ID: 929202957

View in Genome Browser
Species Human (GRCh38)
Location 2:39257456-39257478
Sequence CATTTCCTCCAGACTCCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929202957_929202961 24 Left 929202957 2:39257456-39257478 CCTACAGGAGTCTGGAGGAAATG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 929202961 2:39257503-39257525 AATGATATTATTTCAAGGCCAGG 0: 1
1: 0
2: 5
3: 31
4: 336
929202957_929202960 19 Left 929202957 2:39257456-39257478 CCTACAGGAGTCTGGAGGAAATG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 929202960 2:39257498-39257520 TAAGAAATGATATTATTTCAAGG 0: 1
1: 0
2: 3
3: 65
4: 630
929202957_929202962 29 Left 929202957 2:39257456-39257478 CCTACAGGAGTCTGGAGGAAATG 0: 1
1: 0
2: 0
3: 18
4: 200
Right 929202962 2:39257508-39257530 TATTATTTCAAGGCCAGGCGCGG 0: 1
1: 2
2: 20
3: 174
4: 1033

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929202957 Original CRISPR CATTTCCTCCAGACTCCTGT AGG (reversed) Intronic
901095512 1:6676152-6676174 CATGTCCTCCTGGCTCCAGTGGG - Intronic
902169575 1:14599095-14599117 CAGTTCCGCCAGTCTCCGGTTGG - Exonic
902233026 1:15040340-15040362 CTTCTCCAGCAGACTCCTGTAGG + Intronic
902651688 1:17841593-17841615 CATCTCCTCCAGCCCCCTCTTGG + Intergenic
903184928 1:21623413-21623435 CACTTCCTCCAGACAGATGTTGG + Intronic
904358833 1:29959522-29959544 CATTTCCACCAGCCTCAGGTGGG + Intergenic
905871665 1:41407904-41407926 CAGTTTCCCCAGCCTCCTGTGGG + Intergenic
906624469 1:47313914-47313936 CATCTGCTCCAGGCTCCTGGAGG + Intronic
908688961 1:66755431-66755453 CATTTCCTTTTGACTGCTGTTGG + Intronic
908769777 1:67585392-67585414 GTTTTCCTCCAGACTCCTGGAGG + Intergenic
911638373 1:100261087-100261109 CATTTCTTCTAGATTCCTTTTGG + Intergenic
912642515 1:111360960-111360982 AAATTCCTCCAGAATCCTGTTGG - Intergenic
913693071 1:121298036-121298058 CATTTTCTTCAGACACCTGTGGG + Intronic
914144485 1:144982045-144982067 CATTTTCTTCAGACCCCTGTGGG - Intronic
915897345 1:159822555-159822577 CCTTCCATCCAGACTCCTGCAGG + Intergenic
919206846 1:194429488-194429510 CATATCCTCCAGTTTCCTGGAGG + Intergenic
920480393 1:206316405-206316427 CATTTTCTTCAGACCCCTGTGGG + Intronic
921859785 1:220030385-220030407 GATTTCCTCCAGAGGCCAGTGGG - Exonic
922345436 1:224692419-224692441 CATTCCCTCCAGAGCCCTGTAGG - Intronic
922354185 1:224760542-224760564 CATATCCTTCAGGCTTCTGTTGG - Intergenic
923386908 1:233473806-233473828 CTGTTCCTGCAGACCCCTGTTGG + Intergenic
923993133 1:239461804-239461826 CATCTCCTCCTGTCTCCTCTGGG + Intronic
1063146028 10:3296031-3296053 AATTTCCTCCACATTCCTGGAGG + Intergenic
1063938904 10:11107464-11107486 CCATTCCTCCAGTCTTCTGTAGG - Intronic
1065390728 10:25177889-25177911 CATTTCCTCCTAATTCCTGCAGG + Intronic
1066229479 10:33418460-33418482 CATTTCCTCAAGGCTACTCTAGG + Intergenic
1067558890 10:47290746-47290768 CACTCCCTGCCGACTCCTGTAGG + Intergenic
1068316158 10:55345495-55345517 CAATTCCTCCACCCTCTTGTCGG + Intronic
1069795878 10:71051418-71051440 CATCTTTTCCAGGCTCCTGTTGG - Intergenic
1069984071 10:72272134-72272156 CATTTCCTCCAGGCTGATTTGGG - Intergenic
1070074976 10:73126131-73126153 CATTGACCCCAGATTCCTGTTGG + Intronic
1070530221 10:77330485-77330507 TATTTCATCCTGACTCCTGGAGG - Intronic
1070798390 10:79230464-79230486 CATTTCCTCCAGGCTCCGTGTGG + Intronic
1072636877 10:97184126-97184148 CATTTGCCCCAGACTCTTCTTGG - Intronic
1074511397 10:114115788-114115810 CGTTTCCTCCATTATCCTGTTGG - Intergenic
1077646593 11:3930851-3930873 CATTTACTCCAGAATCATTTTGG + Intronic
1078343067 11:10515011-10515033 CATTTGCTCCAGTCATCTGTAGG + Exonic
1082076373 11:47979298-47979320 CACTACCTCCAGACACCCGTTGG - Intergenic
1082662712 11:55932727-55932749 AATTTCTTCCAAACTCCTGTTGG + Intergenic
1083505130 11:63149641-63149663 CATTTCCTCTAGGTTCCTCTGGG - Intronic
1085986834 11:81798295-81798317 CATTTCCTTTTCACTCCTGTTGG + Intergenic
1086498987 11:87433019-87433041 CTTTTCTTCTTGACTCCTGTAGG + Intergenic
1088964583 11:114705468-114705490 CATTTCCTCCTGACTCTGGCTGG + Intronic
1091311808 11:134580252-134580274 CATTCTCTCCAGACTCCAGAAGG + Intergenic
1093192630 12:16092267-16092289 CATTTTCTCCATAGTCTTGTTGG + Intergenic
1093514822 12:19973316-19973338 CCTTTTCTTCACACTCCTGTGGG + Intergenic
1096203810 12:49705691-49705713 CATTTCCCCCAGCCTCCTCGGGG - Intronic
1098275206 12:68805707-68805729 CATTCCCTCCAGACTTTTTTTGG + Intergenic
1099490888 12:83286616-83286638 TCTTTGCTTCAGACTCCTGTTGG + Intergenic
1101804908 12:108055284-108055306 CATTCCCACCAGCCTCCTGTTGG + Intergenic
1106666845 13:31860260-31860282 CATTTTCCCCAGGCTCTTGTTGG - Intergenic
1112486749 13:99827165-99827187 CATTTACCACAGACTCCAGTTGG + Intronic
1112906519 13:104429254-104429276 CCTTTCCTCCAGTTTCCTATGGG + Intergenic
1113135313 13:107082430-107082452 CATTTCCTCAATTCTCCAGTGGG - Intergenic
1114270828 14:21098717-21098739 AATCTCTTCCAGTCTCCTGTTGG - Intronic
1114402271 14:22420847-22420869 CCTTCCCTCCAGTCTCCTGAAGG + Intergenic
1116809989 14:49530144-49530166 CCTATCCTCCACACTCCAGTAGG - Intergenic
1117629845 14:57679406-57679428 TATTTCCTCCTTTCTCCTGTGGG - Intronic
1118713279 14:68539898-68539920 CGTATCCTCCAGGCTGCTGTTGG + Intronic
1119958833 14:78831641-78831663 CATTTCCTGAAAAGTCCTGTGGG + Intronic
1121712853 14:96052331-96052353 CAATTCTTTCAGCCTCCTGTGGG - Intronic
1124412881 15:29451358-29451380 CTGGTCCTGCAGACTCCTGTGGG - Intronic
1126204484 15:46029580-46029602 CATTTCCTCCAGACGGCTTCTGG + Intergenic
1127453829 15:59140567-59140589 CTTTTCCTCCTTGCTCCTGTAGG - Intronic
1129858657 15:78843263-78843285 TTTTTCCTCCTGGCTCCTGTAGG + Intronic
1130153332 15:81328960-81328982 CCTTTGCTCCAGACACCTGTGGG - Intergenic
1130403788 15:83580454-83580476 CACTTCCTCCAGACACAAGTGGG + Intronic
1130530202 15:84741417-84741439 TCTTTCCTCCAAGCTCCTGTTGG + Intergenic
1135343277 16:21666680-21666702 GATTTCCTCCAGTCTGCAGTGGG + Intergenic
1138320061 16:56104035-56104057 CAGTTCATGTAGACTCCTGTGGG - Intergenic
1139109340 16:63869765-63869787 CATTACCTGTAGACTCCTCTTGG - Intergenic
1141797117 16:86282573-86282595 CCCTACCTCCAGATTCCTGTTGG + Intergenic
1144037756 17:11382684-11382706 ATTTTCCTCCAGCCTCCTGGTGG + Intronic
1146461758 17:33051522-33051544 CATCTTCTTGAGACTCCTGTAGG + Intronic
1147266265 17:39236721-39236743 GATTCCATCCAGACTCCTGGGGG + Intergenic
1147632263 17:41939737-41939759 CACTTCCTTCAGCCTCCTCTTGG - Intronic
1147660669 17:42115332-42115354 CAGTTCCTCCAGCCTGCTCTTGG + Intronic
1148255163 17:46124690-46124712 AACTTCTTCCAAACTCCTGTTGG - Intronic
1151152615 17:72100829-72100851 AATTCCCTCCAGCCTCCTCTAGG - Intergenic
1151418511 17:73982412-73982434 CATTTCCTCCAGTGACCTGGGGG + Intergenic
1152912259 17:83011839-83011861 CATTTTCCCCACATTCCTGTGGG + Intronic
1160252019 18:77210863-77210885 CAGTCCCTCCAGACACCAGTGGG - Intergenic
1160532679 18:79574824-79574846 CATTTCCACCTCAGTCCTGTTGG + Intergenic
1161728479 19:5944621-5944643 CATGCCCTCCAGAGCCCTGTAGG + Intronic
1164425642 19:28139059-28139081 CATTGTCTCCAGCCTCCCGTTGG + Intergenic
1164567401 19:29337151-29337173 TTCTTCCTCCAGTCTCCTGTAGG - Intergenic
1165057540 19:33187501-33187523 CATTTCCTCCTGAGTTCAGTGGG - Intronic
1165235370 19:34416574-34416596 CATTTCCTCTACATTTCTGTAGG - Intronic
1165560619 19:36676520-36676542 CATTTCCCTCAGGGTCCTGTGGG + Intergenic
924978903 2:202485-202507 CTTTTCCTCCTGCCTGCTGTGGG + Intergenic
924982699 2:237468-237490 CAGCTCCTCCAGATTCCTGCAGG - Intronic
925708482 2:6714092-6714114 TATTGCCTCCAGCTTCCTGTGGG - Intergenic
927600238 2:24434565-24434587 CTTTTCCTCCAGCTTCCTTTGGG + Intergenic
929202957 2:39257456-39257478 CATTTCCTCCAGACTCCTGTAGG - Intronic
932178004 2:69620287-69620309 CATTCCCTCCTGTCTCCTCTGGG + Intronic
933318358 2:80741903-80741925 CATTACCACCAGACTCTTGAAGG + Intergenic
933883787 2:86699002-86699024 CATTTCCTCCAAACTCTTTCAGG + Intronic
935225064 2:101046165-101046187 CATTTCCTTAGGACTCCTGGGGG - Intronic
937585647 2:123545455-123545477 CATTTCCTCCGCACTCCCATTGG + Intergenic
938192812 2:129299196-129299218 TATTTTCTCCAGTCTCCAGTGGG - Intergenic
940665021 2:156598600-156598622 CATTTCCTACAGAGTTCTATGGG + Intronic
942318252 2:174713701-174713723 CATCTCCACCAGGTTCCTGTCGG + Intergenic
945407935 2:209472422-209472444 CATTTCCACCAGAGTTCTGAAGG + Intronic
945776775 2:214115247-214115269 CATGTCCTCAAGAGACCTGTGGG - Intronic
946465365 2:219907214-219907236 CATTTTCCCCAGATTCCTATTGG - Intergenic
947501967 2:230677408-230677430 CATTTGCCCCAGCCTCCTCTTGG - Intergenic
948096110 2:235335152-235335174 CATGTCCTCAGGACTCCTGGTGG + Intergenic
948304517 2:236936536-236936558 CATTTCCACAAAACTCCTGGGGG - Intergenic
1168896385 20:1326440-1326462 CATTTATTCCAGACTACTTTAGG + Intronic
1170033484 20:11966601-11966623 CATTTCTTCCAGGCTCCAGGAGG - Intergenic
1170559130 20:17540721-17540743 CATGTCCTCTAGCTTCCTGTAGG + Intronic
1172795922 20:37537518-37537540 CATTTCCTACACACTTTTGTGGG - Intergenic
1173928650 20:46799946-46799968 CCCTTCCTCCAGCTTCCTGTAGG + Intergenic
1175335705 20:58194567-58194589 CATCTCCTCCAGACCCGTGATGG + Intergenic
1175420259 20:58827658-58827680 CCTTTCCTGCTGATTCCTGTAGG - Intergenic
1176151112 20:63591388-63591410 CGTTTCCTCCATGCTCCTCTTGG - Intronic
1176288783 21:5033605-5033627 CATTTCCTGCAGCCTCCCCTTGG + Intronic
1177378638 21:20308175-20308197 CTTTTCCTCCATACTCTTATAGG + Intergenic
1178060450 21:28848643-28848665 CATTTCTTTCAAACTCCTTTAGG + Intergenic
1178119670 21:29456234-29456256 CATATCCTCCAGATCCATGTGGG - Intronic
1178600431 21:33989788-33989810 CATCTCCTCCAAATTCCAGTGGG - Intergenic
1179868401 21:44229870-44229892 CATTTCCTGCAGCCTCCCCTTGG - Intronic
1181409607 22:22709903-22709925 CAGTTCCTCCAGCTGCCTGTGGG - Intergenic
1181417070 22:22768084-22768106 CAGTTCCTCCAGCTGCCTGTCGG - Intronic
1183818929 22:40328352-40328374 CGGTTCTTCCAAACTCCTGTGGG + Exonic
949941629 3:9159196-9159218 CCATCCCACCAGACTCCTGTTGG + Intronic
951015303 3:17725418-17725440 CTTTTCTTGCAGCCTCCTGTGGG + Intronic
952321078 3:32278196-32278218 CATTTCCTCTGGCATCCTGTTGG + Intronic
953754799 3:45636837-45636859 CATTCAATCCAGACTCCTGATGG - Intronic
954445910 3:50546833-50546855 CTTTTCCTCCAGGCTCCTGGGGG - Intergenic
955641597 3:61091657-61091679 CACTGCCCCCAGCCTCCTGTTGG - Intronic
957385426 3:79490349-79490371 CATTTCCTCTACCCTCCAGTAGG + Intronic
958777210 3:98500298-98500320 CAGGTCATGCAGACTCCTGTGGG - Intronic
962187435 3:133274645-133274667 CCTTTCCTACTGCCTCCTGTAGG + Intronic
962424718 3:135259584-135259606 CCTTTGCTCATGACTCCTGTAGG + Exonic
962983285 3:140509680-140509702 CCATTCCTCCAGGCTCCTGCAGG + Intronic
969219842 4:5752447-5752469 CATTTCCTCCACAGCCCTGTGGG + Intronic
969433406 4:7169318-7169340 CACTTCCTGCAGCCTCCTGCAGG - Intergenic
972240543 4:37187336-37187358 CATTCCCTCCATCCTTCTGTTGG + Intergenic
978402399 4:108344489-108344511 CATTCCCTTCAAACTCCTCTGGG + Intergenic
979018384 4:115464080-115464102 CATTGCCTACAGACTCCTTCAGG - Intergenic
979752992 4:124302757-124302779 AATTCCCACCAGACTCCTGATGG + Intergenic
980100876 4:128540074-128540096 CATTTCCTCCCGAAGCCTCTTGG - Intergenic
981310184 4:143290293-143290315 CATTTTCTTAAGAATCCTGTCGG - Intergenic
985257879 4:188087441-188087463 TATTTCCTCCAAATTCCTGAGGG - Intergenic
985815124 5:2122447-2122469 CATTTCCTCCTCATTCCTGAAGG + Intergenic
986936487 5:12894176-12894198 CAAGTCCTCCAGTATCCTGTTGG + Intergenic
990380792 5:55220717-55220739 CAACTCCTCCAGGCTCCTTTTGG + Exonic
990823274 5:59867690-59867712 TAATTTCACCAGACTCCTGTTGG - Intronic
991037917 5:62146379-62146401 GAATTCCTCCAGAGTCCTGCAGG - Intergenic
991574650 5:68090295-68090317 CATTTCCCCTAGAATCCTGGAGG - Intergenic
993994177 5:94700875-94700897 CATTTCCTCCAGTAACATGTAGG - Intronic
994477281 5:100287492-100287514 CATTTCCTCCTTTCTCTTGTGGG - Intergenic
994760076 5:103841145-103841167 CATTCCCCACAGACTGCTGTGGG + Intergenic
996182073 5:120431836-120431858 CAGTGCCTGGAGACTCCTGTTGG + Intergenic
996453503 5:123655028-123655050 CATTTCCTGCACCCTACTGTGGG - Intergenic
996993929 5:129671465-129671487 CATTTCCTAAAGGCTCCTTTGGG + Intronic
999626366 5:153524845-153524867 TATTTCCTACAGAGACCTGTAGG - Intronic
1001206199 5:169765493-169765515 CTTTTCTTCTAGACTCCTCTTGG - Intronic
1001954166 5:175837033-175837055 CCTTTCCCCCTGACTCCTTTGGG - Intronic
1003195166 6:3907887-3907909 CATGTCCTCAGGACTCCTGAGGG + Intergenic
1003650254 6:7952592-7952614 CAGTTCCTCTAGATTCCTATTGG - Intronic
1003747056 6:9014142-9014164 AATTGCCTACAGACTTCTGTGGG + Intergenic
1004145840 6:13065344-13065366 GTTTTCCTCCAAACTCCAGTGGG - Intronic
1004888288 6:20072641-20072663 CTTTTCCTCTAGTCTCCTGAAGG - Intergenic
1005011537 6:21340501-21340523 CACTTCCTCCAGAATCCTTTTGG + Intergenic
1005963670 6:30711531-30711553 CATCTCCTCCATACTACTGTAGG + Intronic
1006188164 6:32192036-32192058 CACCTCCTCCAGACTCCCCTTGG - Intronic
1006550315 6:34817593-34817615 CCTTGCCTCCAGAGTCCTGTGGG + Intronic
1006721150 6:36152386-36152408 CATTACCTCCAGAATCATGGGGG - Intergenic
1007399235 6:41594348-41594370 CATGGCTCCCAGACTCCTGTGGG + Intronic
1011507866 6:88067919-88067941 CATTTCCTACAGATGCCTTTGGG - Intergenic
1011867474 6:91848290-91848312 GATTTCCTCTAGAGTCCTGGAGG + Intergenic
1017524267 6:155229025-155229047 CATTTCCTCCAGACAGCGGGTGG + Intronic
1017886676 6:158605823-158605845 CATTTCCCCCAAAGTCATGTGGG - Intronic
1018242426 6:161790838-161790860 CTTTCCCTCCATACTTCTGTCGG - Intronic
1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG + Intronic
1018922199 6:168183102-168183124 CATTCCCTGCGGACTCCAGTGGG + Intergenic
1022976607 7:35564136-35564158 CATTTTCTTCATATTCCTGTGGG - Intergenic
1024769258 7:52698936-52698958 CCCTTCCTCCAACCTCCTGTAGG + Intergenic
1025313097 7:57976864-57976886 CATTTCCACCATACACCTGTAGG + Intergenic
1027883120 7:83868439-83868461 CATTTACTCCTGACTCAAGTTGG + Intergenic
1031044743 7:116875194-116875216 CATTTTCTTCAGAGTCTTGTAGG + Intronic
1032183985 7:129707339-129707361 CATTTTCTCCAGACTCTCCTAGG + Intronic
1033167234 7:139050790-139050812 CATTTCCTCCAAACACTTCTAGG + Intronic
1034281765 7:149859538-149859560 CATGTCCTTCAGAATGCTGTAGG - Intronic
1038845932 8:31229642-31229664 CATATCCTTCAGAATCCTGTAGG + Intergenic
1042942854 8:74125094-74125116 CATTTCCTGCAAACACCTCTTGG - Intergenic
1046624853 8:116565446-116565468 CATTACCCCCAAACTCATGTTGG + Intergenic
1050131863 9:2421088-2421110 CACTCCTTCCAGACTCCTTTAGG - Intergenic
1050414568 9:5402506-5402528 CCTACCCTCCAGACTCCTGCTGG + Intronic
1053405051 9:37866438-37866460 CATTTGCCTCAGACTGCTGTTGG + Intronic
1055428738 9:76221994-76222016 GATTTCCTCCAGACACCTCCAGG + Intronic
1057522331 9:95769838-95769860 CAGTTGGTCCAGATTCCTGTAGG + Intergenic
1059661527 9:116406492-116406514 CATTTCATCAAGACCCCTGTGGG - Intergenic
1062251370 9:135597009-135597031 CATTCCCTCCAGAGTCCAGATGG - Intergenic
1203355833 Un_KI270442v1:142002-142024 CATTTCCACCAGAGGCCTGAAGG + Intergenic
1186282672 X:8010284-8010306 CAGTTCCTCCCAAGTCCTGTAGG - Intergenic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1188330594 X:28866360-28866382 CATTTCCTCCAGAGTCCCCAAGG - Intronic
1188466286 X:30485455-30485477 CATTTACTCCCTACTGCTGTTGG - Intergenic
1188476064 X:30593533-30593555 CATATACTCCAAACTTCTGTGGG + Intergenic
1189017820 X:37302596-37302618 CTTTTTCTCCATACTCCTCTGGG - Intergenic
1195397589 X:104427961-104427983 CATTTTTTCTAGATTCCTGTGGG - Intergenic
1196133209 X:112179983-112180005 CATGTTCTTCAGACTCCTTTAGG - Intergenic
1196951296 X:120877620-120877642 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196952120 X:120933970-120933992 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196952805 X:120938831-120938853 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196953490 X:120943691-120943713 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196954175 X:120948552-120948574 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196954859 X:120953412-120953434 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196955549 X:120958295-120958317 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196956229 X:120963156-120963178 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196956911 X:120968016-120968038 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196957593 X:120972876-120972898 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196958275 X:120977736-120977758 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1196958957 X:120982596-120982618 CTTTTTCTCCAGATGCCTGTGGG - Exonic
1197120897 X:122891018-122891040 CTTTTTCTTCAGAATCCTGTAGG - Intergenic
1198137036 X:133763359-133763381 CATTTCCTGCAAACGCCTGTGGG + Intronic