ID: 929200332

View in Genome Browser
Species Human (GRCh38)
Location 2:39228574-39228596
Sequence GCAGGAAGTGCGGAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 314}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929200332_929200335 1 Left 929200332 2:39228574-39228596 CCAGCAGCTTCCGCACTTCCTGC 0: 1
1: 0
2: 3
3: 29
4: 314
Right 929200335 2:39228598-39228620 TACTCAGAAATGCAGAATCTCGG 0: 1
1: 2
2: 19
3: 160
4: 592
929200332_929200336 2 Left 929200332 2:39228574-39228596 CCAGCAGCTTCCGCACTTCCTGC 0: 1
1: 0
2: 3
3: 29
4: 314
Right 929200336 2:39228599-39228621 ACTCAGAAATGCAGAATCTCGGG 0: 1
1: 9
2: 73
3: 396
4: 1303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929200332 Original CRISPR GCAGGAAGTGCGGAAGCTGC TGG (reversed) Intronic
900354129 1:2251846-2251868 GCAAGAAGGGGAGAAGCTGCAGG - Intronic
900707457 1:4089603-4089625 GCAGGGGAAGCGGAAGCTGCTGG - Intergenic
900720411 1:4172281-4172303 GGAGGAGGTGTGGGAGCTGCAGG - Intergenic
901057505 1:6455489-6455511 GCAGGCGGTGGGCAAGCTGCTGG + Intronic
902044238 1:13513407-13513429 CCTGGACGTGCGCAAGCTGCTGG - Exonic
902425547 1:16318730-16318752 GGAAGAAGTGCAGAAGCAGCAGG + Intronic
902891313 1:19445987-19446009 GCAGGAACAGAGGAAGCTGGAGG + Intronic
904293652 1:29503897-29503919 GCAGGGTGTGAGGAGGCTGCAGG + Intergenic
905897900 1:41560652-41560674 CAAGGAACTGCTGAAGCTGCTGG + Intronic
906114836 1:43349475-43349497 GCAGGAAGTGGCGAAGCCGTAGG - Intronic
906522346 1:46474939-46474961 GCAGGAAGGAAGGCAGCTGCGGG + Intergenic
907423813 1:54365733-54365755 GCAGGGTGTGCAGAAGCTGTTGG - Intronic
912078387 1:105907266-105907288 GCAGGCAGTGGTGAAGCTGTGGG + Intergenic
912320252 1:108706332-108706354 GCAGGAAGTGAGGCAGCTTCAGG - Intergenic
913167635 1:116203295-116203317 CCAGGCACTGCGGAAGCTGCTGG + Intergenic
913518143 1:119622612-119622634 GAAGGAAGTGGGGAAGGGGCGGG - Exonic
915456163 1:156042158-156042180 GCAGGAAGACTGGGAGCTGCAGG + Exonic
915596309 1:156898261-156898283 TCAGGAAATGGGGCAGCTGCAGG - Intronic
915624281 1:157105437-157105459 GAAGGAAGAGCTGAGGCTGCAGG - Intergenic
917286840 1:173430065-173430087 GCAGGAAGGGTGGAGCCTGCTGG - Intergenic
919683935 1:200463630-200463652 GCACAAAGTTAGGAAGCTGCAGG + Intergenic
919728999 1:200901062-200901084 GCAGGAGGAGAAGAAGCTGCAGG + Exonic
919737254 1:200960439-200960461 GCAGACAGTGAGCAAGCTGCTGG - Intergenic
920268256 1:204743175-204743197 GGAGCAAGTGCTGCAGCTGCTGG - Intergenic
921839128 1:219809751-219809773 GCAGGAAATGCGGTGGCGGCTGG - Intronic
923850969 1:237794283-237794305 GCAGGAAGTGCATGACCTGCAGG + Intronic
924235850 1:241999082-241999104 GCAGGCAGTTTGGAAGCAGCTGG - Intergenic
924798308 1:247308927-247308949 GCAGGATGTGCGGAGTGTGCAGG - Intronic
1064622987 10:17233766-17233788 GCAGGAAATCCAGGAGCTGCAGG + Exonic
1064691970 10:17927578-17927600 GCAGGAAGTGGGAAAGAAGCTGG + Intergenic
1064751663 10:18536719-18536741 GCAGGATGTACGGAAGCTTTTGG - Intronic
1066389080 10:34964362-34964384 GCAGGCAGAGCGGCAGCCGCAGG + Intergenic
1067314889 10:45151870-45151892 GGAAAAAGTGCGGTAGCTGCTGG - Intergenic
1067771804 10:49131882-49131904 GCAGGAGCTGCGGGAGCCGCCGG - Exonic
1067848182 10:49739136-49739158 GCAGGAAGGGAGGAAGGAGCAGG - Intronic
1069990166 10:72310322-72310344 CCAGGAAGTGCTGAATCAGCGGG + Intergenic
1070302142 10:75211127-75211149 GCGGGAAGAGGGGAATCTGCGGG - Exonic
1071502389 10:86213094-86213116 GCAGGAGGTGGGGTTGCTGCAGG - Intronic
1073113864 10:101079932-101079954 GAAGGGAGTGGGGAGGCTGCAGG - Intergenic
1073155279 10:101341671-101341693 GCAGGAAGTGGGGAAAAGGCAGG - Intergenic
1073513273 10:104055980-104056002 GGAGGAGGTGAGGAAGCTGAAGG - Exonic
1073593656 10:104779550-104779572 GGAGGAAGTGTGAAGGCTGCCGG + Intronic
1074492086 10:113947391-113947413 GCAGGTACTGAGGAAGCTGGGGG - Intergenic
1075263045 10:120979479-120979501 CCAGGAGGTGCGGATGCTGCCGG + Intergenic
1076014426 10:127015964-127015986 GCAGGAAGTGAGGGAACTGCAGG - Intronic
1076359581 10:129877950-129877972 GAGGGAAGTGTGGAAGCTGTGGG - Intronic
1076655691 10:132022022-132022044 GCAGCAGGTTAGGAAGCTGCAGG - Intergenic
1076891077 10:133283712-133283734 GCAGGGAGTGCGGGAGAGGCAGG - Intronic
1076984218 11:223681-223703 ACAGGAAGGTGGGAAGCTGCTGG - Intronic
1077118424 11:895905-895927 GCAGGAAGGTGGGGAGCTGCGGG - Intronic
1078040016 11:7851634-7851656 CCAGGAACTGCAGAAGGTGCTGG - Intergenic
1078577333 11:12513428-12513450 GCAGGAAGCTCGCAAGCTGCAGG - Intronic
1079130804 11:17745837-17745859 GCACGAAGTGGGGAAGGGGCCGG - Intronic
1083366503 11:62144789-62144811 GGAGGAAAGGCGGGAGCTGCGGG + Intronic
1083743248 11:64722176-64722198 GCAGGGGGAGAGGAAGCTGCAGG - Intronic
1083764836 11:64836751-64836773 GAAGGAAGTGCAGACTCTGCGGG - Exonic
1084083311 11:66843165-66843187 GCAGGACGTGCTGTGGCTGCAGG + Exonic
1084189708 11:67493394-67493416 GCAGGAGGTGCGGCGGCTGGGGG - Exonic
1084560852 11:69904813-69904835 GCAGGAAGTGGGGACACTGTGGG - Intergenic
1085527342 11:77172092-77172114 GGAGGAGGGGCGGGAGCTGCCGG - Intronic
1085638181 11:78174096-78174118 GCAGGAGGTGCTGAAGATGTTGG + Exonic
1088984335 11:114892277-114892299 GGAGGAAGGGAGGTAGCTGCTGG + Intergenic
1089128482 11:116193808-116193830 GCAGGCAGGGGGAAAGCTGCGGG - Intergenic
1089402012 11:118169716-118169738 GCAGGCAGGGTGGGAGCTGCTGG + Intronic
1089479531 11:118792858-118792880 GCAAGAAATAGGGAAGCTGCCGG - Intergenic
1089678495 11:120106423-120106445 GCAGGATGTGCAGAGGATGCAGG - Intergenic
1091385442 12:91830-91852 GAAGGAAGAGGGGAAGCTGGGGG - Intronic
1092231456 12:6777951-6777973 GATGGAAGAGCGGGAGCTGCTGG - Intronic
1094050576 12:26216275-26216297 CCAGGAAATGCTGATGCTGCCGG - Intronic
1094168623 12:27467513-27467535 CCAGGAAGCGCTGAGGCTGCTGG + Intronic
1096435001 12:51582054-51582076 GAAGGAGGTGAGGAAGCTTCAGG + Intergenic
1096440373 12:51637629-51637651 GAGGGAGGTGAGGAAGCTGCAGG + Intronic
1098399150 12:70054684-70054706 GCACAAAATGGGGAAGCTGCAGG - Intergenic
1102176563 12:110880004-110880026 ACAGGCAGTGCTGGAGCTGCTGG - Exonic
1102179865 12:110904472-110904494 GCAGGAAGTACAGGAGGTGCGGG - Intronic
1102464235 12:113119208-113119230 GGATGAAGTGCTGGAGCTGCGGG - Exonic
1102513185 12:113429245-113429267 GCAGGTGGTGCAGAGGCTGCAGG + Exonic
1102751766 12:115300788-115300810 CCAGGAGGTGCTGATGCTGCTGG + Intergenic
1102946175 12:116990374-116990396 CCAGGAAGTGGGGAAGGAGCAGG + Intronic
1103318001 12:120072656-120072678 GAGGGCAGTGCGCAAGCTGCCGG - Exonic
1104179842 12:126368655-126368677 GCAGGAAGTGTGGCAGGTGCAGG + Intergenic
1104830501 12:131747621-131747643 GCAGGAGGTGCTGCAGCTGGAGG + Intronic
1104950827 12:132439171-132439193 GCTGGAGGTGATGAAGCTGCAGG + Intergenic
1107634387 13:42377700-42377722 GAAGGAAATGGGGAAGCTGTGGG + Intergenic
1110151331 13:72258455-72258477 GCGGGAAGTTAGGAAGCAGCAGG + Intergenic
1110630138 13:77697991-77698013 GCTGGAGGTGAAGAAGCTGCAGG + Intronic
1111882485 13:93975039-93975061 CCAGGCAATGCTGAAGCTGCTGG - Intronic
1113048458 13:106182649-106182671 GCAGGAAGTGGTGAAGTTGCGGG + Intergenic
1113386694 13:109855360-109855382 GCAGGCAGTGGGGTAGCCGCTGG - Intergenic
1113702738 13:112399346-112399368 GCAGGGGGTGAGGAAGCTGGGGG - Intronic
1114416812 14:22550423-22550445 ACAGGAGGTGCAGGAGCTGCAGG + Intergenic
1114490171 14:23095494-23095516 GCCGGAAGTGCGTGGGCTGCCGG + Exonic
1114565874 14:23632403-23632425 GCAGGCAGAGTGGAAGCAGCTGG + Intronic
1114659620 14:24335911-24335933 GCAGGAAGTGGGGATGCTGGGGG - Intronic
1115904237 14:38189290-38189312 CAAGGAAGTGAGGAAGCTGAGGG + Intergenic
1118301215 14:64618125-64618147 GCAGGAAGAGGGGAAGTTGAAGG - Intergenic
1118379391 14:65205189-65205211 GCAGCCAGAGCAGAAGCTGCAGG - Intergenic
1118987879 14:70772161-70772183 GCTGACAATGCGGAAGCTGCTGG - Intronic
1119129402 14:72157637-72157659 GGAGGCAGTGGGGGAGCTGCTGG + Intronic
1119324788 14:73753374-73753396 GGAGGAAGTGTGGGAGCTGCAGG + Intronic
1119520413 14:75280455-75280477 CCAGGAAGCAGGGAAGCTGCAGG + Intronic
1119806321 14:77484721-77484743 GCTGGAGCTGCAGAAGCTGCCGG - Exonic
1119840712 14:77790778-77790800 GCAGGAAGGGCAGCAGCAGCTGG + Intergenic
1120962267 14:90136217-90136239 GCAGGAAATGCAGAAACAGCAGG - Intronic
1121126273 14:91408804-91408826 AAAGGAAGTGTGGCAGCTGCTGG - Intronic
1121246324 14:92463369-92463391 GCAGGAAATGGGGATGCTGTGGG + Intronic
1122037770 14:98961053-98961075 GCAGTAAGAGCAGAAGCTTCTGG - Intergenic
1123042954 14:105497896-105497918 CCTGGTAGTGCGGGAGCTGCAGG + Exonic
1124533703 15:30526156-30526178 GCAGGAAGGGCAGAATCTGAGGG + Intergenic
1124764952 15:32481488-32481510 GCAGGAAGGGCAGAATCTGAGGG - Intergenic
1125530164 15:40407935-40407957 GCAGGAATTTTGGAAGCAGCTGG + Exonic
1125723997 15:41858904-41858926 GCAGGAAGGCCTGCAGCTGCCGG + Exonic
1127266272 15:57364833-57364855 GCAGGAAGCGCAGAAAGTGCAGG + Intergenic
1128059981 15:64729224-64729246 GCAGGAAGTGAGGAGACTGAGGG - Intergenic
1129169600 15:73799558-73799580 GCAGGAGGTGGGGAGGGTGCAGG - Intergenic
1129839464 15:78734815-78734837 GCAGGAGGAGCGGAGGGTGCAGG + Intergenic
1129986449 15:79923436-79923458 CCAGGAGGTGCGGAAGCTGCAGG - Exonic
1130871465 15:87975497-87975519 GCAGGAGGTCAGGGAGCTGCAGG + Intronic
1131035158 15:89217264-89217286 GGAGGCAGTGCGAGAGCTGCAGG - Exonic
1132252130 15:100341863-100341885 GCAGGACGAGCGGAGGCAGCAGG + Exonic
1133322846 16:4924993-4925015 GCAGGGAGTGCTGAGCCTGCAGG - Intronic
1134100196 16:11446672-11446694 GCAGGGAGTGAGGAGGCAGCTGG + Intronic
1135729699 16:24883737-24883759 AGAGTAAGTGCAGAAGCTGCAGG + Intronic
1136315063 16:29449541-29449563 GGAGGAGATGCGGAAGCTCCAGG + Intronic
1136380942 16:29895304-29895326 TCTGGAAGTGCAGAAGCAGCCGG + Exonic
1136429640 16:30188880-30188902 GGAGGAGATGCGGAAGCTCCAGG + Exonic
1137715733 16:50597214-50597236 ACAGGATGTGCGGAAGCCTCTGG + Intronic
1139356660 16:66370968-66370990 GCAGGGAGTGGGGAGGCTGTTGG + Intronic
1139475950 16:67202632-67202654 GCAGGTGGTGCGGGAGCAGCTGG + Exonic
1139679461 16:68549783-68549805 GGAGGATGTGGGGAAGCTTCAGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141455168 16:84136420-84136442 CCAGGAATTGTGGAAGGTGCTGG - Intronic
1141727644 16:85800068-85800090 GGAGCAAGGGCGGAGGCTGCAGG - Intronic
1142358039 16:89613359-89613381 TCAGGAAATGAGGAAGCTGCTGG + Intronic
1142699249 17:1649457-1649479 GCAGGAGCTGCGGCGGCTGCGGG - Exonic
1142965837 17:3580512-3580534 GCAGGAAATACTGAATCTGCAGG + Exonic
1143164162 17:4889661-4889683 GCGGGAGCAGCGGAAGCTGCAGG + Exonic
1143434580 17:6914218-6914240 GCCGTGAGTGCGGAAGCCGCGGG + Intronic
1144142071 17:12359366-12359388 GCAGCAAGTGAGGATGCTGTAGG - Intergenic
1144323363 17:14152879-14152901 GCAGGAGCTACAGAAGCTGCAGG + Intronic
1144659686 17:17060093-17060115 GCAGGAGGTCAGGAAGCTGGCGG - Intronic
1145265255 17:21376826-21376848 GCAGCCAGCGCGGCAGCTGCCGG + Exonic
1146619162 17:34383356-34383378 CCAGCTAATGCGGAAGCTGCTGG - Intergenic
1146819769 17:35975595-35975617 GCAGGAAGTGAGGCAGTTCCAGG + Intergenic
1147522231 17:41184708-41184730 GCAGGATGGGCGGCAGCAGCTGG + Exonic
1148082720 17:44976504-44976526 GGAGGGAGTGGGGAGGCTGCGGG - Intergenic
1148778048 17:50106765-50106787 GCAGGAAGGGAGGATGCTGTTGG - Intronic
1149080364 17:52649136-52649158 ACAGGAAATGAGGAATCTGCAGG - Intergenic
1149172199 17:53824224-53824246 GGAGGAAGTGCTGAACCTGGTGG + Exonic
1149535493 17:57430487-57430509 TCAGGAAGTGCTGGTGCTGCAGG + Intronic
1149993494 17:61395603-61395625 GCAGGCAGAGGGGAAGCTGCGGG + Intergenic
1150069567 17:62139669-62139691 CCAGGAGGGGCTGAAGCTGCAGG - Intergenic
1151272185 17:73005350-73005372 TCAGGAACTGTGGAAGCTCCTGG - Intronic
1151305749 17:73261831-73261853 GCTGGGGCTGCGGAAGCTGCTGG + Exonic
1151703567 17:75755522-75755544 GGAGGATGTGCGGTAGGTGCTGG + Intronic
1151986683 17:77548371-77548393 GCAGGAGGTGCAGAGGCTGCAGG - Intergenic
1152111263 17:78358969-78358991 GAACGCAGTGCGCAAGCTGCAGG - Exonic
1152230362 17:79111250-79111272 GCAGGCAGTGAGGGAGGTGCTGG + Intronic
1152695366 17:81741309-81741331 GCAACAGGTGCGGGAGCTGCGGG - Intergenic
1152797719 17:82316265-82316287 GCAGGGAGGGCAGAGGCTGCTGG + Exonic
1152914232 17:83024669-83024691 GCTGAGACTGCGGAAGCTGCGGG + Intronic
1153144122 18:2009808-2009830 GATGGAATTGAGGAAGCTGCAGG - Intergenic
1153953976 18:10080585-10080607 GCAGGATTTGCCGAAGCTGAAGG - Intergenic
1153979026 18:10293903-10293925 GCAGGAAGTGGGGAAGGTTGGGG - Intergenic
1155593435 18:27454384-27454406 GCAGGAAGTGCTGTAGCGGAGGG - Intergenic
1155961626 18:32000304-32000326 GCAGACACTGGGGAAGCTGCAGG + Intergenic
1157359466 18:46964363-46964385 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157361060 18:47023882-47023904 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157362050 18:47029797-47029819 GCGCGCAGTGGGGAAGCTGCAGG - Exonic
1157362929 18:47035219-47035241 GCACGCAGTGGAGAAGCTGCAGG - Exonic
1159528848 18:69629467-69629489 GCAGGAAGAGAGGAAGATGTCGG - Intronic
1159947819 18:74457197-74457219 GCAGGAGGCGCGGGCGCTGCGGG - Exonic
1159950334 18:74478284-74478306 GCAGGAAGGGCTGAGGCTGCAGG - Intergenic
1160187783 18:76688840-76688862 GCAGGAGGAGCAGAAGCAGCCGG + Intergenic
1160727688 19:624865-624887 CCAGGAGGGGCTGAAGCTGCAGG - Exonic
1160903505 19:1440910-1440932 GCAGGAAGTGAAGCAGCAGCAGG + Exonic
1160932782 19:1578498-1578520 GCAGCAGGTGCGGAAGCGGCTGG - Exonic
1161317361 19:3623870-3623892 GCGGGAGGAGCGGAAGCAGCAGG - Exonic
1161394253 19:4037074-4037096 GCAGGGAGTGTGGCAGCTGCAGG - Intronic
1161517521 19:4704554-4704576 TCAGGAAGTGAGGAGGCTTCTGG - Intronic
1162391522 19:10393112-10393134 GAAGGACGTGCAGATGCTGCAGG - Exonic
1163475519 19:17523762-17523784 GCAGGAAGTGGGTGCGCTGCAGG - Intronic
1163590212 19:18189327-18189349 GCAGAACGTGCAGAAGGTGCAGG + Intergenic
1163807271 19:19406533-19406555 GCAGGAAGGGCGCGAGCTGGGGG - Intronic
1165498568 19:36169313-36169335 GCAGGAACTGGGGAAGGTGCTGG - Intergenic
1165616641 19:37207480-37207502 CCAGGAAATGCTGATGCTGCTGG + Intronic
1165864221 19:38926267-38926289 GCAGGAGCTGAGGCAGCTGCAGG - Exonic
1165941740 19:39417901-39417923 GCAGGAAGTGCAGCGGCGGCTGG + Exonic
1167103722 19:47419019-47419041 ACAGGGGGTGCGGAAGCGGCCGG + Intronic
1167217102 19:48171841-48171863 GCAGGAGGAGCAGGAGCTGCGGG + Exonic
1167476076 19:49701559-49701581 GCAGGAATTCCTGAGGCTGCAGG + Exonic
1167552523 19:50170717-50170739 GCTGGGAGTGCGGGTGCTGCTGG - Intergenic
1168063078 19:53904981-53905003 GCAGGAAGTGCTGAAAGTCCAGG + Intronic
927277013 2:21270974-21270996 GCTGGAGGTGCAGAAGCTGGAGG - Intergenic
928280755 2:29944229-29944251 GCAGAAAGTGTGGAAGAAGCAGG + Intergenic
929200332 2:39228574-39228596 GCAGGAAGTGCGGAAGCTGCTGG - Intronic
929201719 2:39243851-39243873 GCAGTAAGTGCGGATTCTGCCGG - Intergenic
929565677 2:42982831-42982853 ACAGGAAGGGCGGAAGATGCAGG - Intergenic
935498551 2:103810304-103810326 GCACAAAGTGCGGAAGCTGATGG - Intergenic
937950966 2:127387756-127387778 GCAGGAAAGGAGGAAGCCGCGGG + Intronic
938416157 2:131105322-131105344 GCCGGACGTGCGGCAGTTGCAGG + Exonic
939127866 2:138199200-138199222 GCAGAAAGTGCAGAATGTGCAGG - Intergenic
946433880 2:219639683-219639705 CCAGGAGGTGCGGGAGCAGCGGG + Exonic
947733883 2:232445082-232445104 GCCGGTGCTGCGGAAGCTGCAGG + Intergenic
947852271 2:233297981-233298003 GCAGGCAGTGCTGAAGCAGATGG - Intergenic
947940063 2:234045882-234045904 CTAGGAGGTGCTGAAGCTGCTGG + Intergenic
948479168 2:238239672-238239694 GCAGGAGCTGCGGCTGCTGCTGG - Exonic
948804620 2:240448168-240448190 GCAGGAAGGGCAGGAGATGCTGG + Intronic
1169113325 20:3046716-3046738 GCGGGAAGTGCTGCAGCTGCAGG + Exonic
1169285603 20:4304791-4304813 GCAGGAATTGGACAAGCTGCAGG - Intergenic
1169351018 20:4867978-4868000 CCAGGAGATGTGGAAGCTGCAGG - Intronic
1170571740 20:17636582-17636604 GAAGGAGGTGCAGCAGCTGCAGG - Exonic
1172315330 20:33949567-33949589 GCCAGAGGTGAGGAAGCTGCTGG - Intergenic
1172936365 20:38623334-38623356 GTAGCAAGTGGGGAAGGTGCAGG - Intronic
1172955493 20:38755078-38755100 GCAGCAATTGCGGCGGCTGCAGG + Exonic
1174564837 20:51457187-51457209 GCAGCAAGAGCAGCAGCTGCAGG + Intronic
1176217616 20:63955761-63955783 GCATGAAGTGGGGAAGTTGTGGG - Intronic
1179534939 21:42045336-42045358 GCAGGAAGAGTGGAAGGCGCTGG - Intergenic
1179718172 21:43300820-43300842 GCTGCAGGTGCGGAAGCTGGGGG + Intergenic
1179798883 21:43801367-43801389 ACAGGAAGTGCTGATGCTGGAGG - Intronic
1179951069 21:44709073-44709095 GCTGGGAGTGCGGGAGCTGCAGG - Intronic
1180007576 21:45030023-45030045 GCGGGAAAGGCGGAAGGTGCCGG + Intergenic
1180098641 21:45574109-45574131 GCAGGGTGTGCGGCCGCTGCTGG - Intergenic
1180570931 22:16718116-16718138 GAAGGGAGCGCGGTAGCTGCAGG - Intergenic
1180663856 22:17493851-17493873 GGAGGATGTGCAGAAGATGCTGG - Intronic
1180737098 22:18025191-18025213 GCTGGAAGTGTGGAAGGGGCTGG - Intergenic
1180967617 22:19798768-19798790 GCAGGAAATGAGGATGATGCGGG + Intronic
1181695947 22:24592868-24592890 GCAGGAGGCGCAGCAGCTGCCGG + Exonic
1182016300 22:27042770-27042792 CCAGGAAATGCGGAAGCTCAGGG - Intergenic
1183070673 22:35393838-35393860 GCAGGAACTGAGGATGCTGAAGG - Exonic
1183246772 22:36699993-36700015 GCAGGAAGGGCTGGAGCTCCGGG - Intronic
1183396178 22:37572112-37572134 GCAGGGAGTGGGGAAGCTCTGGG - Intronic
1184034735 22:41913066-41913088 GAAGGCAGTGCAGAAGCTGAGGG + Intronic
1184175341 22:42785797-42785819 GCAGGAAGAGGAGAGGCTGCAGG + Intergenic
949517311 3:4819462-4819484 CCAGGAGATGCCGAAGCTGCTGG + Intronic
949893736 3:8753484-8753506 GTAGGCAGTGGGAAAGCTGCTGG - Intronic
952764666 3:36944325-36944347 GCGGGAAGGGCGGAATTTGCGGG - Intronic
952887915 3:38022781-38022803 GCAGGAAGTCCAGAAGCTTTGGG - Intronic
953174523 3:40537724-40537746 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
955457833 3:59143742-59143764 ACAGGAAGTGCTGAAGCTTGAGG - Intergenic
956236992 3:67083445-67083467 GCAGGAAGTGGTGAATATGCAGG + Intergenic
956729910 3:72187076-72187098 CCAGGAAATGCCGATGCTGCCGG - Intergenic
957107265 3:75906741-75906763 GGAGGGAGCGCGGTAGCTGCAGG + Exonic
960947416 3:122976208-122976230 CCAGGAGGTGCAGATGCTGCTGG - Intronic
961315611 3:126033378-126033400 GGAGGGAGTGGGGAAGCTGGAGG + Intronic
961588345 3:127954727-127954749 GCAGGAGGAGCTGAGGCTGCAGG - Intronic
961656854 3:128447407-128447429 GAAGGAAGTGAGGAGGCTGATGG - Intergenic
962315925 3:134359547-134359569 GCAGGAAGGGTGGAGGCTGTTGG - Intronic
963102709 3:141622010-141622032 GAGGGAGGTGGGGAAGCTGCTGG + Intergenic
963732355 3:148986322-148986344 GCAGGAAGACTGGGAGCTGCAGG + Intergenic
964076971 3:152703683-152703705 GCAGGAAGAGCAGCAGCTTCTGG + Intergenic
964192203 3:154016312-154016334 GCAGGAACTGAGGAAGCTCCAGG + Intergenic
964391284 3:156200885-156200907 GCAGACACTGAGGAAGCTGCAGG - Intronic
964835140 3:160929879-160929901 GCTGGAAGAGCAGAAGCTGAAGG - Intronic
965670242 3:171140473-171140495 GAAGGAGCTGCGGAAGCAGCAGG - Exonic
965881660 3:173395664-173395686 GCGGGCGCTGCGGAAGCTGCGGG + Intergenic
966135842 3:176697335-176697357 GCTTGCAGTGAGGAAGCTGCTGG - Intergenic
966715181 3:183007293-183007315 GCAGGTAGTGCTGCTGCTGCTGG + Intergenic
966778165 3:183561097-183561119 ACAGGAAGTTGGGAAGTTGCCGG + Intergenic
966814157 3:183875574-183875596 GAAAGAATTGAGGAAGCTGCAGG + Intronic
966869928 3:184283811-184283833 GGAGGAACTGGGGATGCTGCTGG + Exonic
969700391 4:8764677-8764699 GAAGGCAGTGCTGAAGTTGCAGG + Intergenic
972906411 4:43753154-43753176 GCAGCAAGTGCAGAAACTGGCGG - Intergenic
973279231 4:48341772-48341794 CCAGGAGGTGCGGAAGCTGCAGG + Exonic
973755180 4:54067012-54067034 GCAGGAACTGTGGAAGGTGCTGG - Intronic
974981119 4:68958829-68958851 GAAGGAAGAGCTGAAGCAGCAGG - Intergenic
976123487 4:81808062-81808084 GCAGGATTTGGGGAAGCAGCAGG + Intronic
977659602 4:99567575-99567597 GCAGGAGGGTCTGAAGCTGCTGG + Intronic
978112041 4:104975690-104975712 GGAGGAAGAGCAGAGGCTGCAGG - Intergenic
978471223 4:109069791-109069813 CCAGGAAATGTGGAAGCTGCTGG + Intronic
979401784 4:120257668-120257690 GGAGGAACTGCTGCAGCTGCAGG + Intergenic
982924548 4:161319587-161319609 GCAGGAAGTGAGAGAGCGGCAGG + Intergenic
984113100 4:175644346-175644368 GCAAGAAGTGAGGTTGCTGCAGG + Intronic
985669840 5:1201601-1201623 GCAGGCAGGGCAGAAGCTGGAGG - Exonic
985714550 5:1448098-1448120 GCAGGAAGTGCAGAGGCAGGGGG - Intergenic
985931256 5:3059463-3059485 GCAGGACCTGGGGAAGCTCCTGG - Intergenic
988645124 5:33086450-33086472 CCAGGATGTGAGGAAGTTGCAGG + Intergenic
988676699 5:33440554-33440576 TCAGGAAGCGCCGAAGCCGCGGG + Intergenic
988805571 5:34737262-34737284 GCAGGATGTGCTGAGGCTGAAGG + Intronic
989468491 5:41786133-41786155 GCAGGAAAGTCAGAAGCTGCTGG + Intronic
989484086 5:41968018-41968040 GCAGGAAGTGCGGCAGGAGGTGG - Intergenic
992556147 5:77905631-77905653 GCAGGCAAAGCAGAAGCTGCGGG + Intergenic
997669771 5:135661209-135661231 GAAGGAAGAGAGGCAGCTGCAGG - Intergenic
997953408 5:138259700-138259722 GCTGGAGGGGCTGAAGCTGCTGG + Intronic
999368042 5:151035608-151035630 GAAGCAAGTGGAGAAGCTGCAGG - Exonic
1000417513 5:160998306-160998328 GCAGAAACTGAGGTAGCTGCAGG - Intergenic
1001511059 5:172322236-172322258 ACAGGAAGTGGGGAGGCTGGTGG + Intergenic
1002279419 5:178121932-178121954 GCAGGAACTGCGGGCACTGCGGG + Exonic
1003057977 6:2840663-2840685 GCAGAAATTGAGGAAGCTTCTGG - Intronic
1003328537 6:5110873-5110895 GCAGGTAATGCTGATGCTGCTGG + Intronic
1004867492 6:19868610-19868632 GCAGGATGTGCAGAAGAGGCTGG - Intergenic
1005019926 6:21407682-21407704 GCAAGAAGTGGGGAAGGGGCTGG - Intergenic
1006313728 6:33278436-33278458 GCAGGAAGCCTGGAAGCTGGTGG + Exonic
1006512563 6:34529537-34529559 GCAGGATGTGCAGAAGGTGCTGG + Exonic
1006614677 6:35318321-35318343 GGAGAAGGAGCGGAAGCTGCAGG + Exonic
1008673611 6:53796417-53796439 GCAGGAAGTAGGGAGACTGCTGG + Intronic
1012132997 6:95519732-95519754 GAAGGAAGTGGGGGAGCTGAAGG - Intergenic
1012889841 6:104885613-104885635 GCAGGCACTGCGGAACCTGCGGG - Intergenic
1013170784 6:107634904-107634926 GCAGGACCTGCGGCGGCTGCAGG + Exonic
1013542491 6:111124163-111124185 GCAGGAAGTAGGTAAACTGCAGG + Intronic
1014221731 6:118805012-118805034 TCAGGTAGTGCTGATGCTGCTGG - Intergenic
1016062482 6:139645095-139645117 GCAGGCAGTGAGGAAGCAGCCGG + Intergenic
1017397731 6:154022380-154022402 GAAGGAAGGGCGGAAGCCACGGG - Intronic
1017775329 6:157676102-157676124 CCAGGAAGTGGGGATGCTGCAGG + Exonic
1017966797 6:159273917-159273939 GCAGGAAATGAGCAATCTGCTGG - Intergenic
1018800741 6:167220273-167220295 GCAGAAAGTGCTGATGCTGCTGG + Intergenic
1020124284 7:5524407-5524429 GCAGGAGCTGCTGAAGTTGCTGG + Intergenic
1021322279 7:19226982-19227004 GCAGACAGTGAGCAAGCTGCAGG + Intergenic
1027596093 7:80176280-80176302 GAGAGAAGTGAGGAAGCTGCAGG + Intronic
1027786829 7:82590650-82590672 GCAGGAAGTGCGGCAGGAGGTGG - Intergenic
1029739621 7:102483914-102483936 GCAGGGAGAGTGGAGGCTGCTGG - Intronic
1029757622 7:102583093-102583115 GCAGGGAGAGTGGAGGCTGCTGG - Intronic
1033347855 7:140539587-140539609 GCAGGGAGTGGGAGAGCTGCCGG - Intronic
1033665509 7:143437129-143437151 GCAGGGAGTGGGTAAGGTGCCGG + Intergenic
1033813546 7:145046055-145046077 GCAGAGAGTTCAGAAGCTGCTGG - Intergenic
1034336161 7:150324837-150324859 GCAGGAAGTGGGGGAGAAGCAGG - Intronic
1035345182 7:158192787-158192809 GGAGAAAGGGAGGAAGCTGCAGG + Intronic
1035464817 7:159067932-159067954 GCAGGAAGGGCAGGTGCTGCGGG + Intronic
1036728955 8:11244970-11244992 CCAGGAGGTGCTGAAGCTTCTGG - Intergenic
1037581864 8:20250075-20250097 GCAGGAGCTGCAGGAGCTGCGGG - Exonic
1038647357 8:29372902-29372924 GAAGGAAGTGGAGAGGCTGCAGG + Intergenic
1039462067 8:37753374-37753396 GCAGGAAGTGCAGAGGCTATGGG - Intronic
1041660187 8:60393642-60393664 GCAGCAAGAGTGAAAGCTGCAGG - Intergenic
1042219599 8:66460474-66460496 GCAGGGAGTGAGGAGCCTGCCGG - Intronic
1045060674 8:98408080-98408102 GCAGGAAATGTGGAAGCTCAGGG - Intronic
1048356472 8:133657920-133657942 GCAGGAAGAGCTGAGGGTGCAGG - Intergenic
1049012095 8:139894042-139894064 ACAGGAATTGAGGCAGCTGCAGG - Intronic
1049451504 8:142664510-142664532 GCAGGAAGTGGGGCAGCTGCGGG - Exonic
1049797988 8:144505242-144505264 GCAGACGGTGCTGAAGCTGCTGG + Exonic
1055765288 9:79656582-79656604 GCAGAAAATTCGGAATCTGCTGG + Intronic
1055807361 9:80111441-80111463 GAGAGAAGTGAGGAAGCTGCAGG - Intergenic
1056731930 9:89173276-89173298 GCAGGATGTGCCGGTGCTGCTGG - Intronic
1057420166 9:94905868-94905890 GCAGGGAGTGCAGAAGGGGCTGG + Intronic
1057481325 9:95447505-95447527 GAGGGAAGTGTGGGAGCTGCGGG - Intronic
1060917144 9:127398036-127398058 CCAGGACGTGTGGATGCTGCTGG + Exonic
1061367829 9:130181746-130181768 GCAGGCAGGGCGGGTGCTGCGGG + Intronic
1061884513 9:133584886-133584908 GCTGGCAGTGCGGAGGCTTCAGG - Intronic
1062453147 9:136623864-136623886 CCAGGAAGGGCAGAAGCTGGGGG + Intergenic
1062601418 9:137320211-137320233 GCAGGACGTGGGGAAGGGGCGGG - Intronic
1062725353 9:138070234-138070256 CCAGGAAGGACGGAAGCTACAGG - Intronic
1186481429 X:9898844-9898866 GCAGGAACTGTGGCAGCAGCAGG + Intronic
1188695344 X:33183598-33183620 GCAGGAAGTTGGGAGGCTGGTGG - Intronic
1189510782 X:41659093-41659115 GCAGGAAGGGAGGAAGTTGTTGG + Intronic
1192102195 X:68276897-68276919 GCAGGAAGGGCGGATTCAGCTGG - Intronic
1193617506 X:83708637-83708659 GCAGCAAGTGCAGGAGCTACAGG - Intergenic
1196847990 X:119911901-119911923 GCAGGCAATGGGGGAGCTGCTGG + Intronic
1197941597 X:131795793-131795815 GCAGCAGGTGCGGCAGCAGCTGG - Intergenic