ID: 929202232

View in Genome Browser
Species Human (GRCh38)
Location 2:39247884-39247906
Sequence GAATGAGATCAACCGGTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 39}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929202232 Original CRISPR GAATGAGATCAACCGGTTAT GGG (reversed) Intergenic
901948175 1:12720434-12720456 GAATGAGATCATCCACATATAGG - Intronic
903073649 1:20744221-20744243 TAATGAGATCACCCTGTTTTTGG + Exonic
906384526 1:45356241-45356263 GAATGAGAGCAATAGGCTATTGG + Intronic
907948867 1:59161593-59161615 GAATGAGAGGAAACTGTTATAGG - Intergenic
916619504 1:166480992-166481014 GTATGAGATCAACCTCATATAGG + Intergenic
924589179 1:245387050-245387072 GAATTAGATGAACTGTTTATAGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1065091421 10:22237825-22237847 TAATGAGACCAACCTGCTATTGG + Intergenic
1067328452 10:45292230-45292252 GAATGAGCTCAGCCCTTTATGGG + Intergenic
1071037698 10:81266871-81266893 TAATGAGATCACCCAGATATTGG + Intergenic
1072740883 10:97908362-97908384 GAAGGAGCTCAACCGGGCATGGG + Intronic
1080804100 11:35636126-35636148 GAATGAGATGCTCCGGTTATTGG + Intergenic
1086050440 11:82582671-82582693 GAAAAAGATGAACAGGTTATGGG - Intergenic
1087674468 11:101143765-101143787 GAATGAGAGAAACAGTTTATTGG + Intergenic
1093543278 12:20313803-20313825 GAATGTGATCAACAGCTAATTGG - Intergenic
1096754663 12:53789033-53789055 GAATGAGTTAAACCAGCTATAGG + Intergenic
1110277826 13:73659759-73659781 GACTGAGACAAACTGGTTATAGG - Intergenic
1112543436 13:100340173-100340195 GAGTGAGAAGAACCAGTTATTGG + Exonic
1124148065 15:27149135-27149157 GAATGAGTTCAACAAGTTGTAGG + Intronic
1135483271 16:22841047-22841069 GAGTGAGAGCAACCGGTGTTTGG + Intronic
1144099134 17:11928826-11928848 TAATGAGATCCTCCGGTAATTGG - Intronic
1159337750 18:67091713-67091735 GAATGAGAACAAGCGGTGTTTGG - Intergenic
1160207041 18:76843223-76843245 GAATCAGATAAACTGGTTTTGGG + Intronic
1164135403 19:22410508-22410530 GAATGAGAACATGCGGTTTTTGG - Intronic
1167838318 19:52093654-52093676 GAATGAGATCAGCTGATTATTGG + Intronic
926117372 2:10221942-10221964 AAATGAGATCAACCAGGAATAGG - Intergenic
929202232 2:39247884-39247906 GAATGAGATCAACCGGTTATGGG - Intergenic
931828373 2:66025110-66025132 GAATGAGATCACTCAGCTATAGG + Intergenic
1175736501 20:61390883-61390905 GAATGAGATCATGCGGTCATAGG + Intronic
977376504 4:96211956-96211978 GAATGAGATCAACAGAGTAATGG + Intergenic
981496223 4:145396800-145396822 GAATGGGATCAACAAGTTATGGG - Intergenic
985074495 4:186200015-186200037 GAGTGTGATCACCTGGTTATAGG + Intronic
986538239 5:8815204-8815226 GATGGAGATGAACCGCTTATTGG + Intergenic
990796623 5:59549551-59549573 GAATGATTTCAAATGGTTATAGG + Intronic
999063581 5:148660976-148660998 GAATGGGATCAACCTGTAAGGGG - Intronic
1012671875 6:102061518-102061540 GAATTAGATAAACAGATTATGGG + Intronic
1022033026 7:26509147-26509169 GAATGAGATCAGCTTTTTATGGG - Intergenic
1031188561 7:118516033-118516055 GAATGAGATCATGCAATTATGGG - Intergenic
1033239710 7:139667389-139667411 GAATGAGATCATCAGGTAAAAGG + Intronic
1039167787 8:34704753-34704775 GAGGGAGAACAACCAGTTATTGG + Intergenic
1039658715 8:39438903-39438925 GAATGAGAACATGCGGTGATTGG - Intergenic
1047942640 8:129840418-129840440 AAATGAGATCAACCTGTAGTAGG - Exonic
1051874063 9:21771965-21771987 GAATAAGATAAACCTGTCATGGG + Intergenic
1190156108 X:47993750-47993772 GAATGAGATCAATAGTTTAGTGG + Intronic
1190395511 X:49977894-49977916 GATTGAGATCAGCTAGTTATGGG - Intronic