ID: 929204657

View in Genome Browser
Species Human (GRCh38)
Location 2:39277206-39277228
Sequence TGGTAACAATAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929204657 Original CRISPR TGGTAACAATAGATGGAGCT GGG (reversed) Intronic
901255161 1:7818234-7818256 TGGTAACATTAGTGGAAGCTGGG + Intronic
904375661 1:30080657-30080679 TAGAAACCAGAGATGGAGCTAGG - Intergenic
905611066 1:39351978-39352000 TCGTAACTATAGAGGCAGCTCGG - Intronic
907965168 1:59321946-59321968 AAGTAACTATAGCTGGAGCTGGG + Intronic
909447254 1:75760850-75760872 TGTTAACATTAGAGGAAGCTGGG + Intronic
909561910 1:77016584-77016606 TGCTAATTAGAGATGGAGCTGGG + Intronic
909658876 1:78060750-78060772 TGGTTACAATAGATGGTTCTGGG - Intronic
911013691 1:93308807-93308829 TGGGAGAAATACATGGAGCTAGG - Intergenic
911953483 1:104207182-104207204 TGGCAACTATAGATGGTCCTTGG - Intergenic
912875414 1:113353288-113353310 TGTTAACAATAGGTGAAACTGGG - Intergenic
912898488 1:113620722-113620744 TGGTTATAATACATGGAGATAGG + Intronic
914589996 1:149098100-149098122 TGGAAACAAGAGATGGAAATGGG + Intronic
914889525 1:151610741-151610763 TGGTAACAATAACTGGGGCCAGG + Intergenic
917325645 1:173829282-173829304 TGGTAACATTAGGTGCTGCTGGG + Intronic
919523244 1:198615269-198615291 TGGTCACAATATATGGTACTAGG - Intergenic
922128093 1:222749066-222749088 TGGTAACACTGGATTGAGTTTGG + Intronic
922249883 1:223838851-223838873 TGGTAATATTAGATAGAGGTGGG + Intronic
922509097 1:226148271-226148293 TGCTAACAACAGAGGGAACTTGG + Intronic
922933278 1:229406476-229406498 TGTTAACAATAGGGGGAACTGGG + Intergenic
924350861 1:243113352-243113374 TAATAACAATATATTGAGCTGGG + Intergenic
924679386 1:246216587-246216609 TGCTAACAATTGATGAATCTAGG + Intronic
1069917973 10:71798813-71798835 TGGTACTAATAGTAGGAGCTTGG - Intronic
1070931311 10:80262860-80262882 TTGTAACAGGAGATGGAACTTGG - Intergenic
1071674572 10:87643247-87643269 TGGTAACAATTGATTTAGATAGG + Intergenic
1073277835 10:102328085-102328107 CGTCAAAAATAGATGGAGCTAGG - Intronic
1073768973 10:106714474-106714496 TGTTAACATTAGAGGAAGCTGGG + Intronic
1074361661 10:112828714-112828736 TTTTAACAATAAATAGAGCTGGG + Intergenic
1076317016 10:129549516-129549538 TTGTAATAATAGATGCAGATGGG - Intronic
1078830512 11:14972838-14972860 GGGAAACAAGAGACGGAGCTGGG + Intronic
1081415225 11:42806865-42806887 TGGTAACAATTGGTGAATCTAGG + Intergenic
1081467798 11:43339367-43339389 TAGCAACAATAGAGAGAGCTTGG - Intronic
1085564171 11:77498214-77498236 TGTTAACATTAGGGGGAGCTGGG + Intergenic
1085661525 11:78371873-78371895 TTGTAATAAGAGATGGAACTGGG - Intronic
1087329084 11:96756662-96756684 TGGGAAGTATAGATGGAGATGGG + Intergenic
1088547537 11:110974908-110974930 GGCTAACAAGAGATGGAGCCAGG - Intergenic
1088622134 11:111696361-111696383 TGTTAACATTAGAGGAAGCTGGG + Intronic
1089045071 11:115494165-115494187 TGTTAACAGTTGATGGATCTAGG + Intronic
1089224036 11:116900555-116900577 TGGAAACATAGGATGGAGCTGGG - Intronic
1089859320 11:121574693-121574715 TGGTCAGAAAAGATGGAGCCTGG + Intronic
1090173462 11:124625784-124625806 TGGGAACTATACAGGGAGCTGGG + Exonic
1090633971 11:128676903-128676925 TGGTAACATTAGGGGAAGCTGGG + Intergenic
1091033768 11:132214794-132214816 TGGAAACAGAAGATGGAGCAAGG + Intronic
1091438436 12:493803-493825 AAGTAACAATAGATAGAGGTAGG + Intronic
1092352537 12:7767348-7767370 TGGTAGCAATAGAAGGATGTGGG + Intronic
1093228696 12:16516236-16516258 AAGTAACAATAGCTTGAGCTAGG - Intronic
1093270382 12:17053110-17053132 AGCTAACAAATGATGGAGCTGGG + Intergenic
1094595347 12:31860664-31860686 TGTTAACACTAGAGGAAGCTGGG + Intergenic
1097943773 12:65343692-65343714 GGGTAGTAAGAGATGGAGCTAGG + Intronic
1098837505 12:75440503-75440525 TGCTGAAAATAGATGGATCTTGG - Intergenic
1100693881 12:97068933-97068955 TTGTAACAATAGATGAAACCTGG - Intergenic
1105314519 13:19244708-19244730 AGGTAACAATCGCTGCAGCTCGG + Intergenic
1107498499 13:40952776-40952798 TGGTGATAATAGTTGAAGCTAGG - Intronic
1110429214 13:75404321-75404343 TGTTAACAATAGAAGAAACTGGG - Intronic
1111979033 13:94997680-94997702 TGTTAACAATGGAGGGAACTGGG - Intergenic
1112577359 13:100647336-100647358 TGAAAACAATGGATGGAGCCCGG - Intronic
1113049725 13:106197102-106197124 TGTTAACATTATATGGAGCTGGG - Intergenic
1114180556 14:20363834-20363856 TGTTAACATTAGAAGAAGCTGGG + Intergenic
1114942243 14:27627528-27627550 TTGTAACAAAAGATGGAACATGG - Intergenic
1115371055 14:32615265-32615287 TTGTCACTATAAATGGAGCTAGG + Intronic
1118466539 14:66036170-66036192 TCGTAACAATATGTAGAGCTGGG - Intergenic
1118670246 14:68118191-68118213 TGTTAACATTAGAGGGAACTGGG - Intronic
1119407386 14:74407234-74407256 TGGGCAGAATGGATGGAGCTAGG + Exonic
1120522614 14:85542255-85542277 TGGTAAAAATACATGGTACTGGG + Intronic
1121206206 14:92170265-92170287 TGTTAACAATAGAAGAATCTAGG - Exonic
1126354642 15:47782477-47782499 TGGAAACAACAGATGGTGCATGG + Intergenic
1126399185 15:48251907-48251929 TAGTAACAATAGTTGGGGCCGGG + Intronic
1126888488 15:53178294-53178316 TGTTAACATTAGAGGAAGCTGGG - Intergenic
1127730275 15:61794883-61794905 TGCTAACATTAGAGGAAGCTGGG - Intergenic
1127815513 15:62605533-62605555 TGGTAGGAAAAGATGGTGCTGGG - Intronic
1127953223 15:63830639-63830661 TGTTAACATTAGGGGGAGCTTGG + Intronic
1128926000 15:71656726-71656748 TGCTAATAATAGATAGAGCTTGG - Intronic
1129649142 15:77468475-77468497 TGTTAACAATAGGTGAATCTGGG - Intronic
1130278185 15:82494597-82494619 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130470514 15:84221782-84221804 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130478002 15:84336349-84336371 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1130493763 15:84451781-84451803 TGGTGTCAATAGATGGAGGCTGG + Intergenic
1130592801 15:85226408-85226430 TGGTGTCAATAGATGGAGGCTGG - Intergenic
1131396130 15:92087812-92087834 AGATAATAATAGATGGGGCTGGG - Intronic
1131808693 15:96149992-96150014 TGAGAACAATAGATGTGGCTGGG - Intergenic
1133576408 16:7095725-7095747 TGTTAAGAAAATATGGAGCTGGG + Intronic
1139334265 16:66220134-66220156 TGCCAACAATTGATGGAGCCTGG - Intergenic
1143427415 17:6851009-6851031 TGGGAACAACAGCTGGAACTAGG - Intergenic
1143607803 17:8000182-8000204 TGCTAACAATAGGTGAATCTGGG - Intergenic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1148246244 17:46032659-46032681 TGTTAACAATAAATGGAGACAGG + Intronic
1148748938 17:49933600-49933622 TGTTAACAATAGAAGAAACTTGG - Intergenic
1149999979 17:61428310-61428332 TGTTAACAATAGAAGAAACTGGG + Intergenic
1150869614 17:68892107-68892129 GAGTAACAACAGATGGAACTAGG - Intronic
1155666602 18:28316548-28316570 TGGGTACAATGGGTGGAGCTGGG + Intergenic
1156164904 18:34406686-34406708 TTATAACAATAGCTGGAACTGGG - Intergenic
1156359564 18:36372429-36372451 TGGAATGAATCGATGGAGCTTGG + Intronic
1159609324 18:70508725-70508747 TGGTAACATAAGCTGGAGTTGGG + Intergenic
1162593535 19:11609276-11609298 TGGGAACAATTGCTGGAGTTTGG - Intronic
1163375913 19:16930536-16930558 TGGAAATAATACATGGTGCTTGG + Intronic
1168543166 19:57229844-57229866 TGGTTACAATAGGTGGATCAGGG - Intergenic
925344100 2:3157845-3157867 TGCTAACAATACATGAAGCATGG + Intergenic
927836517 2:26403248-26403270 TTGTAACAATATATGAACCTTGG + Intronic
928545449 2:32325172-32325194 TGGTAACAATTGGTGAATCTGGG + Intergenic
929204657 2:39277206-39277228 TGGTAACAATAGATGGAGCTGGG - Intronic
929539014 2:42805410-42805432 TGGTAACACAAAAGGGAGCTAGG + Intergenic
930013244 2:46953961-46953983 GGGTCTCAAGAGATGGAGCTTGG - Intronic
930614673 2:53581205-53581227 TGGAAACATTAGATGAAGCTGGG - Intronic
936583565 2:113729380-113729402 TGGTAAGAATATATGTAACTTGG - Exonic
936931065 2:117789292-117789314 AGGTAAAAATAGATAGACCTTGG - Intergenic
937695029 2:124799492-124799514 TGGTATCATAAGATGGGGCTGGG + Intronic
938183197 2:129203450-129203472 TGCTAACAATAGAGGAAACTGGG + Intergenic
940977038 2:159957770-159957792 TGGTAGGAACAGATGGAGTTTGG + Intronic
942198982 2:173552092-173552114 TGTTAATAATAGAGGAAGCTGGG + Intergenic
942383889 2:175421328-175421350 TACAAAAAATAGATGGAGCTGGG + Intergenic
942552310 2:177132014-177132036 ATATAGCAATAGATGGAGCTTGG + Intergenic
943466322 2:188233602-188233624 TAGTAACAATCTATGGAGTTCGG + Intergenic
944744673 2:202643284-202643306 TGGTAAATGTAGATGGAGCAAGG + Intronic
945205005 2:207322278-207322300 TGTTAATAATAGAGGGAACTGGG + Intergenic
945478652 2:210318163-210318185 TGGTAACAATAGAGAAAACTTGG + Intergenic
945576370 2:211534951-211534973 TGGTAACAATAGAAAGACCAAGG - Intronic
946294938 2:218776639-218776661 GGGCAACAATGGGTGGAGCTGGG + Intergenic
946637455 2:221745287-221745309 TGTTAACAATTGCTGAAGCTGGG - Intergenic
947374292 2:229480212-229480234 TGCTAATAATGGTTGGAGCTGGG - Intronic
947925123 2:233914620-233914642 TGGTAGCAACTGATGGAGGTGGG - Intergenic
1172198667 20:33110008-33110030 TGCTAACATTAGGGGGAGCTGGG - Intronic
1174480260 20:50826265-50826287 TGGTAACAAATGCTGGAGCCAGG + Intronic
1174747558 20:53078751-53078773 TGGTAAAAATCAATAGAGCTTGG + Intronic
1175799122 20:61791049-61791071 TTGAAACAGTAGCTGGAGCTGGG - Intronic
1182145648 22:27995225-27995247 TCTTAACCATGGATGGAGCTAGG + Intronic
951390382 3:22095990-22096012 TGGTAATAAAAGCTGGAGATTGG + Intronic
951978089 3:28536814-28536836 TGTTGACACTAAATGGAGCTTGG + Intronic
952231119 3:31432117-31432139 TGCTCAGCATAGATGGAGCTGGG + Intergenic
953331955 3:42061180-42061202 TGTTAACATTAGAGGAAGCTGGG - Intronic
953417153 3:42729441-42729463 TGATAGCAAAAGAAGGAGCTAGG - Intronic
954720252 3:52555435-52555457 TGGTAAGAATGGATTGTGCTTGG + Intronic
955236871 3:57147370-57147392 TGGTAGCAAATGGTGGAGCTGGG + Intronic
956198053 3:66673501-66673523 TAGTGACAAGATATGGAGCTGGG - Intergenic
956756551 3:72393628-72393650 TGGTAACATTAGGGGGAACTGGG - Intronic
959005539 3:101015430-101015452 TGGTAGCAATAGGTGGATCCAGG + Intergenic
961590708 3:127978672-127978694 TGGTAGCAATAGCAGGGGCTGGG + Intronic
961950132 3:130740883-130740905 TGTTAACAATAGGTGAATCTGGG + Intronic
962112097 3:132462477-132462499 TGGCAATAATAAAAGGAGCTGGG + Exonic
962711612 3:138091254-138091276 AGCTAAGAAGAGATGGAGCTGGG - Intronic
963003023 3:140700889-140700911 TGGTAACACCAGATGGACATGGG + Exonic
963064664 3:141253772-141253794 TGGTGACAATAGTTGAAGCAGGG - Intronic
963803578 3:149700699-149700721 TGGTAACAATAGATAACACTGGG + Intronic
965265213 3:166533950-166533972 TGTTAACATTAGGTGGAGCAAGG + Intergenic
965308723 3:167101320-167101342 TTGTGACAATAGATTGAGTTTGG - Intergenic
966049861 3:175602886-175602908 TGTTAACAATAGATGAATCTTGG - Intronic
967223345 3:187267891-187267913 TCGTAATTATAGAAGGAGCTGGG - Intronic
967959389 3:194908305-194908327 ATGTTACTATAGATGGAGCTAGG + Intergenic
968402105 4:306745-306767 AGGTAACATTATAAGGAGCTGGG + Intergenic
968410287 4:384548-384570 TAGTAACATTATAAGGAGCTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970295811 4:14628217-14628239 GGGTAACAATACAAGAAGCTTGG - Intergenic
970480991 4:16474325-16474347 TTGTAACAAGAGATGAAACTTGG + Intergenic
970524291 4:16915698-16915720 TGTTAACATTAGGTGAAGCTTGG + Intergenic
972208402 4:36805789-36805811 TCTTATCAATAAATGGAGCTAGG + Intergenic
974773270 4:66444134-66444156 TTGTAACTATAGTTGGAGATAGG - Intergenic
976754867 4:88487381-88487403 TGGTAGCAAGGGATGGAGCTTGG + Intronic
976893705 4:90082285-90082307 TGGTAGCTAGAGATGCAGCTTGG - Intergenic
979251081 4:118567202-118567224 TAATAACAATATATTGAGCTGGG - Intergenic
980085461 4:128386039-128386061 TGGTAACAAGCAATGGAGATGGG + Intergenic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
983752139 4:171287764-171287786 TGTTAATAATAGAGGGATCTGGG - Intergenic
984042909 4:174758699-174758721 TGGTAATAATAGAGGAAACTGGG + Intronic
984082360 4:175263285-175263307 TGGTAATAATGGATGGAGTAAGG + Intergenic
984422470 4:179542133-179542155 AGGGAACAATAGATTAAGCTAGG + Intergenic
984467571 4:180119991-180120013 TGGTAAGAAGTGAAGGAGCTAGG + Intergenic
988611424 5:32729845-32729867 TGGTAACATTAGAGGAAGCTTGG - Intronic
991004142 5:61811322-61811344 TGTTAACAATTGATGAATCTAGG + Intergenic
991560523 5:67946843-67946865 TGGTAACATTTGAGGGAGGTAGG - Intergenic
992445749 5:76831876-76831898 TGATAAGAATAGCTAGAGCTGGG + Intronic
995931279 5:117448927-117448949 TGAGAAAAATAGATGAAGCTTGG + Intergenic
996096931 5:119408745-119408767 TTGTATTAATAGCTGGAGCTTGG + Intergenic
998501336 5:142635600-142635622 TTGTAACACAAGATGCAGCTTGG - Intronic
999536568 5:152523786-152523808 GGGTAAGAAGAGATGGGGCTAGG + Intergenic
1000073623 5:157764252-157764274 AGGTAATAAGAGAAGGAGCTGGG - Intergenic
1000782885 5:165505897-165505919 TGGGAAGAATAGATGGAGACAGG - Intergenic
1003023800 6:2535327-2535349 AGGTAACAATATATGCAGGTGGG - Intergenic
1004009913 6:11674391-11674413 TGTTAACAATAGAAGAAACTGGG - Intergenic
1005977299 6:30809556-30809578 TAGTAACAGTTGATGGAGCTGGG + Intergenic
1008547595 6:52597089-52597111 AGCTAGCAACAGATGGAGCTAGG - Intergenic
1012512887 6:100024805-100024827 TGGGAAGAGGAGATGGAGCTGGG + Intergenic
1012779290 6:103536209-103536231 TGGGAAGAATAAATGGATCTAGG - Intergenic
1015196773 6:130532224-130532246 TTGAAAAAATAGATGGAGTTAGG - Intergenic
1018275295 6:162124066-162124088 TGGAAACAACAGCTGGTGCTTGG - Intronic
1018523514 6:164679957-164679979 GGGAAACAATAAATGGACCTGGG + Intergenic
1022265644 7:28751673-28751695 TGTTAACATTAGAGGAAGCTTGG - Intronic
1023420695 7:39976388-39976410 TGGTAGCAATAAATAGTGCTTGG + Intronic
1035856665 8:2983102-2983124 TGAGAACAACAGATGGAACTTGG - Intronic
1037047833 8:14331564-14331586 TGGTAACAATTGACAGACCTAGG + Intronic
1042356584 8:67835075-67835097 TGTTAACAATTGGTGAAGCTGGG + Intergenic
1043155665 8:76776065-76776087 TGGTACCAATAAAAGGAGCAAGG - Intronic
1047152699 8:122282682-122282704 TGTTAACATTAGAGGAAGCTAGG + Intergenic
1047652993 8:126944866-126944888 TGGGAAGAATAGCTGGAGCTAGG + Intergenic
1050471639 9:5997973-5997995 TGGTAACAATAGAAAGAAATAGG + Intronic
1052669630 9:31539202-31539224 TGGTAACAATAGGATGAGGTGGG + Intergenic
1055639177 9:78306146-78306168 TGGTAACAAAGGATGAGGCTGGG + Intronic
1056851573 9:90088931-90088953 TGTTGACATTAGAGGGAGCTTGG - Intergenic
1056949443 9:91030289-91030311 TAGTATCAATAGCTGGAGCTTGG - Intergenic
1057214339 9:93219778-93219800 TGGTGGCAACAGGTGGAGCTGGG - Intronic
1059734513 9:117087973-117087995 TGTTAACAACAGGTGAAGCTAGG - Intronic
1059762322 9:117350079-117350101 TGGTAACATTAGGGGAAGCTGGG + Intronic
1060058427 9:120436710-120436732 TGCTAACAACTGATGAAGCTGGG + Intronic
1060766702 9:126299443-126299465 TAGTAAATATAGCTGGAGCTTGG + Intergenic
1061555850 9:131368400-131368422 TGGTATAAAGAGATGGGGCTGGG + Intergenic
1061625775 9:131839827-131839849 TGGAAACCAAAGATGGGGCTGGG + Intergenic
1187020829 X:15379741-15379763 TGGTAATAATAAATGTATCTGGG + Intronic
1189185910 X:39054682-39054704 TGGTAACAATTGGTGCATCTAGG - Intergenic
1191979382 X:66909237-66909259 TAGTAGCAATGGCTGGAGCTGGG + Intergenic
1192608622 X:72545499-72545521 AGGTAGTAATTGATGGAGCTGGG + Intronic
1193826637 X:86234525-86234547 TGGTAACAATAGGGGAAGCTAGG - Intronic
1197017305 X:121641527-121641549 TGGTGAGACTAGATGGTGCTGGG + Intergenic
1197458487 X:126708126-126708148 TGGAAACTTTAGATGGAGCATGG + Intergenic