAGGACATTTGG - Intronic
1159150538 18:64517641-64517663 CCTCATAAGAAGAGGGGATTGGG - Intergenic
1159274681 18:66201498-66201520 TCTAAAAAGAAGAGGTAAGAAGG - Intergenic
1159320921 18:66846822-66846844 CCTTATAAAAAGAGTTAGGAAGG + Intergenic
1160417300 18:78720322-78720344 CCTTATAGAAAGAGGTAAGTTGG - Intergenic
1161863739 19:6818701-6818723 CCTTATAAGAAGAGTAAACTAGG + Intronic
1162706866 19:12561597-12561619 CCTTATAAGAAGAGACACCAGGG + Intronic
1163037122 19:14576734-14576756 CGTGATAATAAAAGGGAAGATGG + Intergenic
1164500342 19:28814455-28814477 CTTTATAAGAAGAGGAGAGAGGG - Intergenic
1164787544 19:30945521-30945543 GCAAAAAAGAAGAGGGAAGAGGG - Intergenic
1164890729 19:31821095-31821117 CCTTCTAAGAAGAGGAAAGCTGG - Intergenic
1166441000 19:42815338-42815360 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166459447 19:42973304-42973326 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166460474 19:42983944-42983966 CCTTATAAGAAGAGGAGATGAGG + Intronic
1166476769 19:43133349-43133371 CCTTATAAGAAGAGGAGATGAGG - Intronic
1166581516 19:43904024-43904046 CCTTATAAGAAGAGGAGATCAGG + Intergenic
1166657009 19:44619744-44619766 CCTTATAAGAAGAGGAAGTTTGG - Intronic
1166919050 19:46216031-46216053 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1167009622 19:46798556-46798578 CCTTATAAGAGAGGGGCAGAAGG - Intergenic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1167188751 19:47967609-47967631 CCTTATAAGAAGAGAAAATTTGG - Intergenic
1167230788 19:48281823-48281845 CCTTATAAGAAGAGGAAATCTGG - Intronic
1167582756 19:50356126-50356148 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1167794338 19:51699660-51699682 CCTTATGAGAAGAGGAAATTAGG - Intergenic
1168325041 19:55534248-55534270 CCTTATAAGAAGAGGAGATCAGG + Intronic
1168366813 19:55795264-55795286 CCTTTCAAGAAGGTGGAAGACGG - Intronic
1168497831 19:56869127-56869149 CCTTCTGACAACAGGGAAGAAGG + Intergenic
1168514750 19:57002023-57002045 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1168526077 19:57089828-57089850 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1168588925 19:57616734-57616756 CCTCACAAGAGGAGGGAAGCTGG - Intronic
1202698846 1_KI270712v1_random:147548-147570 CTTTATAACAAGAGGAGAGAAGG + Intergenic
925055053 2:850919-850941 CCTTATAAGAAGAGGAGATGAGG - Intergenic
925062067 2:899794-899816 CCTTATAAGAAGAGGAAATGAGG - Intergenic
925522010 2:4757300-4757322 CGTCAGAGGAAGAGGGAAGAAGG - Intergenic
925550590 2:5069837-5069859 CTTTATAAGAAGAGGGGATGAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925916297 2:8609019-8609041 CCTTATAAAAAGAGGGAGAGAGG - Intergenic
926149046 2:10414498-10414520 CCTTATAAGAAGAGGAGATGAGG - Intronic
926366659 2:12139618-12139640 CCCTTTAAGAAGAGGGGACAGGG - Intergenic
926614127 2:14978121-14978143 TTTTATAAGAAGAGAAAAGAAGG - Intergenic
926689602 2:15724381-15724403 CCTTATAAGAAGAGGAAATTTGG - Intronic
926708103 2:15850908-15850930 CCTTATAAAAAGGGGGAATTTGG + Intergenic
926809410 2:16743115-16743137 CCTTATAAGAAAAGAGAATTAGG + Intergenic
926814236 2:16784476-16784498 CCTTATAAGAAGAAGAAACGTGG + Intergenic
926820996 2:16851735-16851757 CCTTATAAGAGGCAGGCAGAAGG - Intergenic
926966780 2:18423614-18423636 TCTTATAAGAAGAGGAAATGAGG - Intergenic
926979738 2:18555735-18555757 CCTTACATGAAGACTGAAGATGG - Exonic
927382499 2:22495296-22495318 CCTTTTAAGAAGAGGAAATTTGG + Intergenic
927435858 2:23065548-23065570 CCTTATAAGAAGAGGAGATGAGG + Intergenic
927460916 2:23297606-23297628 CCTTATAAGCAGAGGGGATTAGG - Intergenic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928066102 2:28166021-28166043 CCTTATAATAAGAGGAAATTAGG + Intronic
928091848 2:28379414-28379436 CCTTATAAGAGTGGGGTAGAGGG - Intergenic
928288746 2:30018421-30018443 TCAAATAAGAAGAGGAAAGATGG + Intergenic
928613280 2:33011479-33011501 TCTTATAAGAAGAGGCAATTTGG + Intronic
928784189 2:34862236-34862258 TCTTATAAGAAGAGGAAATTTGG - Intergenic
928825958 2:35421245-35421267 CTTTATAAGCAGAGGAAATATGG - Intergenic
928892067 2:36215892-36215914 CCTTATGAGAAGAGGAAATCGGG + Intergenic
929007408 2:37409604-37409626 CCTTATAAGAAGACGAAATTTGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
929373028 2:41249934-41249956 CCTTATAAGAAGAAAAAATATGG + Intergenic
929470078 2:42182918-42182940 CCTTATAAGAAGAGGAAATCTGG - Intronic
929861242 2:45679672-45679694 ACTTACAAGAAGAGGGGATATGG + Intronic
930149474 2:48044034-48044056 CCTTATAAGAAGAGGAGAAAAGG - Intergenic
930285620 2:49424087-49424109 CCTTATAAAAAGGGGGAATTTGG + Intergenic
930322462 2:49873853-49873875 CCTTATAAGAAAGAGGCAGAAGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
931120331 2:59210627-59210649 CCTTATAAAAAGAGGAAATTTGG - Intergenic
932225954 2:70040934-70040956 GCTTATAGGAAGTGGGAAGAGGG - Intergenic
932484074 2:72070632-72070654 CCTTATAAGAGGCAGGCAGAGGG + Intergenic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
932808256 2:74801339-74801361 CCTTATAAGAAGAGGAAATTTGG + Intergenic
933500841 2:83109316-83109338 CCTTATAAGAAGGAGACAGAGGG - Intergenic
933884982 2:86711093-86711115 CCTGTGAAGAAGAAGGAAGAAGG - Intronic
934122556 2:88854206-88854228 CCTTATAAGAAGAAGGAGATTGG - Intergenic
934169794 2:89531024-89531046 CTTTATAACAAGAGGAGAGAAGG + Intergenic
934280096 2:91605332-91605354 CTTTATAACAAGAGGAGAGAAGG + Intergenic
934575128 2:95395389-95395411 CCTTATAAGGAGAGGAAATTAGG + Intergenic
935095631 2:99941708-99941730 CCTGATAGGAAGGAGGAAGAAGG - Intronic
935237991 2:101153765-101153787 CCTTATAAAAAGAGGAAATTTGG + Intronic
935527590 2:104190161-104190183 TATTATAAGAAGAGGGTTGAAGG - Intergenic
935609502 2:105006314-105006336 CCTTATAAGAAGAGGAGATTAGG - Intergenic
935633005 2:105227398-105227420 CCTTACAAGAAAAGGAAAGGAGG + Intergenic
935796382 2:106645252-106645274 CCTTATAAGAGGAGGAAATTTGG - Intergenic
936140531 2:109936184-109936206 CCTTATTAGAAGAGGAAACTTGG + Intergenic
936177222 2:110234129-110234151 CCTTATTAGAAGAGGAAACTTGG + Intergenic
936204163 2:110435302-110435324 CCTTATTAGAAGAGGAAACTTGG - Exonic
936822010 2:116533355-116533377 CTTTATAAGAAGAGGAAATTTGG - Intergenic
937014058 2:118587462-118587484 CCTCATAAGAAGAGGAAATCTGG + Intergenic
937080901 2:119139008-119139030 CCTTATAAGAAGGAGGCAGCGGG - Intergenic
937086664 2:119176360-119176382 CCTTATAAGAAGAGGTGATTAGG - Intergenic
937256490 2:120559799-120559821 CCTTATAAGAAGAGGACATTTGG - Intergenic
938978637 2:136504544-136504566 CCTTATAAGAAGAGAAAATCTGG - Intergenic
939801676 2:146719157-146719179 CCTTATAAGAAAAGGAAATTTGG - Intergenic
939843408 2:147215695-147215717 CCTTATAAAAAGAGGGAATTTGG + Intergenic
939857600 2:147378646-147378668 CCTGATAAGAAGAGGAAATTAGG + Intergenic
940073661 2:149717446-149717468 CCTTATAAGAAGATGAAATTAGG - Intergenic
940628854 2:156211972-156211994 CCTTATAAGATGAGTTAGGAAGG + Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
940991260 2:160098943-160098965 CCTTATAAGAAGAGGAGATTAGG - Intergenic
941007321 2:160261423-160261445 CCTTATAAGAAGAGGAAATTTGG - Intronic
941238468 2:163006587-163006609 CCTTATAAGAAGAGGAAATATGG - Intergenic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
941254504 2:163211669-163211691 CCATATAAGAAGAGGAAATCTGG - Intergenic
941805556 2:169708560-169708582 CCTTATAAGAAAGGGGCAGAGGG - Intronic
941956390 2:171209711-171209733 CCTTATAAGAAGAGGAAATTTGG + Intronic
941984814 2:171499968-171499990 CCTTATAAGAAGAGGAGATTGGG - Intergenic
942068030 2:172290250-172290272 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270063 2:174265595-174265617 CCTTATAAGAAGAGGAAATTTGG - Intergenic
942270439 2:174268872-174268894 CCTTATAAGAAGAGGAGATTAGG + Intergenic
942389415 2:175476667-175476689 CCTTATAAGAAGAGGCGATTAGG - Intergenic
942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG + Intronic
942934708 2:181541185-181541207 CCTTATAAGAAGAGGAAATTTGG + Intronic
943138957 2:183954021-183954043 TCTGATTAGAAGAGGGAAAATGG - Intergenic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
944150134 2:196548884-196548906 CCTTATAAAAAGGGGAAATATGG - Intronic
944191621 2:197009985-197010007 CCCTTTAAAAAGAAGGAAGAAGG + Intronic
944311946 2:198243429-198243451 CCTTATAAGAAGAGGAAATTAGG - Intronic
944914971 2:204350341-204350363 CCTTATATGAAGAGGAAGGCAGG - Intergenic
945175334 2:207038038-207038060 CCTTATAAAAAGAGGAAATTTGG + Intergenic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
946007676 2:216539424-216539446 CCTTGAAAGAAGAGGGAATTTGG - Intronic
946136080 2:217648288-217648310 CCTTATAAGAAGAGGAAATTTGG - Intronic
946231150 2:218292045-218292067 GCTGGTGAGAAGAGGGAAGAGGG - Intronic
946467593 2:219925788-219925810 CCTTGTAAGAAGAAGAAAGTTGG + Intergenic
946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG + Intergenic
947029716 2:225780188-225780210 CCTTATAAGAAAAAGTCAGAAGG - Intergenic
947521093 2:230846654-230846676 CCTTATAAGAAGAGGAGATTCGG - Intergenic
947597469 2:231422287-231422309 CTTTATAAGAAGAGGAAATTTGG - Intergenic
947813246 2:233018433-233018455 CCTTATAAGAAGAGAAAATTAGG - Intergenic
947844272 2:233231693-233231715 CTTTATAAGAAGAGGAAGAAAGG - Intronic
947862399 2:233369950-233369972 CCTTATAGAATGATGGAAGAGGG + Intronic
947943933 2:234083568-234083590 CCTTATAAGAAGAGGAAGAGGGG - Intergenic
947955307 2:234184724-234184746 CCTTACAAGAAGAAGGAAATTGG + Intergenic
947979052 2:234393306-234393328 CCTTGTAAGAGGGAGGAAGAGGG - Intergenic
948075229 2:235160688-235160710 CCTTATAGGAGGAGGGAGGCAGG - Intergenic
948355704 2:237375236-237375258 CCTTATAAGAGGGGGTAAGAGGG + Intronic
948524832 2:238565046-238565068 CCTTATAGGAAGAGGAAATTGGG + Intergenic
948790248 2:240373071-240373093 CCTTGTAAGAAGAGGCCAGAGGG - Intergenic
949061104 2:241957905-241957927 CCTTATAAGAGAAAGGAAGAGGG - Intergenic
1168937442 20:1678208-1678230 CCTTATAAGAAGGAGGAGGCAGG - Intergenic
1169071003 20:2730380-2730402 CCTTATAACAATAGGATAGAGGG - Intronic
1169489965 20:6063058-6063080 TCTTATAAGAGGGAGGAAGAGGG + Intergenic
1169524973 20:6414464-6414486 ATTTCTAAGAAAAGGGAAGAAGG + Intergenic
1169696272 20:8390313-8390335 CCTTATTAGAAGAGGAAATTAGG - Intronic
1169815906 20:9655898-9655920 CCTTATAAGAAAAGGAAACTTGG - Intronic
1170073376 20:12392724-12392746 CATTATAAGAAGAGGAAATGTGG + Intergenic
1170111620 20:12809846-12809868 CCTCATCAGATGAAGGAAGAAGG + Intergenic
1170131728 20:13027575-13027597 CCTCATAAGAACAGGAAGGAAGG + Intronic
1170167031 20:13370744-13370766 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1170380778 20:15757779-15757801 CCTTATAAGAAGAGGAAGAGAGG - Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170498292 20:16948281-16948303 CCTTATAAGGAGAGGAAATTAGG + Intergenic
1170534092 20:17323252-17323274 CCTTATAAGAAGAGGAGATTAGG + Intronic
1170753174 20:19170805-19170827 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1170804586 20:19618433-19618455 CCTTATAAGAACAGGAAATTAGG - Intronic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1172341446 20:34161180-34161202 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1172475899 20:35237413-35237435 CCTTATAAGAGGAAGGCAGGGGG - Intronic
1172909835 20:38399798-38399820 CCTTATAAGAACAGGAAATCTGG + Intergenic
1172911948 20:38416099-38416121 CCTTATAAGAAGAGACACCAGGG + Intergenic
1173019467 20:39255109-39255131 TCTTATAAGAAGAGGAAAATAGG - Intergenic
1173042286 20:39475662-39475684 CCTTATAAGAAGAGGAAAAGTGG - Intergenic
1173254519 20:41384696-41384718 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1173983471 20:47242462-47242484 CCTTCTAAGAGGAGGGCAGGGGG + Intronic
1174062633 20:47843476-47843498 CTTTATAAGAGGAGGGCAGGAGG + Intergenic
1174075652 20:47934146-47934168 CCTTATAAGAGGACGGAAGGAGG - Intergenic
1174435758 20:50505631-50505653 CCTTGTAGGAACAGGGCAGAGGG + Intergenic
1174633391 20:51978035-51978057 CCTTATAAGAAGAGAAGACATGG + Intergenic
1174703590 20:52634166-52634188 CCTTATAAGAAGAGAGACCCAGG + Intergenic
1174883943 20:54310860-54310882 CCTTATAAGAAGAGGAGATAAGG - Intergenic
1174921969 20:54713028-54713050 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175287732 20:57848977-57848999 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1175666074 20:60861136-60861158 GCTTATAAAAAGAGGGAATCGGG + Intergenic
1175687502 20:61042207-61042229 CCTTATAAGAAGAGAAAATTAGG + Intergenic
1176342663 21:5713219-5713241 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176474917 21:7145370-7145392 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176502164 21:7611237-7611259 CCTTATAAAAGAAGGGAGGAGGG - Intergenic
1176536984 21:8111288-8111310 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176900266 21:14432808-14432830 CCTTGTAATAAGAGGGAATTTGG + Intergenic
1176975870 21:15321185-15321207 GCTGAAAAGAAGAGGGGAGAGGG - Intergenic
1177189119 21:17830040-17830062 CCTATTCAGAAAAGGGAAGAAGG + Intergenic
1177207386 21:18025850-18025872 CCTTATAAGAACAGGAAATTTGG - Intronic
1177210638 21:18066803-18066825 CCTTATAAGAAGACGAAATTTGG + Intronic
1177298078 21:19202783-19202805 TCTTATAAAAAGAGGGAATTGGG + Intergenic
1177312711 21:19418205-19418227 CCTTATAAGAAAAGGAAAGTAGG + Intergenic
1177442115 21:21139132-21139154 CTTTATAAGAAAAAGGCAGAGGG + Intronic
1177603857 21:23353979-23354001 CATTGTAAGAAGAGCCAAGAGGG - Intergenic
1177696004 21:24571932-24571954 CCTTATAAGAAGAGAAAAATAGG + Intergenic
1177853528 21:26376875-26376897 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1178316286 21:31569355-31569377 CCTTATAAGAAGAGGAAGTTTGG - Intergenic
1178355154 21:31905150-31905172 CTTTATAAGAAGAGGAAATTTGG + Intronic
1178368782 21:32009886-32009908 CCTTATAAGAAGGGGAAATTGGG + Intronic
1178596142 21:33954621-33954643 CCTTATAAGAAGAGACACCAGGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1178637340 21:34315805-34315827 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1178642357 21:34355349-34355371 CCTTATAAGAAGCAGGCAGGGGG + Intergenic
1178763122 21:35423029-35423051 CCTTATAAAAAGAGGAAATTTGG + Intronic
1178846101 21:36175410-36175432 CCTTGTAAGAAGAGGAAATCTGG - Intronic
1178898343 21:36579136-36579158 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1179019881 21:37629538-37629560 CCTTATAAGAAGAGGAAATTAGG + Intronic
1179112718 21:38461289-38461311 CCTTATAAAAAGAGGTAATTTGG - Intronic
1179119297 21:38528172-38528194 CCTTATGAGAAGAGGAAATTTGG - Intronic
1179153980 21:38833596-38833618 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1179186597 21:39089706-39089728 CCTTATAAGAAGAGGGGATTAGG + Intergenic
1179285610 21:39975130-39975152 CCCTATAAGAGGAGGGTGGAGGG - Intergenic
1179363132 21:40731635-40731657 CCTTATAAGAAGAGGAAATTAGG - Intronic
1179364096 21:40739546-40739568 CCTTATAAGAAGAGGAGATTAGG - Intronic
1179430837 21:41319966-41319988 CCTTATAAGAAGAGGAGATGAGG + Intronic
1179563349 21:42231143-42231165 CCTGGTGAGAAGAGGGAAGCTGG - Intronic
1179593669 21:42428044-42428066 CCTTATAAGAAGAGGGGATGAGG + Intronic
1179708939 21:43200735-43200757 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1180057916 21:45368539-45368561 ACTTAGAAGAGGAGAGAAGAGGG + Intergenic
1180911247 22:19452275-19452297 CCTTTTAAGAAGAGGAAATTTGG - Intronic
1181078536 22:20397936-20397958 CCTCATAAGAAGAGGAAATTTGG - Intronic
1181384447 22:22533609-22533631 CCTTATAAGAGGAGGAAACATGG + Intergenic
1181878366 22:25957800-25957822 CCTTATAAGAAAAAGGCAGAGGG - Intronic
1181967370 22:26666669-26666691 CCTTAAAAGGTGAGGGGAGAAGG - Intergenic
1181988471 22:26818565-26818587 CTTTATAAGAAGCAGGCAGAGGG + Intergenic
1182096442 22:27629214-27629236 CCTTATAAGAGGAAGGCAGGAGG - Intergenic
1182191890 22:28469543-28469565 CCTTATAAGAGGGAGGCAGAGGG + Intronic
1182240900 22:28915311-28915333 CCTTATAAGAAGAGAAAATTTGG - Intronic
1182677143 22:32048247-32048269 ACACAGAAGAAGAGGGAAGATGG + Intronic
1182768235 22:32774319-32774341 CCTCATAAGAAGAGGAAATTTGG + Intronic
1182892868 22:33833412-33833434 CCTTATAAGAAGAGGAGATAAGG + Intronic
1182910300 22:33978656-33978678 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1183128678 22:35811386-35811408 CCTTATAAGAAAAGGGAATGTGG + Intronic
1183868179 22:40720739-40720761 CCTTATAAGAAGTGGGAGGCCGG - Intergenic
1184304530 22:43587603-43587625 CCTTATAAGAGGGAGGCAGAGGG - Intronic
1184413121 22:44337268-44337290 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1184417677 22:44361702-44361724 CCTTATAAGAAGAGGAGACTGGG + Intergenic
1184464953 22:44663527-44663549 CCTTATAAGAGGTGGGCAGGAGG - Intergenic
1184509412 22:44924522-44924544 TCTTATAAGAAGAGACACGAGGG + Intronic
1184622630 22:45693753-45693775 CCTTATAGGAAGAGGAAATTAGG + Intronic
1184674038 22:46030639-46030661 GCTTATGAGAATAGAGAAGAGGG + Intergenic
1185208828 22:49555329-49555351 CCTTATAAAAAGAAGGAAACTGG + Intronic
1203241935 22_KI270733v1_random:27692-27714 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949306415 3:2646818-2646840 CCTTATAAGAAGAGGAAATTTGG - Intronic
949760681 3:7467057-7467079 CCTTCTCAGAAGGAGGAAGAGGG - Intronic
949840483 3:8314658-8314680 CCTTACAAGAAGAGGGAATTTGG + Intergenic
950327904 3:12129930-12129952 CCTCATAAGAAGAGAGACCACGG + Intronic
950445290 3:13033975-13033997 CCTTATAAGAAAAGGAAATTGGG - Intronic
950458887 3:13109302-13109324 TCTTAAAAGAAGAGAGATGAAGG + Intergenic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
950799027 3:15534462-15534484 CCTTATAAGAGGAGGCAATTTGG - Intergenic
950882533 3:16334872-16334894 CCTTATAAGGACAGGCAGGAAGG + Intronic
951145222 3:19218866-19218888 CCTTATAAAAAGAGGAAATTTGG - Intronic
951172766 3:19561536-19561558 CCTTATAAGAAAGAGGAAAAAGG + Intergenic
951409744 3:22348345-22348367 CCTTATAAGAAGGGGAAAGTAGG + Intronic
951531027 3:23698227-23698249 CCTTATAAGAAGAGGAAATTTGG + Intergenic
951657547 3:25026517-25026539 CCTTATAAGAATAGGAAATTTGG - Intergenic
952126228 3:30304214-30304236 CCTTGTAAGATGGCGGAAGAGGG - Intergenic
952710861 3:36430834-36430856 CCTTGTAAGAAGAGGAAATTTGG - Intronic
952780447 3:37092177-37092199 CCTTATAAGAAAAGTGAAACAGG + Intronic
952928139 3:38336857-38336879 CCTTATAAGAAGAGGAAAATTGG - Intergenic
953236697 3:41113306-41113328 CCTTATAAGAAGAGGAGATTAGG + Intergenic
953679714 3:45030180-45030202 ACTAATAAGATGAGGGCAGAAGG - Intronic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
955081893 3:55665488-55665510 CCTTATAAGAAGGGGAAATTTGG + Intronic
955167802 3:56531635-56531657 CCTTATAAGAAGAGGAAATTTGG - Intergenic
955168217 3:56536223-56536245 CCTTTTAAGAAGAGGAAATTTGG - Intergenic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
955892875 3:63668759-63668781 CTTTATAAGAAAGGGGGAGAGGG + Intronic
956152931 3:66262142-66262164 TCTTATATGAAGAGGTGAGATGG + Exonic
956174539 3:66460522-66460544 CTTTATAAGAAGAGGAAATCTGG + Intronic
956568734 3:70670247-70670269 CCTTATAAGAAGAGGAAATATGG - Intergenic
956811976 3:72872320-72872342 CCTTACAAGAAGAGGAAAGGAGG - Intergenic
956932749 3:74064042-74064064 CCTTATAAGAAGAGGAAGATTGG - Intergenic
957245498 3:77711359-77711381 CTTTATAAGAAAAAGGCAGAGGG - Intergenic
957286073 3:78219096-78219118 CCTTGTAAAAAGAGGGAAAAGGG - Intergenic
957449534 3:80360470-80360492 CCTTTTCAGAGGAGGGTAGAGGG + Intergenic
957589725 3:82180403-82180425 CCTTATAAAAAGAGGAAATTCGG - Intergenic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
957748920 3:84386145-84386167 CCTGATAAGAATAAGGAAGTAGG + Intergenic
957872241 3:86104274-86104296 ACTAATAAAAAGAGGGAAGAGGG - Intergenic
958114008 3:89190840-89190862 CCTTATAAGAAGAGGAAATTTGG - Intronic
958567243 3:95830074-95830096 CCTTATAAGAAGAGGAAATGTGG + Intergenic
958790678 3:98647480-98647502 CCTTATAAGAAGAGGAAATCTGG - Intergenic
958834653 3:99130675-99130697 CCTTATAAAAAGGGGAAAGTAGG - Intergenic
958860433 3:99438660-99438682 CCTTAAAAGAAGAGGAAATTAGG + Intergenic
958979570 3:100705668-100705690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
959145842 3:102543473-102543495 CCATATATAAAGAGAGAAGATGG - Intergenic
959784189 3:110273839-110273861 CCTTATAAGAAGAGACACCAGGG - Intergenic
960012222 3:112846780-112846802 CCTTATAAAAAGAGGAAAACTGG + Intronic
960018141 3:112916517-112916539 CCTTATATAAAGAGGGAATTTGG + Intergenic
960321741 3:116245146-116245168 CTTTATAAGAAGAGGAGACAAGG + Intronic
960725189 3:120662943-120662965 CCTTATAAGAAGAGGAAATTTGG + Intronic
960745539 3:120883939-120883961 CCTATTAAGAAGAAAGAAGAGGG + Intergenic
960908563 3:122625626-122625648 CCTTATAAGAAGAGGACATTAGG + Intronic
961015577 3:123465682-123465704 CCTTATAAGAAGAGGAAATTTGG + Intergenic
961518627 3:127454399-127454421 CCTTCTAAGAAGAGAGAATAAGG - Intergenic
961738012 3:129014486-129014508 CCTTCTAAGAAGAGGGGATTAGG - Intronic
961922089 3:130437778-130437800 AATTCAAAGAAGAGGGAAGATGG - Intronic
962073853 3:132059647-132059669 TCTTCTAAGAAGAGGAAAGTTGG - Intronic
962092162 3:132255775-132255797 TCTTATAAGGAGAGGAAAGATGG + Intronic
962215440 3:133516929-133516951 CCTTATAAGAAGAGGAGATTAGG - Intergenic
962254086 3:133858572-133858594 CCTTATAAGAAGAGGAGATGAGG - Intronic
962282417 3:134061910-134061932 CCTTATAAGAAGAGGAATTTTGG - Intergenic
962877684 3:139548313-139548335 CCTTGGAAGAAAAGGGGAGATGG + Intergenic
962946548 3:140176300-140176322 CCTTAGAAGAAGAAGAAACAAGG - Intronic
963728957 3:148952356-148952378 CCTTATAAGAAGAGGCAATTAGG - Intergenic
964111909 3:153096625-153096647 CCTTTTAAGAAGAGGAAATTTGG + Intergenic
964465380 3:156985924-156985946 CCTTATAAGAGGAAGCAAGAGGG + Intronic
964562917 3:158018379-158018401 CCTCATAAGAAAAGGAAATATGG - Intergenic
964643721 3:158936152-158936174 CCTTCTAAGAAGAGGCACAATGG + Intergenic
964670387 3:159219006-159219028 CCTTCTAAGAGGAAGGCAGAGGG - Intronic
965150439 3:164967329-164967351 CATTATAAGAATATTGAAGATGG + Intergenic
965747431 3:171939952-171939974 CCCTGTAAGAAGTGGGAATAAGG + Intergenic
966004574 3:174993969-174993991 CCCTATAAGAAGAGAGAAATTGG - Intronic
966069749 3:175861245-175861267 CCTTATAAGAAGAGGACATTAGG + Intergenic
966480158 3:180398980-180399002 CCTTACAATAAAAGGGGAGAGGG + Intergenic
966535861 3:181032985-181033007 CCTTATAAGAAGAGACTACAGGG - Intergenic
966733169 3:183167560-183167582 CCTTATAAGAAGAGGAGATTAGG - Intergenic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
967634187 3:191781366-191781388 CCTTATGAGAGGAGGAAAGGAGG - Intergenic
967842273 3:194016085-194016107 CCTTATGAGAAGAGGAAATTGGG - Intergenic
967964305 3:194949022-194949044 CCTTATAAGAAGAGGAAATTTGG + Intergenic
967964437 3:194949932-194949954 CCTTATAAGAAGAGGAAATTTGG - Intergenic
968280140 3:197471011-197471033 CCTTATAATAAGAGGAAATTCGG - Intergenic
968745802 4:2359504-2359526 CCTTATAAGAAGAGGAAATATGG + Intronic
969030664 4:4210519-4210541 CTTTATAAGAAGAGGAGAGAAGG - Intronic
969033527 4:4231957-4231979 CTTTATAAGAAGAGGAAAAGAGG - Intergenic
969051583 4:4377066-4377088 CCCTATAAGAAGAAGGGACATGG - Intronic
969174666 4:5389514-5389536 CCTTATAAGAAGAGGAGAGTAGG - Intronic
969322714 4:6422674-6422696 CCTTATAAGAAGAGGAGATTAGG - Intronic
969482878 4:7456114-7456136 CCTTATAAGAAGAGGAGATCAGG - Intronic
969515600 4:7646466-7646488 CCTTATAAGAAGAGGAGATCAGG + Intronic
969859507 4:10024422-10024444 CCTTATAGGAAGAGGAAATGAGG + Intronic
970025575 4:11620780-11620802 CCTTATAAGAAGAGAAAATTTGG + Intergenic
970077538 4:12241472-12241494 CCTTATAATAAGAGGAAATTAGG + Intergenic
970917370 4:21351690-21351712 CCTTATAAGAAAAGGAAATTAGG + Intronic
971193424 4:24448804-24448826 CTTTATAAAATTAGGGAAGAAGG + Intergenic
971290969 4:25339125-25339147 CCTTAAAAGAAGAGGAAATTTGG - Intronic
971526866 4:27630572-27630594 CCTTATAAGAATAAGGGATAAGG - Intergenic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
971586764 4:28414515-28414537 ACTAATAAGAAGAAGAAAGAAGG - Intergenic
972184330 4:36510536-36510558 CCTTATAAGAAGAGGAAATGTGG + Intergenic
972243424 4:37218999-37219021 TGTTATAAAAAGAGGGAAAAAGG + Intergenic
972380072 4:38511313-38511335 CCTTATAAGAAGAGGAAATTTGG - Intergenic
972571264 4:40312446-40312468 CATCCTAGGAAGAGGGAAGATGG - Intergenic
972662157 4:41126791-41126813 CCTTATAAGAAGAAGAAATTAGG - Intronic
972881153 4:43424645-43424667 CCTTCTAAGAAGAGGAGATAAGG - Intergenic
973208604 4:47589044-47589066 CCTTATAAGAAAGAGGCAGAGGG + Intronic
973242920 4:47977247-47977269 CCTTATAAGAAGAGGAAACGTGG + Intronic
973616074 4:52679210-52679232 CCTCGTCAGATGAGGGAAGACGG + Intergenic
973838588 4:54837343-54837365 CCTTATAAGAAGAGGAGATTAGG + Intergenic
973839511 4:54846593-54846615 CCTTATAAGAAGAGGAGATTAGG - Intergenic
973960041 4:56100670-56100692 CCTCATAAGAAGAGGAAATTTGG + Intergenic
974123223 4:57664787-57664809 CCTTATAAGAGAAGTGCAGAAGG + Intergenic
974140761 4:57883569-57883591 CCTTATAAGAAGAGTAAAGTTGG - Intergenic
974589633 4:63927685-63927707 CCTCATAAGAAGAGGAAATTTGG - Intergenic
975262107 4:72315393-72315415 CCTTATAAGAGAGGGGTAGAAGG + Intronic
975430757 4:74288062-74288084 CCTTCTAAGAAGAGGAAATTTGG - Intronic
975749929 4:77512574-77512596 CCTTATAAGAAGAGAAAATTTGG - Intronic
975885365 4:78958538-78958560 CCTAATAAGAACAGGGAATTTGG + Intergenic
976028474 4:80721471-80721493 CCTTATAAGATGAGGAAATGAGG - Intronic
976047420 4:80967632-80967654 CCTTATAAGAAGAGCAAATTTGG - Intergenic
976080948 4:81354122-81354144 CCTAAGAAGAAGAGGAAAGGGGG - Intergenic
976304052 4:83541920-83541942 CCTTGTAAGAAGAGGAAACTTGG - Intronic
976362887 4:84201181-84201203 CCTTAGAAGAGGAAGGTAGAGGG - Intergenic
976496313 4:85733751-85733773 CCTTATAAGAAGAAGAAATTAGG - Intronic
976574007 4:86647749-86647771 CCTTATAAGAAGAGGAAATTAGG + Intronic
976663846 4:87569107-87569129 CCTTATAAGAAGAGGAGATTAGG - Intergenic
976796456 4:88939379-88939401 CCTTATAAGAATGGGGTAGAGGG - Intronic
976816122 4:89149620-89149642 CCTTATAAGAAGGGGAAATTTGG + Intergenic
976888656 4:90016773-90016795 CCTTATAAGAAGAGGAGATTTGG + Intergenic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
977303885 4:95299193-95299215 CCTTATAAGAAGAAGAAATTTGG + Intronic
977399832 4:96518946-96518968 CCTTATAAAAAGAGGAAATCTGG - Intergenic
978291167 4:107142512-107142534 CTTTATAAGAAGAGGAAGAAAGG + Intronic
978481175 4:109192551-109192573 CCTTTTAAGAAAAGAGAAGGTGG + Intronic
978580759 4:110229157-110229179 CCTTATAAGAAGAGGCGACTAGG - Intergenic
978611605 4:110546756-110546778 CCTTAAAGGAAGTGAGAAGATGG + Intronic
979434251 4:120670493-120670515 CCTTGGAGGAAGTGGGAAGAAGG + Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
979625451 4:122840026-122840048 CTTTATAAGAAGAGGAAACCTGG - Intronic
979682430 4:123476668-123476690 CCTTATAAGAAGAGGAGATTAGG - Intergenic
980106549 4:128594024-128594046 CCTTTTAAGAAAGGGGTAGAGGG - Intergenic
980812546 4:137901407-137901429 CCTTATAAGAAGAGGAGACCCGG - Intergenic
980867860 4:138574627-138574649 CTTCATGAGAAGAGGGAATAGGG - Intergenic
981842974 4:149133845-149133867 CCTTATAAGAAGAGGAAATGTGG + Intergenic
982100033 4:151958671-151958693 CCTTACAAGAAGAGGGAATTTGG - Intergenic
982742754 4:159074815-159074837 CCTCATAACATGAGGTAAGATGG + Intergenic
983866450 4:172772877-172772899 CCTTATAAGAGGGAAGAAGAGGG + Intronic
984024667 4:174528882-174528904 CCTTATAAGAAGAGGAAATTTGG - Intergenic
984049050 4:174841360-174841382 CCTTATAAGAAGAGGAGATTAGG - Intronic
984152932 4:176156938-176156960 ACTTATAAGAAGAGGAAATCTGG - Intronic
984167782 4:176322727-176322749 CCTTATAAAAAGAGTTATGACGG - Intronic
984426273 4:179590928-179590950 CCTTATAAGAAGAGAAAAGGAGG - Intergenic
984589528 4:181601526-181601548 CCTTATAAGAAGAGGACATTAGG - Intergenic
984599140 4:181706203-181706225 CCTTATAAGAAGAGGAGATTTGG - Intergenic
984934785 4:184880670-184880692 CCTTATGAAAAGAGGCAACATGG - Intergenic
985245667 4:187977524-187977546 CCTTATACGAAGAGGAAACAGGG + Intergenic
985724448 5:1508446-1508468 CCTTATAAGAAGAGGAGATGAGG + Intronic
985771537 5:1814940-1814962 CCTTATAAGAAGAGGGGATGAGG - Intronic
985816837 5:2133698-2133720 CCTTATAAGAAGAGGAGAAGAGG - Intergenic
986113514 5:4746092-4746114 CTTTATAAGAAGAGGGGATTAGG - Intergenic
986231582 5:5869101-5869123 CTTTATAAGAGGAAGGCAGAGGG - Intergenic
986304362 5:6504534-6504556 CCTTATAAGAGGAAGGCAGAGGG - Intergenic
986367145 5:7043731-7043753 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
986463620 5:7998389-7998411 CCTTATTAGAAGAGTGAATTTGG - Intergenic
986576585 5:9219552-9219574 CCTTATAAGAATAGGAAATTAGG + Intronic
986776947 5:11024555-11024577 CCTTATAAGAAAAAGGAAAAAGG - Intronic
986943079 5:12980334-12980356 CCTTAGAAGAAGAGGAAATTAGG + Intergenic
986977710 5:13411830-13411852 CCTTATAAGAAGAGGAAATTAGG + Intergenic
986987057 5:13512135-13512157 CCTTCTAAGAAGAGGAGAGCAGG - Intergenic
987033837 5:14000183-14000205 CCTTCTGAAAAGAGGGAAGTTGG + Intergenic
987230003 5:15884200-15884222 CCTCCTAAGAAGAGGAAACAGGG - Intronic
987244379 5:16033704-16033726 CCTTATAAGAAGAGGAAATTAGG + Intergenic
987253404 5:16123296-16123318 CCTTATAAGAAGAGGAGATTAGG + Intronic
987353025 5:17038072-17038094 CATCCTAAGAAGAGGGAAGTTGG + Intergenic
987362886 5:17122527-17122549 CCCTATAAGAAGAGGAAATGTGG + Intronic
987877458 5:23697041-23697063 CCTTATGAAAACAGGGAAGATGG + Intergenic
988014711 5:25539477-25539499 CCTTATAGGAAGAGGAGAAATGG + Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
988360684 5:30232859-30232881 CCTTTTAAGAAGAGGAAATTAGG + Intergenic
988414050 5:30923521-30923543 CCTTATAAGAAGGGGAAATTTGG + Intergenic
988593549 5:32569891-32569913 CCTTATAAAAAGGAGGAAGAGGG + Intronic
988660170 5:33257788-33257810 CCTTACAAGAAGAGGAAATTTGG + Intergenic
988998902 5:36740997-36741019 CCTTATAAGAAGAAGAAATTAGG - Intergenic
989094618 5:37770297-37770319 CTTTATAAGAAGAGGAAATTTGG + Intergenic
989364516 5:40640616-40640638 CCTTATAAGATGAGGAAATCTGG + Intergenic
989437186 5:41428427-41428449 CATTATAAGAAGAGGAAATTTGG + Intronic
990335126 5:54764889-54764911 CCTTATAAGAAAAGGAAATGTGG - Intergenic
990493720 5:56326228-56326250 CCTTCTAAGAGAAGGGCAGAGGG + Intergenic
990716157 5:58639534-58639556 CCTTAAAAGAAGAGAGATCAGGG - Intronic
991039883 5:62164114-62164136 CCTTATAAAAGGAAGGCAGAGGG + Intergenic
991131429 5:63126499-63126521 CCTTCTAAGAAAAGGAAATATGG - Intergenic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
991433218 5:66569466-66569488 CCTTATAAGAGGGAGGCAGAAGG + Intergenic
991446673 5:66707606-66707628 TCTTATAAGAAGAGGAAATTAGG - Intronic
991525431 5:67551829-67551851 CCTTATAAGAAGAGGATATTAGG - Intergenic
991608349 5:68425568-68425590 CCCAATAATAAAAGGGAAGAGGG + Intergenic
991937516 5:71816568-71816590 TCTTATAAGAAGAGGAAACCTGG - Intergenic
991998200 5:72409332-72409354 CCTTATAAGAAGAGAGAAATAGG - Intergenic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992318750 5:75588820-75588842 CCTTATAAGAAGGAGGCAGGAGG - Intronic
992387118 5:76295330-76295352 CCTTATAAAAAGAGGTGCGAGGG - Intronic
992591827 5:78303533-78303555 CCTTAAAAGAGGAAGGCAGAAGG - Intergenic
992855167 5:80852753-80852775 CCCTATAAGAACAAGGGAGATGG - Intronic
993081843 5:83310780-83310802 CCTTATTAGAGGGAGGAAGAAGG + Intronic
993168706 5:84387876-84387898 CCTTATAAGAAGAGACACCAAGG + Intergenic
993558225 5:89368272-89368294 CCTTATAAGATGGAGGCAGAAGG - Intergenic
993874327 5:93288743-93288765 CCTTATAAGAAGAGGAGATAAGG - Intergenic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
994184440 5:96802819-96802841 CCTTATAAGAAGATGGAGACTGG + Intronic
994282501 5:97922279-97922301 CCTTATAAGAAGAGGAAATTTGG - Intergenic
994932088 5:106202641-106202663 AATTATAAAAAGTGGGAAGATGG + Intergenic
995163460 5:109009332-109009354 CCTATTAAAAAGATGGAAGAGGG - Intronic
995424162 5:112001384-112001406 CCTTATAAGAAGAGGAAATTTGG - Intergenic
995686625 5:114779544-114779566 CCTTAGATGAAGAGGGGATATGG - Intergenic
995705333 5:114983098-114983120 CCTTATAAGATGAGGCCATAGGG - Intergenic
995837060 5:116409574-116409596 CCTTATAAGAAGAGGGGATTAGG + Intronic
996269500 5:121585578-121585600 TCTTTCAAGAAAAGGGAAGAAGG - Intergenic
996534971 5:124568273-124568295 CCTTATAAGAAAAGGAAATCTGG + Intergenic
996567416 5:124894097-124894119 CCTTATAAGAAGAGGAAATTTGG - Intergenic
996771598 5:127092368-127092390 CCTTATAAGAAGAGGAAATTTGG + Intergenic
997045556 5:130312649-130312671 CCTGTTAAAAAGAGGGAGGATGG - Intergenic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997901006 5:137764255-137764277 CCTTATAAGAAGAGCCCAGAGGG + Intergenic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998360409 5:141581123-141581145 CCTTATAAAAAGAGGAAATTTGG + Intronic
999446011 5:151639967-151639989 CCTTATAAGAGGTGGGTAGAGGG - Intergenic
999497945 5:152118548-152118570 CCTTATGAGAAAAGGGCAGAGGG + Intergenic
1000002470 5:157152141-157152163 AATTATAGGAAAAGGGAAGAAGG - Intronic
1000017332 5:157289612-157289634 CCTTATAAAAAGAGGAAATCTGG - Intronic
1000035653 5:157445726-157445748 CCTTATAAGTGGAAGGCAGATGG - Intronic
1000041281 5:157486918-157486940 CCTCATAAGAAGAGGAGAGTTGG + Intronic
1000091364 5:157932082-157932104 CCTTTTTAGAGGAGGCAAGATGG + Intergenic
1000128684 5:158273560-158273582 ACTTTTAAAAAGGGGGAAGAAGG - Intergenic
1000279208 5:159767724-159767746 CCTTATAAGGGGAGGAAAGGGGG - Intergenic
1000397926 5:160795687-160795709 CCTTATAAGAGAAAGGCAGAGGG + Intronic
1000575979 5:162975788-162975810 CCTTATAAGCAGAAGCAAGGTGG - Intergenic
1000973362 5:167738811-167738833 CCTTATAAGAAGAGGAAATTTGG - Intronic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001154715 5:169263038-169263060 CCTTATTAGAAGAGGAGACAGGG + Intronic
1001179181 5:169502725-169502747 CCTTATAAGAAGAGGTGATTAGG + Intergenic
1001338831 5:170825179-170825201 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1001427972 5:171636811-171636833 CCTTATAAGAAAAAGGCAGAGGG + Intergenic
1001581688 5:172802829-172802851 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1001707257 5:173750516-173750538 CCTTACAAGAAGAGGAAATTAGG + Intergenic
1001869677 5:175140421-175140443 TCTTATAAGAAGAGGAAATTAGG + Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1002565293 5:180109646-180109668 CCTTATAAGAGGACGGCAAAGGG + Intronic
1002706322 5:181162782-181162804 CCTTATAAGAGGAGGAAATGTGG + Intergenic
1002886914 6:1305531-1305553 CCTTATAAGAAGAGGAAATGTGG + Intergenic
1002906426 6:1452868-1452890 CCTTATAAAAAGAGGAAATCAGG - Intergenic
1003311249 6:4971682-4971704 CCTCATAAGAAGAGGAAATTTGG - Intergenic
1003466226 6:6382684-6382706 CCTTATAAGAAGAGGAAACTTGG - Intergenic
1003549405 6:7089072-7089094 ACATATAAGAAGAGAGATGAAGG - Intergenic
1003617751 6:7670710-7670732 CCTTATAAGAAAAGGAAATTAGG - Intergenic
1003673776 6:8183708-8183730 ACTTAGAGGCAGAGGGAAGATGG + Intergenic
1003970654 6:11296058-11296080 CCTTATAAGAAGAGGAGATGAGG + Intronic
1004062215 6:12208676-12208698 CCTTAGAAGAAGAGGAGAGGGGG + Intergenic
1004088991 6:12480131-12480153 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1004310310 6:14539798-14539820 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1005146376 6:22695212-22695234 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1005273094 6:24187168-24187190 CCTTAAAAAAATAGGGAAGTTGG + Intronic
1005427209 6:25715407-25715429 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1005647728 6:27857148-27857170 CCTTTTAAGAAGAGGAAATTTGG + Intronic
1005694732 6:28341435-28341457 CCCTATAAGAAAAGGCTAGAGGG - Intronic
1006834292 6:36987352-36987374 CATTATCAGGAGTGGGAAGAGGG - Intergenic
1006858750 6:37155066-37155088 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1007066286 6:38993547-38993569 CCATAAAAGAAGAGGGAAATGGG - Intronic
1007298609 6:40848536-40848558 CCGTCTAAGAAGAGGAAATAAGG - Intergenic
1007839988 6:44708264-44708286 CCTTACAAGAAGAGGAAATTTGG - Intergenic
1008036782 6:46753556-46753578 CCTGGTGAGAAGAGGGAAAAGGG + Intronic
1008279884 6:49584361-49584383 CCTTATAAGAAGAGACAATTAGG - Intergenic
1009206646 6:60810378-60810400 CCTTATAAGTCCAGGGAAGCCGG - Intergenic
1009263505 6:61525596-61525618 TCTTATAAGAAGAGGAAATCTGG - Intergenic
1009868559 6:69428573-69428595 CCCTATAACTAGAAGGAAGAAGG + Intergenic
1009924961 6:70109455-70109477 CCTTATAAGAATGGAAAAGAAGG + Intronic
1010009828 6:71037070-71037092 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1010108985 6:72202430-72202452 CCTTACAAGAAGAGGAAATTTGG - Intronic
1010273318 6:73939642-73939664 CCTTATAAGGAGAGGAAATTAGG + Intergenic
1010407562 6:75522282-75522304 TATTATAGGAAAAGGGAAGATGG - Intergenic
1010623138 6:78101514-78101536 CCTTTTAAGAAAAAGGCAGATGG + Intergenic
1010729960 6:79380831-79380853 CCTTATAAGAAGAGGGGGTTAGG - Intergenic
1010931960 6:81814584-81814606 CCTTCTAAGAAGAGGAAATTAGG - Intergenic
1011401424 6:86966186-86966208 ATTACTAAGAAGAGGGAAGAAGG + Intronic
1011476673 6:87755444-87755466 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1011790443 6:90893170-90893192 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1011988948 6:93487872-93487894 CCTTTTAACAAAAGGGCAGAAGG - Intergenic
1012020325 6:93909743-93909765 CATTTTAAGAAGAGACAAGATGG - Intergenic
1012044160 6:94248313-94248335 CCTTATATGAAGAGGAAATTTGG - Intergenic
1012482337 6:99680921-99680943 CCTTATAAGAAGAGGAAAATTGG + Intergenic
1013260670 6:108438401-108438423 CCTTATGAGAAGAGGAAATGTGG - Intronic
1013277972 6:108604903-108604925 CCCTATAAGAAGAGAGAAAAAGG + Intronic
1013278861 6:108615672-108615694 TCATAAAAGAAGAGGAAAGAGGG - Intronic
1013346235 6:109263330-109263352 CCTTATAAGAAGAGGAAATTCGG + Intergenic
1013447960 6:110250371-110250393 CCTTATAAAAAGAGGAAATTTGG - Intronic
1013904681 6:115200738-115200760 ATTTATAAGAACAGGGAAAAGGG + Intergenic
1014122143 6:117737961-117737983 CCTTGTCAGAAGAGGAAATATGG + Intergenic
1014597976 6:123369228-123369250 CCTTAAAAGAAGAGGAAATTTGG - Intronic
1014660013 6:124158251-124158273 CCTTATAAGAAGAGGTGATTAGG - Intronic
1014707213 6:124762292-124762314 CCTTATGAGAAGAGGAAATTTGG - Intronic
1014961683 6:127694664-127694686 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015136013 6:129871652-129871674 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1015498003 6:133900940-133900962 CCTTATAAGAGAAAGGGAGAGGG + Intergenic
1015678604 6:135779458-135779480 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1016035735 6:139380865-139380887 CCTCATAAGAAGAGGAAATTTGG - Intergenic
1016240882 6:141929127-141929149 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1016397649 6:143642659-143642681 TCTTATAAAAAGAGGGAATTTGG + Intronic
1016516387 6:144897157-144897179 CCTTATAAGAAGAAGAAATTTGG - Intergenic
1016551320 6:145283399-145283421 CCTTATCAGAAGAGGAGAAAAGG + Intergenic
1016647931 6:146431696-146431718 CCTATGAAGAAGTGGGAAGATGG + Intronic
1016740997 6:147528436-147528458 CCTTATAAGAAGAGGAGATTAGG - Intronic
1017645221 6:156533970-156533992 CCTTATAAGAAGAGAAACCAGGG - Intergenic
1017937081 6:159015214-159015236 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1018035098 6:159874984-159875006 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1018036758 6:159888590-159888612 CCTTATGGGAGCAGGGAAGAAGG - Intergenic
1019554904 7:1624393-1624415 CCTTCTAAGAAGAGGAAATCAGG - Intergenic
1019791260 7:3015446-3015468 CCTTATAAGAAGAGGAAATGAGG - Intronic
1019826539 7:3289263-3289285 CCTTATAAAAAGAGGAAATTAGG - Intergenic
1019954604 7:4403478-4403500 CCTTATAAGAAGAGACATCAGGG - Intergenic
1020108594 7:5434910-5434932 CCTTATAAGAAGAGGAGATTAGG - Intronic
1020361892 7:7335651-7335673 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1020677842 7:11201825-11201847 CCTTAGGAGAAGAGGGGAGTGGG + Intergenic
1021065805 7:16170964-16170986 CCCCACAAGAAGAGGGAAGCCGG + Intronic
1021190124 7:17610610-17610632 ACTTAAAAGAAGAGGGAATTTGG + Intergenic
1021611760 7:22464629-22464651 CCTTATAAGAGGAGGAAATTTGG + Intronic
1021897734 7:25253002-25253024 TCTTATAAGAGGAAGGCAGAAGG + Intergenic
1021972603 7:25980516-25980538 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1022853676 7:34293981-34294003 ACTGATAAGTAGAGGGAAAATGG - Intergenic
1023296190 7:38717225-38717247 CCTTATAAGAAAAGGAAATTTGG - Intergenic
1023317207 7:38951673-38951695 CCTTATAAGAAAAGGAAATGAGG + Intergenic
1023378768 7:39585362-39585384 CCTTATAAGAAGAGGAAATTTGG + Intronic
1023576304 7:41631257-41631279 CCTTATAAGAAGAGGAAGAGAGG - Intergenic
1023790941 7:43753205-43753227 CCTTACGAGAAGAGGAAAGTTGG - Intergenic
1023817627 7:43962513-43962535 CCCTATCAGAACAGGGAAGCTGG - Intergenic
1024281468 7:47722817-47722839 CCTTATAAGAAGAGGAGATTAGG - Intronic
1024472714 7:49779885-49779907 CCTTATAAGAAGAGGAGATGTGG - Intronic
1024542709 7:50492025-50492047 CCTTATAAGAAGAGAAAATTTGG + Intronic
1024670494 7:51589548-51589570 CCTTATAAGAAGAGACATGAGGG + Intergenic
1024896672 7:54268824-54268846 CCTACTAAGAAAAAGGAAGAAGG - Intergenic
1025702809 7:63835501-63835523 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1025707617 7:63881939-63881961 CCTTATTAGAAGAGGCATTAAGG + Intergenic
1026108903 7:67443052-67443074 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1026154692 7:67816864-67816886 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1026172058 7:67962612-67962634 CCTTGTAAGAAGAGGAAATTTGG + Intergenic
1026512789 7:71040898-71040920 CCTTATGAGAAGGTGGTAGATGG + Intergenic
1026538869 7:71262990-71263012 CCTTATGAGAAGAGGAAATTTGG + Intronic
1026603375 7:71795322-71795344 CCAGAGAAAAAGAGGGAAGATGG - Intronic
1026884977 7:73935484-73935506 CCTTATAAGAAATAGGCAGAGGG + Intergenic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027835205 7:83232876-83232898 CCTCATAAGAAGAGGAAATGTGG + Intergenic
1027844943 7:83361063-83361085 CTTTATAAGAAGAGGAAGGGAGG - Intergenic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1027946873 7:84758471-84758493 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1027979116 7:85194871-85194893 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1027996915 7:85435690-85435712 CTTTATCAGCAGAGGGAAAATGG + Intergenic
1028093653 7:86733600-86733622 ACTTATAAGGACAGGGAAAAAGG + Intronic
1028205676 7:88013995-88014017 CCTTAGAAGGAGAGGGTAGTAGG - Intronic
1028466099 7:91153722-91153744 GCTTATCAGAGGATGGAAGATGG + Intronic
1028809315 7:95066153-95066175 CCTTATAAGAATAGGAAATTTGG + Intronic
1028921000 7:96309951-96309973 CCTTATACGAAGAGGAAATTAGG + Intronic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1029193780 7:98790103-98790125 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1029256304 7:99271996-99272018 CCATATAAAAAGAGGGAAGATGG - Intergenic
1029519246 7:101049690-101049712 CCTTATAAGAAGGGGAAATTTGG - Intronic
1029742251 7:102497387-102497409 CCCTATCAGAACAGGGAAGCTGG - Intronic
1029760241 7:102596552-102596574 CCCTATCAGAACAGGGAAGCTGG - Intronic
1029923172 7:104287619-104287641 CCTTAAAAGAAAAGAGAAGAAGG - Intergenic
1029986547 7:104928142-104928164 CCTCATAAGAAGAGGAAATTTGG + Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030346944 7:108444685-108444707 CCTTATAAAAAGAGGCAATTTGG - Intronic
1030418977 7:109283455-109283477 CTTCATAGCAAGAGGGAAGAAGG - Intergenic
1030600235 7:111583970-111583992 CCTAATAAGAAGAGGAGATAAGG - Intergenic
1030740481 7:113103370-113103392 CCTTATAAAAAGAGGAACAAGGG - Intergenic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031478354 7:122249273-122249295 CCTTTTAAAAAGAGGGAATTTGG + Intergenic
1031756658 7:125652224-125652246 CCTTATTTGAATAGGGAAAAGGG + Intergenic
1031914962 7:127554356-127554378 CCTTATAAGAGGAGAGGACATGG - Intergenic
1032123398 7:129173116-129173138 CCTTATGAGAAGAGGAAAATTGG - Intergenic
1032172757 7:129599577-129599599 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1032508639 7:132454703-132454725 CCTTATAAGAAGAGGAAATTTGG + Intronic
1033983615 7:147196032-147196054 CCTTATAAGAAGGGGAAATTAGG + Intronic
1034726376 7:153339994-153340016 CCTTATAAGAAGAGAAAACTTGG - Intergenic
1034760897 7:153670882-153670904 CCTTATAAGAAGAGGAGATCAGG - Intergenic
1034798637 7:154036789-154036811 GCGTATAGGAAGAGGGAAGGGGG + Intronic
1034957114 7:155341847-155341869 CCTTAGAAGAAGAGGAGATAAGG - Intergenic
1035046711 7:155972677-155972699 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1035116769 7:156531471-156531493 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1035700813 8:1638311-1638333 CCTTATAAGAAGAGGAGATGAGG + Intronic
1036211287 8:6843168-6843190 CCTTATAAGAAAAGGAAATTTGG + Intergenic
1036574573 8:10014817-10014839 CCTTATAAGAAGAGGCGATTAGG - Intergenic
1036781426 8:11650564-11650586 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1036922841 8:12874293-12874315 CCTTATTACAAGTGGGGAGAAGG + Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037449612 8:19003622-19003644 TTTTAAAAGAGGAGGGAAGAAGG + Intronic
1037616310 8:20522309-20522331 CCTTATAAGAAGGGGAGAGGAGG + Intergenic
1037983698 8:23273205-23273227 CCATATAAGAAGAGGAAATTTGG + Intronic
1038016794 8:23522465-23522487 CTTTATAAGAAGAGAGGAGTTGG + Intergenic
1038030604 8:23635312-23635334 GCTTGTAAAAAGACGGAAGAAGG - Intergenic
1038062895 8:23931794-23931816 CCTAAAAAGAAGAGGGAACTGGG - Intergenic
1038161458 8:25043290-25043312 TCTTATAAGAAGAGGAAATTTGG - Intergenic
1038340124 8:26679181-26679203 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1038340991 8:26684764-26684786 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1038349255 8:26761506-26761528 CCTTATAAGAAGAAGAAATTGGG + Intronic
1038368291 8:26960663-26960685 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1038486360 8:27937827-27937849 CCTTATAGGAAGAGGAGATAAGG - Intronic
1038558703 8:28549178-28549200 CCTTATAAGAGGAGGAAATTTGG - Intronic
1038650852 8:29402009-29402031 TCTGATAAAGAGAGGGAAGAGGG - Intergenic
1038655225 8:29444674-29444696 CTTTTAAAGAAGAGGGAAAATGG + Intergenic
1039037911 8:33379242-33379264 CTTTATAAGCAGTGGGAAAATGG + Intronic
1039057929 8:33551278-33551300 CCTGATAGGAAGAGGCAAGGAGG - Intronic
1039146736 8:34455675-34455697 CCTTATAAGAAGAAGAAATATGG + Intergenic
1039370895 8:36982896-36982918 CCTTACAAGAAGAGGGAATTAGG + Intergenic
1039440033 8:37588669-37588691 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1039564852 8:38544040-38544062 CCTTATAAAAAGAGGCAATTTGG + Intergenic
1039720785 8:40162018-40162040 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1039741848 8:40390014-40390036 CTAAATAAGAAGAGGGAAGCAGG - Intergenic
1040115729 8:43616606-43616628 CCTTATAAAAACAAGAAAGAAGG + Intergenic
1040586590 8:48749197-48749219 ACATATAAGAAGTGAGAAGAGGG + Intergenic
1040618192 8:49061275-49061297 CCTCATAAGAAGAGGGAATTTGG + Intronic
1040660168 8:49563829-49563851 CCTTATTAGAAGAGGAAATTAGG - Intergenic
1040803934 8:51373190-51373212 CCTTATAAGAAAAGGAAATGTGG + Intronic
1040856022 8:51948716-51948738 CCTTATAAGAAAAGGAAATTTGG + Intergenic
1040857373 8:51961857-51961879 CCTTACAAGAAGAGGAAATGTGG - Intergenic
1040978085 8:53215970-53215992 CCTTATAAAAAGAGGGCATTAGG - Intergenic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1041240312 8:55843584-55843606 CCTTATAAGGAGAGGAAATTTGG + Intergenic
1041260961 8:56020194-56020216 TGTTATAAGAAGAGGGAATTTGG - Intergenic
1041301355 8:56415193-56415215 TCTTAAAAGAATAGGAAAGAAGG - Intergenic
1041644249 8:60235303-60235325 CCTTATAAGAAGAGGAAATTTGG - Intronic
1041777069 8:61535037-61535059 CCTTATAAGAAGAGGAACTTTGG - Intronic
1041882708 8:62770549-62770571 CCTCATAAGAAGAGACATGAGGG - Intronic
1041954248 8:63539916-63539938 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1042000056 8:64112054-64112076 CCTTATAAGAAGAGGGGATTAGG - Intergenic
1042192218 8:66198509-66198531 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1042250994 8:66756105-66756127 TCTTATAAGAAGAGGAAATTTGG + Intronic
1042576499 8:70226240-70226262 GTTTATAATAAGAAGGAAGAGGG + Intronic
1042929029 8:73995402-73995424 CCTTATAAGAAGAGGAAATTTGG - Intronic
1043088022 8:75861123-75861145 CCTCATAAGAACAGTAAAGACGG + Intergenic
1043534139 8:81182427-81182449 CCTTATAAGAAGAGGATACTAGG - Intergenic
1043564271 8:81530769-81530791 CCTTTTAAGAGGGAGGAAGAGGG + Intronic
1044109835 8:88258657-88258679 GTTTACAATAAGAGGGAAGACGG + Intronic
1044354741 8:91208041-91208063 CCTTATGAGAAGAGGAAATTTGG - Intronic
1044704231 8:94993177-94993199 CCTTATAAGAAGAGGAGATAAGG - Intronic
1044846338 8:96385535-96385557 CCTTATAAGAAGAGGAAAATAGG + Intergenic
1044884576 8:96763101-96763123 CTTTATAAGAAGAGGAAAGTTGG - Intronic
1044941819 8:97351195-97351217 ACTTAGAAGACGAGGGAACAAGG - Intergenic
1045003683 8:97899596-97899618 CCTTATAAGAAGAGGAAGTCTGG - Intronic
1045247607 8:100457262-100457284 CCTCATAAGATGAGGGGATAAGG + Intergenic
1045403491 8:101842155-101842177 CCTTAAAAGAAGAGGAAATTTGG - Intronic
1045611085 8:103842988-103843010 ACTTATAAGAAGAGGAAATTTGG - Intronic
1045669277 8:104529180-104529202 CCTTATAAGAAGAGGAGATCAGG + Intronic
1045704704 8:104908277-104908299 CCTTATAAGAAGAGGAAATTAGG + Intronic
1045730603 8:105234900-105234922 CCTTGTAAGATGAAGCAAGAAGG + Intronic
1045943405 8:107765841-107765863 CCTTATAAGATGAGGAAATTTGG + Intergenic
1046175424 8:110570031-110570053 CCTTATCAGCAGTGTGAAGACGG - Intergenic
1046490744 8:114950630-114950652 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1046627787 8:116593593-116593615 CCTTATTAGAAGAGGAAATTAGG + Intergenic
1046790542 8:118317031-118317053 TCTTATAAGAAGAGGAAATTTGG + Intronic
1047063475 8:121253581-121253603 CCTTAGAAGAGGGAGGAAGAAGG - Intergenic
1047124526 8:121945950-121945972 CTTTATAAGAGGAGGGCAGGAGG - Intergenic
1047192054 8:122687139-122687161 GCGTTTAAGTAGAGGGAAGAAGG - Intergenic
1047433752 8:124817027-124817049 CCTTAAATGATGAGGGAATATGG + Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1047717756 8:127611268-127611290 CCTTGTAAGAGAAGGGCAGAGGG + Intergenic
1048270113 8:133021711-133021733 CCTTATAAGAAGAGGGGGTCAGG - Intronic
1048429877 8:134360250-134360272 CCTTATAAGAAAGAGAAAGAGGG + Intergenic
1048535354 8:135289212-135289234 TCTGATAAAAAGAAGGAAGAAGG + Intergenic
1048544365 8:135372632-135372654 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1048977872 8:139683103-139683125 CCTGATAGGAAGAAGGAAAAGGG + Intronic
1049241685 8:141540571-141540593 CCTTATAAGAAGAGGCGATGGGG - Intergenic
1050185230 9:2965949-2965971 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1050369512 9:4906405-4906427 CCTTATAAGAAGAGAAAATGTGG + Intergenic
1050488581 9:6162545-6162567 GCTTATAAGAATGGGGATGATGG - Intergenic
1050535129 9:6624355-6624377 CCTTATAAGAAGAGCAAAATTGG + Intronic
1050639275 9:7649224-7649246 CCTTATAAGAAGAGAAAATTTGG + Intergenic
1050984186 9:12061105-12061127 CCTTATAAGAAAAAAGCAGAAGG - Intergenic
1051202429 9:14642597-14642619 CCTTATAAGAAGAGGAAATTTGG + Intronic
1051358232 9:16259395-16259417 CCTTATAACAAGAGGAAATTTGG - Intronic
1051762153 9:20479408-20479430 TCTTATAGCAAGAGGGAAAATGG + Intronic
1051972123 9:22901608-22901630 CCTTATAAGAAGAAGAAAGAGGG + Intergenic
1052031342 9:23632486-23632508 CAATAAAAGAATAGGGAAGAGGG - Intergenic
1052796859 9:32931117-32931139 CCTTATAAAAAGAGGAAGGCAGG - Intergenic
1053096178 9:35329855-35329877 CCATGGCAGAAGAGGGAAGAGGG + Intronic
1053446488 9:38157148-38157170 TTTTATAAGAAGGGGGCAGAAGG - Intergenic
1053446598 9:38157959-38157981 CCTTATAAGAGGGAGGCAGAGGG - Intergenic
1053558499 9:39163432-39163454 CCTTTTCAGAAGAGCGAAGTTGG - Intronic
1053822617 9:41983657-41983679 CCTTTTCAGAAGAGCGAAGTTGG - Intronic
1054138615 9:61455509-61455531 CCTTTTCAGAAGAGCGAAGTTGG + Intergenic
1054857678 9:69918601-69918623 CCTTATAACAAGGGGGAATTTGG - Intergenic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1055443374 9:76358476-76358498 CCTCAAAGGAAGAGGCAAGAGGG - Intronic
1055645632 9:78358905-78358927 CCTTCTAAGAAGAGGAAATTTGG - Intergenic
1056048248 9:82741407-82741429 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1056148439 9:83759140-83759162 CCTCAGAAGAGGAGGGAAAAGGG - Intronic
1056296505 9:85198560-85198582 CCTTATAACAAGAGGAAATTAGG - Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1056938986 9:90938925-90938947 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1057008068 9:91578135-91578157 CCTTATAAGAAGAGGAAATTAGG + Intronic
1057306146 9:93913097-93913119 CCTTATAAAAAGGGGGAAATTGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057559218 9:96114240-96114262 CCTTGTAAGAAAAGGGAACTAGG - Intronic
1058003638 9:99892845-99892867 CCTTATATGAAGAGGAAATTTGG + Intergenic
1058537235 9:105974859-105974881 GGTTATAAAAGGAGGGAAGAGGG - Intergenic
1058590144 9:106556823-106556845 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1058735519 9:107890521-107890543 CCTTACAAGAAGAGAGAATTTGG + Intergenic
1058927649 9:109683344-109683366 CCTTATAAGAGAAGTGCAGAGGG + Intronic
1059058978 9:111015014-111015036 CCTTATAAGAGGAAGAAAGTTGG + Intronic
1059343170 9:113611054-113611076 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1059496721 9:114716139-114716161 CCTTGTAAGAAGAGGAAATTTGG - Intergenic
1059498800 9:114732679-114732701 CCTTCTAAGAAGAGGAAATTAGG + Intergenic
1059561285 9:115337059-115337081 CCTTATAAGAAGGAGGCAAAGGG - Intronic
1059698808 9:116755415-116755437 CCTTTTAAGAAGAGGAAAACTGG + Intronic
1059726636 9:117014756-117014778 CCTTATAAGAAGAGGATATTGGG + Intronic
1059859860 9:118447605-118447627 GTTTATAAGAAGGGGGAAAAAGG - Intergenic
1059899184 9:118903692-118903714 CCTTATAAGAAAAGGTCTGAGGG + Intergenic
1060541399 9:124432963-124432985 CCTTATAAGAGGGAGGCAGAGGG + Intergenic
1061277090 9:129575376-129575398 CCTTATAAGAAGAGGAAATTAGG + Intergenic
1062288273 9:135783312-135783334 CCAGCTCAGAAGAGGGAAGAGGG + Intronic
1062488947 9:136795108-136795130 CCTCATAAGAAGAGGAAATTAGG + Intronic
1203458252 Un_GL000220v1:10769-10791 CCTTATAAAAGAAGGGAGGAGGG + Intergenic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1185604906 X:1363074-1363096 CCTTATAAGAAGAGGAGACGTGG - Intronic
1185606251 X:1368652-1368674 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185682075 X:1897118-1897140 CCTTATAAGAAGAGGACATGAGG - Intergenic
1185704699 X:2258004-2258026 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185721826 X:2388416-2388438 CCTTATAAGAAGAGGAGATGAGG + Intronic
1185746078 X:2574575-2574597 CCTTATAAGAAGAGGAGACGAGG + Intergenic
1185776359 X:2805731-2805753 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185790215 X:2923651-2923673 CCTTATAAGAAGAGGAGATGAGG - Intronic
1185791837 X:2933057-2933079 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185800703 X:3007899-3007921 CTTTATAAGAAGAGGAAATGAGG - Intronic
1185815378 X:3150282-3150304 CCTTATAAGAAGAGGAGAGGAGG - Intergenic
1185841674 X:3397884-3397906 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1185853484 X:3510707-3510729 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1185921971 X:4103482-4103504 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1185943338 X:4346090-4346112 CCTTATAAGAAGAGGAGAAGAGG + Intergenic
1185943607 X:4349138-4349160 CCTTATAAGAAGAGGAGATTCGG + Intergenic
1185952174 X:4449477-4449499 CATTAAAGGAAGAGGGAAGTTGG + Intergenic
1186186816 X:7028957-7028979 CCTTATAAGAAGAGGAGATGAGG - Intergenic
1186296204 X:8151303-8151325 TGTTAGAAGAAGTGGGAAGATGG + Intergenic
1186371686 X:8953357-8953379 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1186410308 X:9340697-9340719 CCTTATAAGAAGAGGCGATGAGG + Intergenic
1186925384 X:14328249-14328271 CCTTATAAGCACATGGAAGCTGG - Intergenic
1187295870 X:17999981-18000003 CCTTATAAGAGGAAGACAGAGGG - Intergenic
1187343321 X:18440989-18441011 TGTTAGAGGAAGAGGGAAGAGGG + Intronic
1187597454 X:20788798-20788820 CCTTATAAGAAGAGGATATTAGG + Intergenic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1188032884 X:25284106-25284128 CCTTATAAGAAGAGGAGATTAGG - Intergenic
1188121069 X:26308587-26308609 CCTTATAGGAAGAGGAAATTTGG - Intergenic
1188384942 X:29544933-29544955 CCTTATAAGAAGATGAAATTAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1188646685 X:32577142-32577164 CCTTATGAGAAGAGGAAATTTGG + Intronic
1189108764 X:38265082-38265104 CCTTATAAAAAGAGGAAATGTGG + Intronic
1189211818 X:39290277-39290299 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189249243 X:39587318-39587340 CCTTATAAGAAGAGGAAATTTGG - Intergenic
1189288470 X:39868517-39868539 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1189532674 X:41902464-41902486 CCTTATAAGAGGAAGGCAGGAGG - Intronic
1190224369 X:48534029-48534051 CCTTATAAGAAGAGGGACACTGG - Intergenic
1190243165 X:48673539-48673561 CCTTATAAGAAGAGACGTGATGG - Intergenic
1190395206 X:49975440-49975462 CCTTATAGGAAGAGGGTAAATGG - Intronic
1190444492 X:50509892-50509914 CCTTATAAGAAGAGGGGATTTGG + Intergenic
1190636203 X:52436467-52436489 CCTTATAAGAAGAGGAAATGAGG - Intergenic
1190643611 X:52504370-52504392 CCTTACAAGAAGAGGAAATGAGG - Intergenic
1190792207 X:53710970-53710992 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1190962374 X:55265155-55265177 CCTCATAAATAGAGGGAAGAGGG + Intronic
1191755536 X:64588524-64588546 CCTTATAAAAAGAAGGCAGGAGG - Intergenic
1191767817 X:64719646-64719668 TCTTATAAGAATAGTGAAGGAGG - Intergenic
1192093608 X:68186800-68186822 CCTTATAAGAAGGTGCCAGAGGG - Intronic
1192163210 X:68804106-68804128 AAGTATAAGAAGGGGGAAGATGG - Intergenic
1192746427 X:73943388-73943410 AAATAAAAGAAGAGGGAAGATGG + Intergenic
1193142344 X:78041222-78041244 ATTTATTAGAAGAGGGGAGAAGG - Intronic
1193201608 X:78697948-78697970 ACTAAAAGGAAGAGGGAAGATGG + Intergenic
1193319747 X:80107329-80107351 CCTTATAGGATTAAGGAAGAGGG + Intergenic
1193426575 X:81347377-81347399 CCTTATAAGGGTAAGGAAGAGGG - Intergenic
1193543595 X:82800469-82800491 CCTTATGAGAAGAGGAAATTTGG + Intergenic
1193758120 X:85433753-85433775 CCTTATAAGAAGAGGAGATAAGG + Intergenic
1193988165 X:88272927-88272949 ACTGATAAGAAGAGGGAATGTGG - Intergenic
1194458318 X:94132492-94132514 CCTTATAAGAAGAGGCAATTAGG + Intergenic
1194794542 X:98194958-98194980 CCTTATAAAAAGAGGAAAATTGG - Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1195020712 X:100824463-100824485 GCTTATAAGAAAAGGGCATACGG - Intronic
1195174100 X:102297994-102298016 CTTTATAAGAAGAGGAAAATTGG + Intergenic
1195184765 X:102389099-102389121 CTTTATAAGAAGAGGAAAATTGG - Intronic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1195929606 X:110061439-110061461 CCTACTAAGAAGATGGAAGGAGG - Intronic
1196391061 X:115207881-115207903 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196391151 X:115208905-115208927 CCTTATAAGAGGAAAGCAGAGGG + Intronic
1196717019 X:118822013-118822035 CCTTATAAGAAGAGGAAATTTGG + Intergenic
1197664949 X:129213588-129213610 GCTAGTAAGAAGATGGAAGACGG + Intergenic
1197777899 X:130131796-130131818 ACTCCTAAGAAGAGAGAAGAGGG + Exonic
1197814643 X:130484667-130484689 CCTTTTCAGAAGAGGTAAAATGG - Intergenic
1197951513 X:131902506-131902528 CCTTTTAAGAAAAGGGGATAAGG + Intergenic
1197968131 X:132086537-132086559 CCTTATAAGAAGAAGAAATTTGG + Intronic
1198281769 X:135149681-135149703 CATTATAAGAAGAGGGATATTGG - Intergenic
1198286499 X:135196511-135196533 CCTTATATGAAGAGGGATATTGG - Intergenic
1198289190 X:135222841-135222863 CATTATAAGAAGAGGGATATTGG + Intergenic
1198333100 X:135640422-135640444 CCTGAAGAGAAGATGGAAGATGG - Intergenic
1198512821 X:137371390-137371412 CCTTATAAGAAGAGGAAATGTGG - Intergenic
1198574401 X:137994169-137994191 GGTTATAAGCAGGGGGAAGAGGG + Intergenic
1198895076 X:141444692-141444714 CCTTTTAAGAAGAGGAAATTAGG - Intergenic
1198959298 X:142167364-142167386 CCTTATAAGAAGAGGAGATTAGG + Intergenic
1199356975 X:146874332-146874354 CCATGTAAGCAGAGGGAATATGG - Intergenic
1199384804 X:147211439-147211461 TCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199385672 X:147220402-147220424 CCTTATAAGTAGAAGGAAGGTGG - Intergenic
1199412137 X:147536372-147536394 CCTTATAAAAAGAGGGAATTTGG + Intergenic
1199661612 X:150055767-150055789 GCTAATAAAAAGAGAGAAGATGG - Intergenic
1199681636 X:150228714-150228736 CCTTATAAGAGGAAGGCAGAAGG - Intergenic
1199845758 X:151692173-151692195 CCTTATAAGAAGAGGAAATTAGG - Intergenic
1199902968 X:152195705-152195727 CCTTATAAGAATCAGGCAGAAGG - Intronic
1199948757 X:152688640-152688662 CCTTATAAGAAGAGGACATTAGG + Intergenic
1199960919 X:152779809-152779831 CCTTATAAGAAGAGGACATTAGG - Intergenic
1200298712 X:154950064-154950086 CCTTATAAGAAGAGGAAATGTGG - Intronic
1200809948 Y:7473819-7473841 TCTTATAAGAAGAGGAGATAAGG - Intergenic
1201231370 Y:11867942-11867964 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201232711 Y:11880116-11880138 TCTCATAAGAAGAGGGGATAAGG + Intergenic
1201265920 Y:12206449-12206471 CCTTATAAGAAGAGGAGAGGAGG + Intergenic
1201284097 Y:12364286-12364308 CCTCATAAGAAGAGGAGATAAGG + Intergenic
1201293616 Y:12445744-12445766 CCTTATAAGAAGAGGAGATGAGG + Intergenic
1201554789 Y:15256675-15256697 CCCCAAAAGAAGAGGGAAAAGGG + Intergenic
1201625064 Y:16005829-16005851 CCTTATAAGAGGAAGGCAGTAGG + Intergenic