ID: 929203517

View in Genome Browser
Species Human (GRCh38)
Location 2:39263577-39263599
Sequence CTGCGTCAAGACTTCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929203517_929203521 1 Left 929203517 2:39263577-39263599 CCCATATAGAAGTCTTGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 929203521 2:39263601-39263623 GAGACACGGAAAGGAAAGCTAGG 0: 1
1: 0
2: 2
3: 21
4: 294
929203517_929203524 21 Left 929203517 2:39263577-39263599 CCCATATAGAAGTCTTGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 929203524 2:39263621-39263643 AGGTTAAGATTAAGGAAGGCAGG 0: 1
1: 0
2: 0
3: 25
4: 227
929203517_929203520 -8 Left 929203517 2:39263577-39263599 CCCATATAGAAGTCTTGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 929203520 2:39263592-39263614 TGACGCAGAGAGACACGGAAAGG 0: 1
1: 0
2: 3
3: 10
4: 205
929203517_929203522 13 Left 929203517 2:39263577-39263599 CCCATATAGAAGTCTTGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 929203522 2:39263613-39263635 GGAAAGCTAGGTTAAGATTAAGG 0: 1
1: 0
2: 0
3: 16
4: 123
929203517_929203523 17 Left 929203517 2:39263577-39263599 CCCATATAGAAGTCTTGACGCAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 929203523 2:39263617-39263639 AGCTAGGTTAAGATTAAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929203517 Original CRISPR CTGCGTCAAGACTTCTATAT GGG (reversed) Intronic
907002887 1:50880062-50880084 CTGGGTTAAAACTTCTATTTTGG + Intronic
908030109 1:59990029-59990051 CTTCCTCAAAACTTCTATCTTGG + Intronic
918580947 1:186128328-186128350 CTTCGTCTAGAGTTCTACATAGG - Intronic
1077324172 11:1956572-1956594 CTGCAGCAAGACTTTTATTTAGG - Exonic
1202807158 11_KI270721v1_random:11767-11789 CTGCAGCAAGACTTTTATTTAGG - Intergenic
1093609925 12:21142434-21142456 TTTCCTCAAGACTTCCATATGGG - Intronic
1097357945 12:58623034-58623056 AAGAGTCAAGACTTCTAAATGGG - Intronic
1102439692 12:112952025-112952047 CTGAATGCAGACTTCTATATAGG + Intronic
1102687228 12:114734496-114734518 CAGCGCCAAGCTTTCTATATGGG - Intergenic
1103249617 12:119488389-119488411 CTGAGTCAAGACTTCCAGCTGGG + Intronic
1116008779 14:39326002-39326024 CTGCGTCCAGCCCTGTATATGGG + Intronic
1121827389 14:97021566-97021588 CTCTGTGAAGTCTTCTATATTGG - Intergenic
1131774677 15:95781858-95781880 TTGCGATAAGACTTCTTTATAGG - Intergenic
1134260521 16:12647643-12647665 CAGAGTCAAGAGTTCTATGTTGG - Intergenic
1139243450 16:65417841-65417863 CTCCACCAAGAGTTCTATATTGG - Intergenic
1140900587 16:79363739-79363761 CTGGGGCAAGACTTCAAAATAGG + Intergenic
1150063605 17:62090176-62090198 CTCCTTCTAGAATTCTATATAGG - Intergenic
1167958488 19:53087151-53087173 CTGCCTCAAGGCTTCCATGTGGG - Intronic
1168487629 19:56778000-56778022 CTTCCTCAAGATTTCTACATTGG + Intronic
1168570849 19:57467850-57467872 CTGCGTCAAGAGTTCTAAGTTGG + Intronic
929203517 2:39263577-39263599 CTGCGTCAAGACTTCTATATGGG - Intronic
933273608 2:80260157-80260179 CTGAGTCAAGATTTCAATACTGG - Intronic
934228902 2:90159793-90159815 CTGCCTGAAGACTTCTTAATAGG + Intergenic
944088519 2:195877263-195877285 CTCCCTCAAGAGTTCTGTATAGG + Intronic
1169627301 20:7585968-7585990 CTGCAGCAAGACTTCTAGCTGGG - Intergenic
1178644155 21:34371415-34371437 CTGTCTTAAGACTTCTAAATAGG - Intergenic
1184938564 22:47742732-47742754 CTGCTTCAAGACTGCAATATAGG - Intergenic
949797945 3:7871359-7871381 CTACGTAAAGACTGCTATTTAGG - Intergenic
958991082 3:100845923-100845945 ATGCTCCAAGACTTCTAAATTGG - Intronic
962111114 3:132449370-132449392 ATGCCTCAAGACCACTATATAGG - Intronic
967447185 3:189580321-189580343 GTGGGTCAAGACTTCTGGATGGG + Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
978601872 4:110437239-110437261 CTGCTTCAAACCTTCTATCTTGG + Intronic
986524363 5:8657139-8657161 ATGTGTCCAGACTTCTATGTTGG + Intergenic
989315152 5:40069854-40069876 CAGTGTCAAGACATCTACATTGG - Intergenic
993849223 5:92985313-92985335 CTGAGTCTAGAATTCTAGATTGG - Intergenic
994873591 5:105384474-105384496 CTGCTTCAAGACTGCATTATGGG - Intergenic
995440161 5:112182468-112182490 CTTCTTCAAAACTTATATATAGG + Intronic
995994777 5:118284493-118284515 CTGAGTCTAGACTTGTAGATAGG - Intergenic
997355351 5:133259308-133259330 CTGCCTCAAGACCTTTGTATGGG - Intronic
1006981740 6:38153241-38153263 CTGCAGCCAGATTTCTATATTGG + Exonic
1017217814 6:151930795-151930817 CTGCATCTAGAATTCTAAATTGG + Intronic
1018069621 6:160152280-160152302 CTGGGTCAAGAATTTTAGATTGG - Intronic
1023367834 7:39482178-39482200 CTGCATCAAGAATTCCATGTTGG + Intronic
1024112402 7:46160668-46160690 CTTCCTCAAGACTTCTAGACAGG - Intergenic
1041186876 8:55310230-55310252 CTGCGTCAATATTTTTAAATCGG + Intronic
1041752337 8:61274013-61274035 TGGCATCAAGACTTTTATATTGG - Intronic
1042081800 8:65061754-65061776 CTGCGTCATGACTGCAATGTGGG - Intergenic
1050274495 9:3982808-3982830 CTGCCTGAAGCCTTCCATATAGG - Intronic
1056367973 9:85924959-85924981 CTGATACAAGACTTGTATATAGG - Intergenic
1057773687 9:97987738-97987760 CTACGTAAAGACTTTTATTTTGG - Intronic
1059118877 9:111623466-111623488 ATTCATCAAGACTTCTATTTTGG + Intergenic
1185993825 X:4921655-4921677 GTGCCTGAAGACTTCTAGATGGG + Intergenic
1191790290 X:64964543-64964565 CTGGGTAAATAATTCTATATTGG - Intronic
1193083984 X:77431926-77431948 CTTGATCAAGACTTCTAAATCGG + Intergenic
1196567675 X:117228192-117228214 CTGCGCCCAGCCTTCTATAGGGG - Intergenic