ID: 929197822

View in Genome Browser
Species Human (GRCh38)
Location 2:39204734-39204756
Sequence AAGTTCTTTTAGAAAAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 535
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929197822 Original CRISPR AAGTTCTTTTAGAAAAGTGA AGG (reversed) Intronic
900353260 1:2247446-2247468 AAGTTCTTTTAGCAAAATGATGG + Intronic
901227177 1:7620496-7620518 AAGTTCTGTGAGAGAAGGGAAGG - Intronic
905223538 1:36465084-36465106 AAATGCTCTCAGAAAAGTGAGGG - Intergenic
906650614 1:47509907-47509929 AAGTTCTATGAGAGAAGAGACGG + Intergenic
908552031 1:65218274-65218296 CACTTCTGTTAAAAAAGTGAAGG - Intronic
909545355 1:76840572-76840594 AATTTCTTTAAGGAAAGTAATGG + Intergenic
909669233 1:78169247-78169269 ACTGTCTTTTAGAAAAGAGAAGG + Intergenic
910764108 1:90763494-90763516 AAGTCCATATAGTAAAGTGAAGG + Intergenic
910866672 1:91794501-91794523 ATGTTTTTTTAAAAAAGTGGAGG - Intronic
910932854 1:92459791-92459813 AAGTCCTATTAGATACGTGAGGG - Intergenic
911288838 1:96029662-96029684 AAGTTTTTTTAAAAAAATCATGG - Intergenic
911463244 1:98216765-98216787 AAGTTCTCTTAGAGAAATCAGGG - Intergenic
911986163 1:104626513-104626535 AATTTCTAGTAGAAAATTGAGGG + Intergenic
912268205 1:108180951-108180973 ATATTCTTATAGGAAAGTGAGGG - Intronic
912677878 1:111702321-111702343 ATCTTCTTTTAGAAAAGTTTTGG - Intronic
912994103 1:114516346-114516368 AAGCTGTTTTGGTAAAGTGATGG - Intergenic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916282720 1:163070211-163070233 AAGGTCTTTTAAAAAAATCAAGG - Intronic
916441974 1:164835951-164835973 AGGTTCTTTTAGAAAATTCTTGG - Intronic
916634886 1:166657866-166657888 AAATTCTTTTAGAAAAATATCGG - Intergenic
917208029 1:172598126-172598148 AAGTTCTTTTTGGAAAGTCAGGG + Intronic
917220765 1:172726791-172726813 AAGTTCTGTTCGAAGTGTGAAGG - Intergenic
917389237 1:174515657-174515679 AAGTTCCTTAAGAACAGTGATGG + Intronic
917532368 1:175847446-175847468 ATGTTCTTAGAGAAAAATGAAGG + Intergenic
917981720 1:180273568-180273590 AAATTCTTTAAGAAAAAAGAAGG + Intronic
918017838 1:180654244-180654266 AAGTAGTTTTAGTAGAGTGATGG - Intronic
918366777 1:183816166-183816188 AAATTACTTTAGAAAACTGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918573014 1:186021189-186021211 AGATTCTTTATGAAAAGTGAAGG + Intronic
918643470 1:186873233-186873255 AATTCCTCTCAGAAAAGTGATGG - Intronic
918703795 1:187637205-187637227 TAGTTCCTTTAGTAAAATGAAGG - Intergenic
919017158 1:192053289-192053311 AACTTCTTTTAGAAATGAAAAGG - Intergenic
919069062 1:192730889-192730911 AAATTCTTTTAGAACAATGAGGG - Intergenic
920107611 1:203565435-203565457 AAGTTATTTAAGAGAAGTAAAGG + Intergenic
920285929 1:204879681-204879703 CAGTTCTTTTGGAAATGGGAAGG + Intronic
921303152 1:213769661-213769683 AAGTCCTTTTGGAAAAGGGCAGG + Intergenic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923073845 1:230591690-230591712 AAGTTGTCTTAGAAATGGGATGG + Intergenic
923129220 1:231060730-231060752 AATTTCTTTTAAAACAGGGATGG - Intergenic
1063425891 10:5949769-5949791 AAGTGGTTTTAAAAAAGTGGTGG + Intronic
1063700770 10:8383175-8383197 ATGTTCTAAGAGAAAAGTGAAGG - Intergenic
1063925916 10:10977195-10977217 AAATTGTTTTGGAAAAGTGAGGG + Intergenic
1064635459 10:17361617-17361639 AAAGTCTTCTAGAAAATTGAAGG + Intronic
1064652658 10:17525006-17525028 AAGTGCTTCTAGAAAACTCAAGG + Intergenic
1064874674 10:19979659-19979681 AAGTTCCTTTAAAAAGGTGCGGG - Intronic
1064878559 10:20023048-20023070 AATTTTTTTTGGAAAAGTAATGG + Intronic
1065023715 10:21522112-21522134 AAGTTCTTTTGAAAACCTGAAGG + Intronic
1065384740 10:25123815-25123837 GGGTTCTTTTATAAAAGGGAGGG + Intergenic
1065687903 10:28303823-28303845 AAGTTCTTTAAGAGAGCTGAAGG - Intronic
1065807118 10:29404377-29404399 AAGTACATTTACAAAGGTGATGG - Intergenic
1066069842 10:31796644-31796666 AAGTTCTTTCAGTTCAGTGATGG + Intergenic
1066232120 10:33445974-33445996 AATTTCCTTTAGAAAATGGAAGG + Intergenic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1068064278 10:52109301-52109323 GTGTTCTTTTAGAAAAATGCGGG - Intronic
1068344191 10:55750041-55750063 AAGTTCATTTAAAAAAATAATGG - Intergenic
1068605604 10:59001912-59001934 AAATTCCTTTAGAAAAGACAAGG + Intergenic
1068770886 10:60819378-60819400 AATTTTTTGTAGAAGAGTGAAGG + Intergenic
1069011574 10:63379803-63379825 AAGTTGTTTTAACAAAATGAAGG + Intronic
1070854695 10:79597715-79597737 AAGCTATTTAAGAAAATTGAAGG + Intergenic
1071297198 10:84230414-84230436 AAGGTCTTTTGTAAATGTGAGGG + Intergenic
1072026296 10:91461897-91461919 ACTTTCTTTTTTAAAAGTGAAGG - Intronic
1072213644 10:93269932-93269954 AACTTTTTGGAGAAAAGTGATGG + Intergenic
1072478735 10:95789204-95789226 AAACTCATTTAGAAAAGTCAAGG - Intronic
1072518515 10:96210145-96210167 AAGGTCCTTTAGAAATGTTAAGG - Intronic
1072906574 10:99459448-99459470 AAGAGCTTTTAAAAAAATGATGG + Intergenic
1073867643 10:107823526-107823548 TCATTCTTTTAGAAAAATGAGGG - Intergenic
1073961924 10:108941542-108941564 AAGTTCTTTTAGGTAAAAGAGGG + Intergenic
1075111815 10:119593928-119593950 AAGTTCTTTTTTAAAAGTCCTGG - Intronic
1075685200 10:124359929-124359951 TACTTCTTTTAGAATAGGGAAGG + Intergenic
1077137080 11:1005701-1005723 GGGGTCTGTTAGAAAAGTGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079795499 11:24797799-24797821 AAGTTCTTTTATAAATCTGCTGG + Intronic
1080070969 11:28085847-28085869 AAGTTCTTATAGTGAAGTGTAGG - Intronic
1080366497 11:31580025-31580047 TATTTCTTTTTGCAAAGTGAAGG - Intronic
1080758362 11:35224003-35224025 AGATTCTTTTAGAAAAGGGGTGG - Intronic
1081177226 11:39943922-39943944 AAGTTGTTTTTTAAAAATGAAGG - Intergenic
1081196649 11:40169022-40169044 AAGTTATTTTATAAAACTCAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083089083 11:60181295-60181317 ATTTTCTTTTACAAAAGTAATGG - Intronic
1084034473 11:66500373-66500395 AACTTTTTTTAAAAAAGTGAAGG + Intronic
1085535940 11:77217608-77217630 AAATTAGTTTAGAAAAATGAGGG + Intronic
1086047641 11:82551541-82551563 AAGGTCTCTTAGCAAAGTGATGG - Intergenic
1086133372 11:83422771-83422793 CAGTCCTTTTGGAAGAGTGAGGG - Intergenic
1086181764 11:83960483-83960505 AAATTCTTTTACAAAAGAAAGGG + Intronic
1086815862 11:91369789-91369811 AAATGCTGTAAGAAAAGTGATGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087249316 11:95878533-95878555 AAGTTTTTGCAGAAAAGTGAAGG - Intronic
1087866640 11:103236468-103236490 CAGTTAATTTGGAAAAGTGAAGG + Exonic
1087897500 11:103602982-103603004 AAGTAATCTTAGAAGAGTGAAGG - Intergenic
1088103815 11:106183577-106183599 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1088157558 11:106827037-106827059 ATGGTCTCTTGGAAAAGTGAAGG + Intronic
1088343982 11:108801955-108801977 AATTTTTTTTAAAAAAGTGGGGG + Intronic
1088491244 11:110389945-110389967 AAGAAATTTAAGAAAAGTGAAGG - Intergenic
1089726874 11:120489078-120489100 AAGTTATATTAGAAAAGTTGAGG + Exonic
1090084121 11:123635966-123635988 AAGTTCTTTGAGAAATCTAATGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1090536223 11:127644772-127644794 AGGTACTTGTAGAAAACTGAGGG + Intergenic
1091701995 12:2669580-2669602 AAGTTCTTTTAGACAGGGGTTGG - Intronic
1093275609 12:17121380-17121402 AATTTTTTTTAAAAAAGTAAAGG + Intergenic
1093358773 12:18199450-18199472 TAGTCCTTTTACAAGAGTGAGGG - Intronic
1093630981 12:21408872-21408894 AAGTTGTTTTAGAAGAGCGTTGG - Intronic
1093635444 12:21461110-21461132 ATGGTCTCTTGGAAAAGTGAAGG - Exonic
1094146266 12:27231317-27231339 GGGTTCTCTTAGAAAAGGGAGGG - Intergenic
1094400990 12:30060314-30060336 TAGTTCTTTTGCAAGAGTGAGGG - Intergenic
1095341703 12:41097501-41097523 AAATTCTTTTAGAAAATAGAAGG - Intergenic
1095974009 12:47926999-47927021 AAGTGCTGTTTGGAAAGTGAAGG + Intronic
1097143227 12:56921098-56921120 AAGTTATATAAGAAAGGTGATGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097338543 12:58411984-58412006 AATTTGTTTTAGAATAGAGATGG + Intergenic
1098791025 12:74822136-74822158 ATTTTCTTTTAAAAAAGTGATGG + Intergenic
1098931025 12:76414145-76414167 AAGTTCTTTTCGATAAATGGTGG - Intronic
1100179211 12:92065856-92065878 TACTTCTTTTAGAGCAGTGAGGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101562177 12:105867366-105867388 AAGTTCTTGAAGGAAATTGAAGG + Intergenic
1102398240 12:112605995-112606017 AAATTCTGTTAAAAAAGTGGGGG + Intronic
1104055303 12:125225525-125225547 AAGTTCTTCCAGAAACATGATGG - Intronic
1104257181 12:127149586-127149608 AAGTTCTCTTAGAGAAGTTTAGG - Intergenic
1106216223 13:27702873-27702895 AAGTTATTCTTAAAAAGTGAAGG - Intergenic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1106677084 13:31972080-31972102 AATTCCTTTATGAAAAGTGAAGG - Intergenic
1106895021 13:34290654-34290676 ATGTTCTTTCTCAAAAGTGATGG - Intergenic
1107774112 13:43820063-43820085 AAGTGCATCTATAAAAGTGAAGG + Intergenic
1107918340 13:45176386-45176408 AACTTCATTTAAAAAAGAGACGG - Intronic
1108443671 13:50483871-50483893 AAGTACTTTTAGTATAGGGAAGG - Intronic
1109157788 13:58932654-58932676 AAGTTCTTCTAGAAAAGTTAAGG - Intergenic
1109641701 13:65200158-65200180 TAGCTCTTCTATAAAAGTGAAGG + Intergenic
1111384792 13:87511087-87511109 AATTTATTTTGGAAAAGGGAAGG + Intergenic
1111392544 13:87615928-87615950 AAAATCCTTTAGAATAGTGATGG + Intergenic
1111674619 13:91371531-91371553 AACATATTTTAGAAAAGTAAAGG + Intergenic
1111705038 13:91738209-91738231 AACTTCTTTTACAAAAGAGCAGG + Intronic
1112107320 13:96254833-96254855 AAGTTGTTCCAGAAAAGAGAAGG + Intronic
1112936863 13:104811278-104811300 AAATTGTTTTAGTACAGTGAAGG - Intergenic
1113598328 13:111549917-111549939 AATTTCTTTTATAAAATTAAGGG - Intergenic
1115125264 14:29985137-29985159 AAGTACTTTTTAAAAAATGAAGG + Intronic
1115482367 14:33873958-33873980 GAGTTCTCTTATAAAAGGGAGGG + Intergenic
1115519519 14:34219498-34219520 CAGTTTTTTTAAAAAAGTGAGGG - Intronic
1115614519 14:35081463-35081485 ATGATCTTTTAAAAAAGTTAAGG + Exonic
1115870236 14:37792433-37792455 AAGTTTTTTTAAAAAAATCAAGG - Intronic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1117174469 14:53132568-53132590 CAGTTCTTTTGCAAGAGTGAGGG - Intronic
1117960692 14:61158970-61158992 AAGTTGGGTTTGAAAAGTGATGG - Intergenic
1122175038 14:99910899-99910921 AAGATCCTTGAGAAAAGGGATGG - Intronic
1123824767 15:24069906-24069928 AAGTCTTTTTAGGAAAGTGTGGG + Intergenic
1124149194 15:27162019-27162041 AATTTTATTTATAAAAGTGAAGG + Intronic
1124855155 15:33380463-33380485 AAGTTCTTTTAGCCATGGGAAGG + Intronic
1125630813 15:41145586-41145608 CCTTTCTTTTAGAAGAGTGAAGG + Intergenic
1126355689 15:47793578-47793600 AAGTTTTTTTAAAAAAGAGTGGG - Intergenic
1126841414 15:52720936-52720958 AAGTTCTTTTAGATTAGGAATGG + Intergenic
1126841415 15:52721032-52721054 AAGTTCTTTTAGATTAGGAATGG - Intergenic
1127942731 15:63716191-63716213 AAGTCCTTTTAGAAAAACTATGG + Intronic
1128527063 15:68419668-68419690 AAGGGCTTTTAGAAACATGAAGG + Intronic
1129261375 15:74369727-74369749 AAGCTCTTTCAGAGAAGTGAGGG - Intergenic
1130730996 15:86492070-86492092 AAGTGCTCCTAGAATAGTGAGGG + Intronic
1130757754 15:86783929-86783951 AATTTTTTTAAGAAAAGTGGGGG - Intronic
1131289715 15:91096621-91096643 AAATTCTTGTGGAAAAGTTAAGG + Intergenic
1131864388 15:96691811-96691833 AAGTGCTTTCTGAAAGGTGAGGG - Intergenic
1133473723 16:6099805-6099827 GAGGTCTTTGAGAAAAGGGAAGG - Intronic
1134317244 16:13130032-13130054 AAGTTCTTTGAAAATTGTGAGGG - Intronic
1135893958 16:26381586-26381608 AACTTCTTTTTCAAAACTGAAGG + Intergenic
1138158493 16:54729446-54729468 AAGTTATTTTGGTAGAGTGATGG - Intergenic
1138891735 16:61150865-61150887 AAGTTATTTTAAAAAATTTATGG - Intergenic
1138898688 16:61242039-61242061 AATTTGTTTTCTAAAAGTGATGG + Intergenic
1142225642 16:88876228-88876250 AAGTTTTTTTAAAAAAGCAAAGG - Exonic
1143698271 17:8637041-8637063 AATTTGGTTTAGAAAAATGAAGG + Intergenic
1143896226 17:10138266-10138288 AAGTTCTTTTACAGATGTGAAGG + Intronic
1144206770 17:12984927-12984949 AAGTTCATAAAAAAAAGTGAGGG - Intronic
1144426679 17:15149489-15149511 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1146771929 17:35577009-35577031 AAGATCTTTTGGAAATGTTAAGG + Intronic
1147487279 17:40828807-40828829 AAGTTCCTTTAGAGAAGGGAGGG + Intronic
1147620024 17:41860068-41860090 ATGTTCTCTTAAAAGAGTGAAGG - Intronic
1148039426 17:44694918-44694940 AACTTCTTTTTAAATAGTGATGG - Intergenic
1148718470 17:49732832-49732854 AAATTCTTTTAGGACAGTGGTGG - Intronic
1151410034 17:73918383-73918405 AAATTCATTTAGAAAAGTAAAGG + Intergenic
1152156048 17:78633457-78633479 AGGTTATTTTATAAAAGTGAAGG + Intergenic
1152415792 17:80160925-80160947 AACATCTTTTAGAAAAATGGGGG + Intergenic
1153603224 18:6803619-6803641 AAACTCTTTCAGAAAATTGAAGG - Intronic
1155016498 18:21846155-21846177 AAATTCTTATGGAAATGTGAAGG - Intronic
1155530767 18:26764194-26764216 AAATTCTTTTATAAATTTGAAGG + Intergenic
1155738329 18:29252549-29252571 AAGGTCTTTTAGAAGATTGAAGG + Intergenic
1155901018 18:31390444-31390466 AAGTACTTTTAAAACAGTAAAGG + Intronic
1155936722 18:31762400-31762422 AGGTGCCTTTAGAAATGTGAAGG - Intergenic
1156318092 18:35989820-35989842 ATGTTCTTTTTGAAATGTGTAGG - Exonic
1156674189 18:39507735-39507757 AAATAATTTTAGAAAACTGAGGG - Intergenic
1157008698 18:43620104-43620126 AAGTTCATTTAGAAACTTCATGG + Intergenic
1158370473 18:56796863-56796885 TAGTTCTTTAAGAAATTTGAGGG + Intronic
1158762431 18:60405494-60405516 ATGTTCTTTTAGAAAAAGCAGGG + Intergenic
1159482329 18:69006329-69006351 AATTTGTGATAGAAAAGTGATGG - Intronic
1160321119 18:77896683-77896705 AACTTCACTTAGAAAAGTCAGGG - Intergenic
1160958000 19:1703049-1703071 AATTTTTTTTAGAAAAGAAAAGG + Intergenic
1162202014 19:9027315-9027337 AAATTTATTTGGAAAAGTGAAGG - Intergenic
1163108022 19:15138428-15138450 AATTTTTTTTAAAAAAGAGATGG - Intergenic
1164461337 19:28451388-28451410 ATGCCCTTTTAGAAAAGTGAAGG - Intergenic
1164491992 19:28723409-28723431 GACTGCTTTTAGAGAAGTGATGG + Intergenic
1164863122 19:31578799-31578821 ACTTTCTTTAAGAAAAGTGCAGG - Intergenic
1165367363 19:35376521-35376543 AAGTGGTTTTATTAAAGTGATGG - Intergenic
1166551920 19:43671314-43671336 AATTTCTTTTGGAAAGATGAGGG - Intergenic
1166825649 19:45607373-45607395 AAGTTCTGCTGGAAAAGTGCTGG - Intronic
1167198398 19:48046783-48046805 AAATTCTTTTAAAAAAGGGGGGG - Intergenic
1168182675 19:54672736-54672758 CATTTCTGTTAGAAAAGAGATGG - Intronic
925827845 2:7867534-7867556 AAGTTTTCTTTGAAGAGTGAAGG - Intergenic
925887699 2:8407329-8407351 AAGTACTTTTAGTAAATTGCTGG - Intergenic
926272482 2:11377181-11377203 AAATTTTTTTAGAAAAATGAAGG + Intergenic
926274360 2:11392259-11392281 AAGTTCTTTAAGAAAACACAAGG + Intergenic
926936886 2:18095008-18095030 ATGTTCTTTTAGAATAGTTCTGG + Intronic
928431735 2:31225132-31225154 AAATGCTTTTAGAAAAATAAGGG + Intronic
929131583 2:38579697-38579719 AAGGGCTTTGAAAAAAGTGAGGG + Intronic
929134696 2:38612572-38612594 AAGTTCTTTTAAACTAGGGAAGG + Intergenic
929197822 2:39204734-39204756 AAGTTCTTTTAGAAAAGTGAAGG - Intronic
929974065 2:46615064-46615086 AAGTTCTCCAAGAAGAGTGATGG + Exonic
930659305 2:54037888-54037910 AAATTCTTTCAGGAATGTGAAGG + Intronic
930759319 2:55015443-55015465 AAAATCTTTTAGAAAACTGAGGG + Intronic
931008219 2:57877523-57877545 TAGTTTGTTTAGAAAAGTAATGG + Intergenic
931013066 2:57941085-57941107 AAGTTTTTCTAGGAAACTGATGG - Intronic
931095687 2:58938234-58938256 AAGTTCTCTTAGAATATTGTGGG - Intergenic
931466013 2:62487533-62487555 AAGGGCTTTTAAAAAAGTGAGGG - Intergenic
931541673 2:63336131-63336153 AAGTTTATTTAAAAAAGTAAAGG - Intronic
933146446 2:78859689-78859711 AAATGATTTTAAAAAAGTGAGGG + Intergenic
933414121 2:81963323-81963345 TAGTTCTTTTATGAAAGTCATGG + Intergenic
933577418 2:84085443-84085465 AAGGTTTTTTAAAAAAGAGATGG + Intergenic
934073265 2:88405479-88405501 AAGTTATTTTTAAAAAGCGATGG + Intergenic
935180588 2:100687053-100687075 AAGTTTTTTTAGAAAATAAAAGG + Intergenic
935433366 2:103002243-103002265 AAACTCATTTACAAAAGTGAGGG + Intergenic
935900446 2:107786805-107786827 AAGTTCCTTGATGAAAGTGAGGG + Intergenic
936645502 2:114365091-114365113 GAATTGTTTTAGACAAGTGACGG + Intergenic
938132259 2:128726700-128726722 TAGTTTTTTTAGAAAAATCATGG - Intergenic
938706167 2:133929383-133929405 AACTTCTTTGAGAAATGAGATGG - Intergenic
939262264 2:139825567-139825589 AATCACTTTCAGAAAAGTGAAGG + Intergenic
940152685 2:150620119-150620141 AAGTTTTTTTTAAAAAGTGAGGG + Intergenic
940569296 2:155409914-155409936 ACGCCCTTTTAGAAGAGTGAAGG - Intergenic
940644750 2:156379327-156379349 GATTTGTTTTACAAAAGTGAAGG - Intergenic
941473548 2:165920557-165920579 AAATTCTTTTAGCAAGGAGAAGG + Intronic
941501753 2:166287351-166287373 AAAATCTTTTAGAATAATGATGG - Intronic
942100921 2:172582689-172582711 AAGTTCTTCAGGAAAAGGGAGGG - Intronic
943259195 2:185636529-185636551 AAGTTCTTTCTAAAAAATGAAGG + Intergenic
943971738 2:194417819-194417841 AAATTATTTTTGAGAAGTGAAGG - Intergenic
944389889 2:199206957-199206979 GAGTTTCTTTATAAAAGTGACGG - Intergenic
944620803 2:201514152-201514174 AAATTCTTCTAGAATACTGAAGG + Intronic
944996519 2:205300968-205300990 TGGTCCTTGTAGAAAAGTGAAGG - Intronic
945895453 2:215476314-215476336 AAGTTATTTAAAAAATGTGATGG + Intergenic
946227290 2:218270701-218270723 AAGATCTTGCAGAAAAGTGTGGG - Intronic
946834000 2:223754073-223754095 AACTTTTTTTAGAGAAGTGGGGG - Intronic
947474347 2:230429519-230429541 AAGTACATTTAGAGAAGTAATGG - Intronic
947955938 2:234191578-234191600 AAGTTGTTTTAGAAAGTAGAAGG + Intergenic
948211849 2:236200039-236200061 AAGGTCCATTAGAAAAGAGATGG + Intronic
948409110 2:237745349-237745371 AAGCTCTTGTTGAAAGGTGATGG - Intronic
1169389827 20:5180779-5180801 GGGTTCTCTTATAAAAGTGATGG - Intronic
1169568344 20:6880326-6880348 AAGTTTTTTTAAAAAAATAACGG - Intergenic
1169633444 20:7660240-7660262 AGGTTCTTTTAGACAAGAAATGG + Intergenic
1169722696 20:8696483-8696505 AAGTTCATATAGAAATGTTAAGG - Intronic
1170236406 20:14110178-14110200 TAGATCTTTTACAAACGTGAAGG - Intronic
1170239276 20:14145284-14145306 AAATTCTTTGAGAAAAGAGGTGG - Intronic
1171134017 20:22680459-22680481 AAATTCCTTTAGAAATGTCAAGG + Intergenic
1171721762 20:28570300-28570322 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171756299 20:29113199-29113221 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171785953 20:29464694-29464716 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1171862288 20:30412278-30412300 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1171949609 20:31409106-31409128 AAGTTTTTTTAAAATAGAGAAGG - Intronic
1173094918 20:40016636-40016658 AACTTCCTTTAGCTAAGTGAAGG - Intergenic
1174723157 20:52835102-52835124 TGCTTCTTTTAGAAAAATGAGGG - Intergenic
1174792445 20:53492780-53492802 AATTTCTTTTAGAAAGGGCAGGG + Exonic
1174882464 20:54295238-54295260 AAGGTCATTTAGTAAAGAGAAGG + Intergenic
1176455897 21:6910215-6910237 AAGGTCTTTTAGAAAGAGGAAGG + Intergenic
1176834071 21:13775263-13775285 AAGGTCTTTTAGAAAGAGGAAGG + Intergenic
1177187622 21:17815645-17815667 AAATTATTTTAGAAAAGAGGAGG - Intronic
1177218442 21:18159449-18159471 AAGTTCTCCTATAAAACTGAGGG - Intronic
1177514740 21:22134786-22134808 CTGTTCTTTTAGCACAGTGAAGG + Intergenic
1177534067 21:22401693-22401715 ATGCCCTTTTAGAAGAGTGAAGG - Intergenic
1178118485 21:29442696-29442718 AAGCACTTTTAGAAAACTAAAGG - Intronic
1178740699 21:35197935-35197957 AAGTTCCTTGAGAATAGAGATGG - Intronic
1179523054 21:41957819-41957841 AAATTCTTTTAGAAAAATGTGGG + Intergenic
1180295318 22:10928987-10929009 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG + Intergenic
1182133402 22:27876957-27876979 TAGTTCTTTTAGAATACTGTGGG + Intronic
1182193008 22:28483738-28483760 ACGTTCTTTTGGGAAATTGAAGG - Intronic
949607248 3:5666757-5666779 AAGTTATTTTTCAAAAATGAAGG + Intergenic
951239835 3:20274782-20274804 AAGTACTTTTAGAATCATGAAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955266167 3:57447430-57447452 AACTTCTTTTAGAAAAAGTACGG + Intronic
955891559 3:63655570-63655592 AAGTTATGTTAGACATGTGATGG - Intronic
956365074 3:68492378-68492400 ACTTTCTTTTATAAAAGTTAAGG + Intronic
956471481 3:69571543-69571565 AAGTAATTTTGGAAAAGTTAAGG + Intergenic
956960642 3:74396309-74396331 AAGTTCTTGAAGAAAATTAAAGG + Intronic
957594795 3:82249132-82249154 AAGTTCTGCCAGAAAACTGAAGG - Intergenic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
958766377 3:98372838-98372860 AAGATTTTTTAGTAAAATGATGG - Intergenic
960007139 3:112791689-112791711 AATTTCTCTTAGAAGAGTGTTGG - Intronic
960421065 3:117446014-117446036 AAACTCTTTCAGAAAAGTTATGG - Intergenic
960454731 3:117856650-117856672 AAGAGCTTTTGGAAAAGTAAGGG + Intergenic
960613425 3:119575704-119575726 AGGTTCTTTTACAAAAATCAGGG - Intergenic
961145447 3:124589255-124589277 AAGTTCCTTTACAAAGGTGTTGG + Intronic
961989546 3:131173213-131173235 AAGTTCATAGAGAAAAGTGGAGG - Intronic
962473400 3:135733512-135733534 AAACTATTTTAGAAAACTGAAGG - Intergenic
962490563 3:135889819-135889841 CATTTCTCTTAGAAGAGTGAGGG - Intergenic
962707671 3:138061226-138061248 AAGTTCTCGTAGGAAGGTGATGG - Intergenic
963100475 3:141598148-141598170 AAAGTCTTTTAGAAAACAGAGGG + Intronic
963122120 3:141785181-141785203 CAGTTCTTCCAGAAAAGTTAAGG + Intronic
963442347 3:145356039-145356061 TAGTTCCTTTAGTAAAATGAAGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
963653570 3:148015849-148015871 AAGTTATTTTCCAAAAGTGAAGG + Intergenic
963927912 3:150970724-150970746 AAATTCTGTGAGATAAGTGAGGG + Intronic
964852586 3:161110643-161110665 ATGTTCCTTTAGTAATGTGATGG - Intronic
965360969 3:167737122-167737144 AATTTCTTTTTGAAAAGAAATGG + Intronic
965723003 3:171682646-171682668 AAGTTCTACTAAAAAAATGAAGG - Intronic
965919032 3:173890181-173890203 AAATTCCCTTATAAAAGTGAAGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
968118089 3:196105018-196105040 AAGTTCATTTAAAAAAAAGAAGG + Intergenic
968323232 3:197790403-197790425 AAGCTATTTTATAAAAGGGATGG + Intergenic
969419674 4:7085032-7085054 AGGTTCTCTTATAAAAGGGAGGG - Intergenic
969808725 4:9631449-9631471 AAGTCCCTTCAGAAAAGGGAGGG - Intergenic
969841277 4:9884271-9884293 CAATTTTTTTAGAAAAGAGATGG + Intronic
970108021 4:12607037-12607059 AATTTATTTTAGAAATTTGAAGG - Intergenic
970240621 4:14004817-14004839 AAGTTGTTTTAAAAAAGCTAAGG - Intergenic
970380694 4:15504409-15504431 AAGTTCTTTTGGCAAGCTGATGG - Intronic
970618252 4:17788806-17788828 AAGTGCTTTTTGAAAATTGGTGG - Intergenic
971882435 4:32394916-32394938 ACTTTATTTTAGAAAAGAGAAGG + Intergenic
972248382 4:37271719-37271741 AAGTTGTTAAACAAAAGTGATGG + Intronic
972832374 4:42829539-42829561 AAGTTCTATGCTAAAAGTGATGG - Intergenic
973088835 4:46105709-46105731 AAGTAATTTTAGAAAATTGGAGG - Intronic
973270931 4:48262670-48262692 GACTTCGTTTAGAAAAGGGAAGG + Intronic
974493805 4:62602006-62602028 AATTTGATTTTGAAAAGTGAAGG - Intergenic
975140879 4:70917106-70917128 ATGCCCTTTTAGAACAGTGAAGG + Intronic
975567141 4:75769484-75769506 AAATTCTTTTCTAAATGTGAGGG - Intronic
976047810 4:80973291-80973313 AGGTTTTTTTAAAAAAGTAATGG - Intergenic
976292960 4:83439733-83439755 AAGTTGTTTTAGTATACTGAAGG - Intronic
976644006 4:87368512-87368534 GAGTTCTCTTATAAAAGGGAAGG + Intronic
977381283 4:96277538-96277560 AAGTATATTTAGAAAAGAGATGG - Intergenic
977603285 4:98957003-98957025 ATGATCTTTTAAAAAAGTTAAGG + Intergenic
977673891 4:99726685-99726707 GAGTTCTCTTATAAAAGGGAGGG - Intergenic
977782173 4:100993456-100993478 AAGTCCTTTTGCAAGAGTGAAGG + Intergenic
979144561 4:117226235-117226257 CAGGTATTTTAGAAAATTGAAGG + Intergenic
979232341 4:118359649-118359671 AAGTTTATTAAGAAAAGTAAAGG - Intergenic
979666869 4:123321378-123321400 AAGTTCTTTTTGACATCTGAAGG - Intergenic
980937018 4:139235247-139235269 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
981436564 4:144730480-144730502 GACTTCATTTAGTAAAGTGAAGG + Intronic
981904655 4:149908020-149908042 AAATTTATTTAGAAAAGTAATGG + Intergenic
982648135 4:158049709-158049731 GAATACTTTTAGAAAAATGATGG - Intergenic
983129626 4:164001010-164001032 AAGAAATTTTAAAAAAGTGATGG + Intronic
983639898 4:169935424-169935446 AAGTTTGTTTAGAAAGGCGAAGG - Intergenic
983680882 4:170352249-170352271 AACTTCTTTTAGAAAAGGAATGG - Intergenic
984155208 4:176187956-176187978 CAGTTCTTTATGATAAGTGAAGG - Intronic
984463393 4:180064459-180064481 AAGTTTATTTAGAAAACTGGTGG - Intergenic
985352352 4:189078541-189078563 ATAGTCTTTTAGAAAATTGATGG - Intergenic
985878723 5:2620653-2620675 AAGTCCTTATAGAAAAATGCAGG + Intergenic
986490818 5:8287690-8287712 AATTACTTTTAGAAAAGTCAGGG + Intergenic
986650158 5:9955310-9955332 AAATTATTTCATAAAAGTGATGG - Intergenic
986906380 5:12498770-12498792 AAATAGTTTTAGAAAATTGAAGG + Intergenic
986971008 5:13336703-13336725 CAATTCTTACAGAAAAGTGAAGG + Intergenic
987131331 5:14862813-14862835 AAGTGATTTTTGAAAAGTCAAGG - Intronic
987610008 5:20190909-20190931 AACTTCTACTAAAAAAGTGAAGG + Intronic
987677102 5:21088943-21088965 AAGTTCTTATGGAAAAGGGAAGG - Intergenic
988020781 5:25617778-25617800 ATTTTCTTTTACAAAATTGAAGG - Intergenic
988372927 5:30395800-30395822 AAGTATTTTTAAAAAAATGATGG - Intergenic
988383757 5:30535034-30535056 AAATTCTTTTATGAGAGTGATGG + Intergenic
989037222 5:37187994-37188016 AAGTCCTTATATAAAAGTCATGG + Intronic
989117753 5:37972254-37972276 AAACTCTTTTAGAAAATAGAGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990021936 5:51138361-51138383 AAGTTCTTCAAGTTAAGTGATGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990541383 5:56776274-56776296 AAGTTCATTTTGAAAAGTAGGGG + Intergenic
991556400 5:67899696-67899718 AAGTTCTTGTTGACAAGTGATGG - Intergenic
992660776 5:78958574-78958596 ATATTCTTTTATAAAAGTGATGG - Intronic
994438791 5:99774528-99774550 AAATGCTTTTAGAAAAGGGAGGG - Intergenic
994874810 5:105405848-105405870 AAGTTCCTGAAGAAAAGAGAAGG + Intergenic
995196036 5:109369633-109369655 AAGTTCTTTGGGAAAAAGGAAGG - Intronic
995395217 5:111680152-111680174 AATTTATTTTAGAAAAGTACTGG - Intronic
995974546 5:118017195-118017217 AATTTGTATTAGAAAACTGATGG - Intergenic
996063982 5:119061494-119061516 GATTTCTTTTAGAAAAGTAATGG - Intronic
996720019 5:126621039-126621061 AAATTCTTTTTAAAAAGAGACGG + Intronic
996805185 5:127446711-127446733 AGGCCCTTTTAGGAAAGTGAAGG + Intronic
997175354 5:131770431-131770453 ATGTTCTTTTAGAAAAACCAAGG + Intronic
997488307 5:134250636-134250658 AATTTCTTATAGAGATGTGAGGG + Intergenic
999599208 5:153242175-153242197 AAGTTCTTGGAGAAAAGTTTGGG - Intergenic
1000588910 5:163134482-163134504 AAGTATATTTAGAAAAGTGATGG - Intergenic
1001733502 5:173978668-173978690 AAGTTCAATTAGAAAAGAAATGG - Intronic
1002611641 5:180422826-180422848 AAATTCTTATGGAAATGTGAAGG - Intergenic
1002717354 5:181235751-181235773 ATGTTCTTTGGGAAAAGGGAAGG + Exonic
1002984631 6:2176956-2176978 GAGCTCTTTTAGGAAAGGGATGG + Intronic
1003361914 6:5434810-5434832 AAGTTCTCTTTTAAAAGAGAAGG - Intronic
1003925734 6:10876208-10876230 TAGTTCTTTTAATAGAGTGAAGG - Intronic
1004717760 6:18234638-18234660 AAGTGCTGTCAGAAAATTGAAGG - Intronic
1005569784 6:27133533-27133555 AAGTTCTTTTAGAGAAGACGTGG - Exonic
1006205662 6:32339930-32339952 AAGTTGTATTAGAAATGTTATGG + Intronic
1008344866 6:50414064-50414086 AAGTAATTTTACAAAAATGATGG + Intergenic
1008897033 6:56567803-56567825 AAGTTTTTTTAAAAAAATAATGG - Intronic
1008973544 6:57398356-57398378 AAGTTCTTTTAAACTAATGAGGG - Intronic
1009028913 6:58033832-58033854 AAGATCTTCTAGAAAATTGTGGG - Intergenic
1009162445 6:60299908-60299930 AAGTTCTTTTAAACTAATGAGGG - Intergenic
1009204452 6:60785205-60785227 AAGATCTTCTAGAAAATTGTGGG - Intergenic
1009278477 6:61716550-61716572 AGGTTTTTTTAAAAAAATGAAGG - Intronic
1009386987 6:63097017-63097039 AATTTCTTTTAGATATCTGAAGG - Intergenic
1009827845 6:68890406-68890428 AAGTTCCTTTAAAAAAGTTTGGG - Intronic
1010487751 6:76435579-76435601 AAATTCTTATAGTAAAATGATGG - Intergenic
1011025550 6:82865352-82865374 ATGTTCTGTTAGAAAAATGAAGG - Intergenic
1011341867 6:86324826-86324848 AAGCCCTTCTAGAAGAGTGAAGG - Intergenic
1012030129 6:94049283-94049305 ATGGTGTTTTAGAAATGTGAAGG + Intergenic
1012187495 6:96237768-96237790 AAGTACTTTTAGAGAATTGTTGG - Intergenic
1012325863 6:97916512-97916534 ACGTTCATATAGAAAAGTTATGG + Intergenic
1012329681 6:97969064-97969086 AATTACTTTTAAAAATGTGAAGG + Intergenic
1012412857 6:98979440-98979462 AAATTCTGTTAGAAAACTTAGGG - Intergenic
1012523145 6:100144749-100144771 AAGTTCTTTTAAAAATCAGAAGG + Intergenic
1014265143 6:119268879-119268901 GAGTTGTTTTAGAAAAATGAGGG - Intronic
1014589107 6:123240384-123240406 AAATTATTTTAGAAATGGGAAGG + Intronic
1015563272 6:134539186-134539208 AAGTTCCTTTAGGAAACTCACGG + Intergenic
1016173002 6:141042134-141042156 GAGATCTTTTAGCAAAGAGAGGG - Intergenic
1016455961 6:144231026-144231048 AAGTTTCTTTAGAACATTGAAGG + Intergenic
1016477872 6:144447921-144447943 AACTTACTTTAGAAAACTGAAGG - Intronic
1016594332 6:145782420-145782442 AAGTAATTTTAAAAGAGTGAAGG + Intergenic
1016798240 6:148141185-148141207 TAGTTCTTTTAGAAAAGTTAGGG - Intergenic
1016861078 6:148719474-148719496 AAGTTTTTTTAAAAAAAAGAGGG + Intergenic
1016902840 6:149118846-149118868 AAGTTCTCCCAGAAAAGTGTGGG + Intergenic
1016960537 6:149668750-149668772 AAGTTCTTTTAAAGAACTCAAGG - Intronic
1017908252 6:158771485-158771507 TTGTTCTTTTAGAAAAGTTCTGG - Intronic
1018602549 6:165560581-165560603 AATTTACTTTAGAAAAGTAAAGG - Intronic
1019080808 6:169428327-169428349 AAGTACTTTCAGAAAAGTTAGGG + Intergenic
1019140948 6:169942041-169942063 ACGTCCTTCCAGAAAAGTGAGGG - Intergenic
1020439890 7:8206170-8206192 AAGTTCTCCTAGAACAGTGGAGG + Intronic
1020857106 7:13442526-13442548 AAGTATTTTTAAAAAAGTAATGG + Intergenic
1021090980 7:16482177-16482199 AATTTCTGTTTGCAAAGTGAAGG - Intronic
1022274723 7:28843976-28843998 GAGTTATATGAGAAAAGTGAAGG - Intergenic
1022738396 7:33098080-33098102 AAGTTCTCTTAGAATATTAATGG + Intronic
1023516210 7:41004359-41004381 CATTTCTTTTGGCAAAGTGAAGG + Intergenic
1023540853 7:41264419-41264441 AAGTGCTTTCAGAAAAGAAAAGG - Intergenic
1024008693 7:45248186-45248208 AAATTATTTTTGAAAAGTGAAGG + Intergenic
1025783816 7:64625748-64625770 GCTTTCTTTTAGAAAAGAGATGG - Intergenic
1026488949 7:70846157-70846179 TAGTTCCTTTAGTAAAATGAAGG - Intergenic
1026489204 7:70848260-70848282 TAGTTCCTTTAGTAAAATGAAGG - Intergenic
1026685757 7:72508542-72508564 AAGATTAATTAGAAAAGTGAAGG + Intergenic
1027397681 7:77772965-77772987 AAGGTATATTAGAAAAATGAGGG + Intronic
1027409163 7:77895675-77895697 GAGTTCTTTTAAAAAAGAGGAGG - Intronic
1027870138 7:83696222-83696244 AAGTGCTATTAGTACAGTGAGGG + Intergenic
1029222476 7:99001266-99001288 AGGTGCTCTTTGAAAAGTGAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030167860 7:106572503-106572525 AAGATACTTAAGAAAAGTGAAGG - Intergenic
1030365589 7:108642172-108642194 AAATTCTTTTACAAAATTGCAGG - Intergenic
1030707362 7:112708084-112708106 AAGTTCTTTTAAGAATGTGAAGG + Intergenic
1030839646 7:114332914-114332936 TAGTTCTTTCAGAGAAGTAAGGG - Intronic
1031342327 7:120618593-120618615 CAATTATTTTAGAAAAGTGCAGG + Intronic
1031406452 7:121393103-121393125 AAAATGTTTTAGAAACGTGACGG + Intronic
1031686576 7:124737423-124737445 AAATTCTTTTTCAAAAGCGAAGG - Intergenic
1031956011 7:127943367-127943389 AAATTCTTTTGAAAAAGTGATGG + Intronic
1032373088 7:131379850-131379872 AAATTTTTTTTCAAAAGTGATGG + Intronic
1032778664 7:135143852-135143874 AATTCCTGTAAGAAAAGTGAGGG + Intronic
1032950353 7:136902029-136902051 AAATTGTATTAGATAAGTGAAGG + Intronic
1033512614 7:142074701-142074723 ATGTTCTGGTAGAAAAGAGAAGG + Intronic
1033705096 7:143878924-143878946 GAGTGGTTTTAGAAAAGTAAAGG - Intronic
1034857798 7:154569184-154569206 AAGTAATTTTAGAAAAGGGAGGG + Intronic
1035882952 8:3262078-3262100 AAGTTCAATTAAAAAAGTAAAGG + Intronic
1036227885 8:6975237-6975259 AAGACCTTTTAAAAATGTGAAGG + Intergenic
1036230338 8:6994354-6994376 AAGACCTTTTAAAAATGTGAAGG + Intergenic
1036232790 8:7013457-7013479 AAGACCTTTTAAAAATGTGAAGG + Intronic
1037125973 8:15350155-15350177 AAATTCATTTAGAAATGTAAAGG + Intergenic
1037229588 8:16640327-16640349 AAATTATTTTTCAAAAGTGAAGG - Intergenic
1038308736 8:26428648-26428670 AAGTCCTTTTTGAAAGGGGATGG - Intronic
1038720937 8:30034779-30034801 CATTTCTGTTAGAAAAGAGATGG + Intergenic
1039374300 8:37017781-37017803 AAGTTATATTACAAAAATGATGG - Intergenic
1040797481 8:51301733-51301755 AAGTTCTTTGAGAAATCTGAGGG + Intergenic
1041206975 8:55509846-55509868 ACTTTCTTTTAGAAAAGCGCTGG - Intronic
1041851006 8:62393117-62393139 TAGTTCTTTAAGAAAAATCATGG - Intronic
1043027213 8:75084850-75084872 ATGTTGTTTTAGCACAGTGATGG + Intergenic
1043112503 8:76204314-76204336 AAATTCTGTAAGAAAAGTGAGGG - Intergenic
1043144147 8:76630798-76630820 AAGTTATCTTTCAAAAGTGAAGG + Intergenic
1043862743 8:85339702-85339724 AAGTTCTTGGAGAAAATTAAAGG + Intronic
1044269905 8:90229962-90229984 AAATTCTAGTAGAAAAGTGGTGG + Intergenic
1044337703 8:91006988-91007010 AAGATCTTATAGAAAAGAAAAGG - Intronic
1044428901 8:92085874-92085896 GAGTTGTTTTGGAAAAGTAAAGG - Intronic
1045184399 8:99822282-99822304 AAGTCTTTTGAGAAAAGTTAGGG + Intronic
1045428569 8:102091918-102091940 GGGTTCTTTTATAAAAGGGAGGG + Intronic
1045533099 8:103002750-103002772 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1046143363 8:110123247-110123269 AAAAACATTTAGAAAAGTGATGG + Intergenic
1046261163 8:111769762-111769784 GAGTTCTTTTAGAAAATCCATGG + Intergenic
1046324556 8:112623779-112623801 AATTTCTTTAAGACAAATGATGG - Intronic
1046337438 8:112808447-112808469 AAGTCCTTGAAGAAAAGTGGGGG - Intronic
1046677545 8:117127229-117127251 AAGTTCTTAGGGAAAAATGATGG + Intronic
1047028333 8:120849131-120849153 AGCTCCTTTTAGAAAAATGAAGG - Intergenic
1048056629 8:130873084-130873106 AAGTTCGTTTACAGAGGTGATGG + Intronic
1048501456 8:134979300-134979322 AAGTTATTTTAAAAAAGAAAAGG - Intergenic
1049961056 9:738525-738547 AAGTACTGTTAGAGAAGAGAGGG - Intronic
1050274293 9:3980670-3980692 AATTTCTTTTCAAAAAGTGCAGG + Intronic
1050314545 9:4387958-4387980 ATGCCCTTTTAGAAGAGTGAAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050735058 9:8752513-8752535 AAGTTTATTAAGAAAAGTAAAGG - Intronic
1051086260 9:13352373-13352395 AAGTTTTGTTAGAGAAGGGAAGG + Intergenic
1051991524 9:23158383-23158405 AAGTTCATTTTAAAAAGGGATGG + Intergenic
1052118902 9:24684209-24684231 AGGTTCTTTTGGAAAAGAAATGG + Intergenic
1053185170 9:36009859-36009881 ATGTTTTTTTATAAAAGTAAGGG + Intergenic
1054839781 9:69724672-69724694 AAATTCTTTAATAAATGTGATGG - Intronic
1055200287 9:73650217-73650239 AAGTACTTTAAGAAAATAGAGGG + Intergenic
1055378631 9:75681045-75681067 AAAATCTTTTAGAAAATAGATGG + Intergenic
1055412024 9:76040992-76041014 AAATGCTTTTGGAAAACTGATGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056077849 9:83059864-83059886 ATTTTCTCTTAGAAAATTGAGGG - Intronic
1056079935 9:83081651-83081673 ATGTTCTATTCTAAAAGTGATGG - Intergenic
1057401606 9:94728040-94728062 GAGTCCTTTAAGAAAAGTGCAGG - Intronic
1058312744 9:103525751-103525773 ATGCTCTTTCAGAAGAGTGATGG - Intergenic
1058821789 9:108738567-108738589 AAACTCTTTTAGAAAATAGAAGG + Intergenic
1059382766 9:113940668-113940690 AAGTTTTTTTACAAAAATAATGG - Intronic
1059532661 9:115050597-115050619 AAGTTCTCTTAAAAACGAGAGGG + Intronic
1059843896 9:118249497-118249519 AATTGATTTTAAAAAAGTGAAGG + Intergenic
1060079386 9:120627922-120627944 AAGTTCATTTTTAAAAGTGGAGG - Intronic
1060136660 9:121162949-121162971 ATGGTCTTTTAGAAAAATGTTGG + Intronic
1061468211 9:130800235-130800257 AAGTACTTTTAAAAAAATTAAGG + Intronic
1061976712 9:134071966-134071988 AACTTCTCTTAGAAAAGGGTGGG + Intergenic
1062442855 9:136578899-136578921 AAGTGCTTGTGGGAAAGTGAGGG + Intergenic
1202802194 9_KI270720v1_random:10091-10113 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1203446753 Un_GL000219v1:63862-63884 AAGTCCTTCTAGAAGAGTGAAGG - Intergenic
1186368044 X:8916005-8916027 GATTTCTTTTAGAAACTTGATGG - Intergenic
1187825705 X:23332839-23332861 AAGTTCAGTTTGAGAAGTGAAGG + Intergenic
1188306426 X:28565152-28565174 AAGTTCTTTTAGTAAGTTAAAGG - Intergenic
1188872078 X:35384906-35384928 AAATTATTCTAGAAAAGAGAAGG - Intergenic
1188944648 X:36284116-36284138 AAGTGCTTTTATAAAATTGAAGG + Intronic
1190529027 X:51356362-51356384 AAATTCTGTTAGGCAAGTGAGGG + Intergenic
1190538497 X:51453614-51453636 AAATTATTTTTCAAAAGTGAAGG - Intergenic
1191652635 X:63557730-63557752 GAGATCTTTTAGAAAAGTAAGGG - Intergenic
1192542261 X:71984073-71984095 GGGTTCTCTTATAAAAGTGAGGG - Intergenic
1192696204 X:73418621-73418643 AAGCTGTCTTAGTAAAGTGAAGG - Intergenic
1192975853 X:76284384-76284406 GAGTTCTTTTCTAATAGTGAAGG + Intergenic
1193507940 X:82365611-82365633 ATGCCCTTTTAAAAAAGTGAAGG + Intergenic
1193917802 X:87387539-87387561 AAGTTGTTTGAGGAAAGTCATGG - Intergenic
1194445220 X:93979160-93979182 AAGTTCTGTGAGATAATTGATGG - Intergenic
1195370916 X:104171550-104171572 AACTTATTATAGAAAACTGAGGG + Intronic
1195453963 X:105047056-105047078 AAGTTCTGTTAGGCAAGGGAGGG - Intronic
1196595195 X:117537777-117537799 ATTTTTTTTTAGAAAAGGGAGGG - Intergenic
1197243087 X:124140575-124140597 ATGCACTTTTAGAAAAGTGAAGG + Intronic
1197500029 X:127230922-127230944 TAGTCCTTTTACAAGAGTGAGGG - Intergenic
1197577367 X:128232027-128232049 AAGCTCTTCTTCAAAAGTGAGGG + Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1198875581 X:141222377-141222399 TAGTTCTTGTAGTAAACTGATGG - Intergenic
1199140738 X:144308904-144308926 AAGTTCTTTGAGAAGAGAGTAGG - Intergenic
1199315856 X:146377015-146377037 AAGTAATTTTAGAAAAAAGATGG + Intergenic
1199732510 X:150650370-150650392 AAGTACTTTTTAAAAAGTGGAGG - Intronic
1201406503 Y:13655431-13655453 AAGTTCATAGAGTAAAGTGAAGG - Intergenic
1201681581 Y:16650920-16650942 ATGTTCTTTTATAATAGTAAAGG + Intergenic
1201759554 Y:17522030-17522052 AAGTTATTTTAGTCATGTGAGGG - Intergenic
1201842000 Y:18383960-18383982 AAGTTATTTTAGTCATGTGAGGG + Intergenic