ID: 929208646

View in Genome Browser
Species Human (GRCh38)
Location 2:39327930-39327952
Sequence TGATAAGCACACAACTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 195}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929208646 Original CRISPR TGATAAGCACACAACTTAGC TGG (reversed) Intronic
901441819 1:9282615-9282637 TGCAAAGGAAACAACTTAGCTGG + Intergenic
901970157 1:12902016-12902038 TGAAAAATACACAAATTAGCTGG + Intronic
902015014 1:13299765-13299787 TGAAAAATACACAAATTAGCTGG - Intergenic
903000560 1:20262646-20262668 TGAAAAATACAAAACTTAGCGGG - Intergenic
903439671 1:23378199-23378221 TTAAAAGCACAAAAATTAGCCGG + Intergenic
904583806 1:31567728-31567750 TTAAAAGCACAAAAATTAGCTGG + Intergenic
905147118 1:35895421-35895443 GGATAAGGAAACAACTTAGCAGG - Intronic
906449408 1:45931985-45932007 TGAGAAGAACACAACATTGCTGG - Intronic
908389302 1:63670492-63670514 TGAGAAACACACAACTTCTCCGG - Intergenic
909465070 1:75964287-75964309 TGATAAACTCAAAACTAAGCAGG - Intergenic
910161809 1:84280110-84280132 GGATAAACACATAATTTAGCAGG - Intergenic
911168536 1:94746340-94746362 TGATTAGTACCCATCTTAGCAGG - Intergenic
911968789 1:104403447-104403469 TGATAAATAAACAAATTAGCTGG - Intergenic
912621249 1:111161096-111161118 TGAATAGCAAACAACTGAGCTGG - Intronic
912915135 1:113807150-113807172 TGAAAAACACAAAAATTAGCCGG + Intronic
914809001 1:151012932-151012954 TAAAAAGCACAAAAATTAGCCGG - Intronic
918343382 1:183585461-183585483 TGAAAAATACACAAATTAGCTGG + Intronic
920107856 1:203567138-203567160 TGAAAACCACAAAAATTAGCCGG + Intergenic
921267024 1:213429313-213429335 CAAAAAGCACAAAACTTAGCTGG - Intergenic
921282742 1:213583657-213583679 TGAAAAATACAAAACTTAGCTGG + Intergenic
921500138 1:215891809-215891831 TGACAGGCACACAGCTCAGCTGG + Intronic
921692102 1:218164248-218164270 TTATAACCACACAACTTTGCTGG - Intergenic
921717200 1:218429915-218429937 TGTTAAGCATACAACTCAACTGG + Intronic
1062871197 10:906421-906443 TGGTAAGCACACAACTCCACTGG + Intronic
1063322870 10:5068627-5068649 TTATCAGAACACAACTTAGCAGG - Intronic
1063477594 10:6342650-6342672 TGAAAAATACAAAACTTAGCCGG + Intergenic
1063716455 10:8531926-8531948 TGAAAAACACAAAAATTAGCTGG + Intergenic
1064324021 10:14332060-14332082 TGAAAAACACAAAAATTAGCCGG + Intronic
1065306028 10:24369641-24369663 TGCTAAGTACACATCTTAGAAGG - Intronic
1066605689 10:37168020-37168042 TGATAAGGAGACAACTGATCTGG - Intronic
1066606472 10:37179812-37179834 TGATAAGGAGACAACTGATCTGG - Intronic
1067846170 10:49723459-49723481 TGAAAAACACAAAAATTAGCCGG - Intergenic
1068717621 10:60205685-60205707 TGATATGCAAACAAACTAGCTGG + Intronic
1069347404 10:67486282-67486304 TGATAAACAGACCACTTATCTGG + Intronic
1069463039 10:68612777-68612799 TGAAAAACACAAAAATTAGCTGG - Intronic
1069714901 10:70514406-70514428 TGAGAAACACATAATTTAGCAGG + Intronic
1069763674 10:70835239-70835261 TGATAAGAATACAAATTAGGAGG - Intronic
1070228495 10:74538091-74538113 TAATAAACACAAAAATTAGCTGG + Intronic
1071876484 10:89848783-89848805 TAAGAAACACACAAATTAGCTGG + Intergenic
1076226105 10:128777059-128777081 TGATCAGCACACAGCAGAGCAGG + Intergenic
1080044383 11:27793873-27793895 AGATGAGAACACAACTTGGCTGG - Intergenic
1080666169 11:34338217-34338239 TGAAAAGTACAGAAATTAGCTGG + Intronic
1082905230 11:58300601-58300623 TTAAAAACACAAAACTTAGCTGG + Intergenic
1085991498 11:81852283-81852305 TAAAAAGCACACATCTTAGGTGG + Intergenic
1086320525 11:85642361-85642383 TGATAAGCACATATGTTAGAGGG + Intergenic
1087943003 11:104123369-104123391 TGAAAAGCAAACAGCGTAGCAGG + Intronic
1088466345 11:110143870-110143892 TGATAAGGACACAAGTTAGCAGG - Intronic
1091556640 12:1578731-1578753 TGATAAGCAAAGAACTAAGCAGG + Intronic
1093709329 12:22312011-22312033 TGATAAGCACCCAACCTACCAGG + Intronic
1095669666 12:44843858-44843880 TGAAAAACACAAAAATTAGCTGG + Intronic
1100059308 12:90553234-90553256 TGATAGGAACACAGCTCAGCTGG + Intergenic
1101746682 12:107547030-107547052 TGAAAAGTACAAAAATTAGCTGG + Intronic
1102520251 12:113473310-113473332 TGATAAACACAAACATTAGCAGG - Intergenic
1103382928 12:120508861-120508883 TGATAAATACAAAAATTAGCTGG + Intronic
1103565983 12:121815669-121815691 AGAAAAACACACAAATTAGCTGG - Intronic
1109509264 13:63348227-63348249 TTATAAGCCCACAATTTGGCAGG + Intergenic
1112543692 13:100343031-100343053 TGCTAAGTACAAAAATTAGCGGG + Intronic
1114919575 14:27310034-27310056 TTATCAGAACAAAACTTAGCAGG + Intergenic
1116905857 14:50402850-50402872 TGAAAAACACAGAAATTAGCTGG - Intronic
1117496180 14:56307539-56307561 TGGTAAGCATACAACTCAACTGG - Intergenic
1117581303 14:57154118-57154140 TAAAAAGCACACAACTTACCTGG + Intergenic
1118207620 14:63738063-63738085 TGAAAAATACAAAACTTAGCTGG - Intergenic
1118418883 14:65576879-65576901 TGAAAAGTACAAAAATTAGCTGG - Intronic
1118420642 14:65598382-65598404 TTAAAAACACAAAACTTAGCTGG - Intronic
1120908100 14:89638562-89638584 CGAAAAGCACAAAAATTAGCTGG + Intronic
1202901895 14_GL000194v1_random:49173-49195 TGATGAGGACACAGCTTTGCAGG + Intergenic
1123784333 15:23654204-23654226 TGAGAAGCATACAATTTTGCTGG - Intergenic
1125355135 15:38809576-38809598 TGATAGGTACACAGCTCAGCTGG + Intergenic
1126574878 15:50186597-50186619 TGATAATAACAAAAATTAGCTGG - Intronic
1129647443 15:77449515-77449537 TGATATGCATACAATTTAACTGG - Intronic
1130220349 15:82014262-82014284 TGAAAAATACAAAACTTAGCCGG + Intergenic
1130342325 15:83010370-83010392 TGACAACCACACAACTTTACAGG + Intronic
1130646087 15:85728523-85728545 TGAGAAGCTCACACCCTAGCAGG + Intronic
1132152599 15:99473330-99473352 TGAAAAACACAAAAATTAGCTGG - Intergenic
1132918934 16:2372384-2372406 TAAAAAGCATACAACTCAGCAGG - Intergenic
1133752878 16:8738157-8738179 TGAAAAATACAAAACTTAGCTGG + Intronic
1133984012 16:10654210-10654232 TGAAAAACACAAAAATTAGCTGG - Intronic
1134748402 16:16605750-16605772 TGAAAAACACAAAAATTAGCTGG - Intergenic
1136031084 16:27503631-27503653 AGAGAAGCAGACAATTTAGCGGG - Intronic
1140296951 16:73718112-73718134 TTAAAAGCACACAAGTGAGCTGG + Intergenic
1140348292 16:74236367-74236389 TGAAAAACACAAAACTTAGCTGG + Intergenic
1143454460 17:7057326-7057348 TGAAAAACACAAAAATTAGCTGG - Intergenic
1143626222 17:8111588-8111610 TGATAAGCAAAGGACTTGGCAGG - Intronic
1145733326 17:27210236-27210258 TAAAAAACACAAAACTTAGCTGG - Intergenic
1148540286 17:48474951-48474973 TAATAAGAACAAAAATTAGCTGG - Intergenic
1153314442 18:3708165-3708187 TGAAAAGTACAAAAATTAGCTGG - Intronic
1155527380 18:26730980-26731002 CAAAAAGCACACAAATTAGCTGG - Intergenic
1156325669 18:36072621-36072643 CGAAAAGCACAAAAGTTAGCCGG + Intergenic
1156907145 18:42367424-42367446 TGATAAGAACACAGCCCAGCTGG - Intergenic
1160503740 18:79415898-79415920 TTAAAAGTACACAAATTAGCTGG + Intronic
1161018573 19:1996721-1996743 TGAAAAACACACAAATGAGCTGG + Intronic
1161838271 19:6662717-6662739 TGATATGCATACAAATTAGAGGG - Intronic
1163317191 19:16548921-16548943 TGAAAAGCTCACCACTGAGCTGG + Intronic
1163406598 19:17126823-17126845 TTAAAAGCACAAAAATTAGCCGG - Intronic
1163992738 19:21014243-21014265 TGATAATCTCACAACTGAGAAGG + Intergenic
1164042051 19:21501567-21501589 TGATAATCTCACAACTTAGAAGG + Intronic
1164212528 19:23112125-23112147 TGATAATCTCACAACTTAGAAGG + Intronic
1164279599 19:23758241-23758263 TGAAAAGAAAACAATTTAGCCGG + Intronic
1165190051 19:34055608-34055630 TGAAAAACACAAAAATTAGCTGG - Intergenic
1166681934 19:44773743-44773765 TGAAAAATACAAAACTTAGCTGG - Intergenic
1168571677 19:57476002-57476024 TGCTAAGCACAGAGCTTAGAGGG - Intronic
927870922 2:26623179-26623201 TGAAAAACACAAAAATTAGCTGG + Intronic
927905978 2:26857376-26857398 TAAAAAACACAAAACTTAGCTGG + Intronic
928970084 2:37018996-37019018 TTAAAAACACACAAATTAGCTGG + Intronic
929208646 2:39327930-39327952 TGATAAGCACACAACTTAGCTGG - Intronic
929265769 2:39917581-39917603 GGAGAAGCACACAACTTTGTAGG - Intergenic
930013214 2:46953663-46953685 TGATCTCCACACAACTGAGCTGG - Intronic
930623799 2:53673029-53673051 TGGTAAGCACACACCTCTGCTGG + Intronic
932040008 2:68289640-68289662 TGAAAAACACAAAAATTAGCTGG - Intronic
933337451 2:80976230-80976252 TGATAAGTAAACAAATTGGCAGG + Intergenic
933969460 2:87458419-87458441 TGATTAGCACACAAGTTACAAGG + Intergenic
934504801 2:94881271-94881293 TGATGAGGACACAGCTTCGCAGG - Intergenic
937786712 2:125907466-125907488 TAAAAAGCAGAAAACTTAGCAGG - Intergenic
938545752 2:132329669-132329691 TGATACACACACAACTTAGAGGG + Intergenic
941481480 2:166020497-166020519 TGATAAGCATACCATTCAGCTGG - Intronic
941842550 2:170102387-170102409 TGATAAGGTCACAACATATCAGG - Intergenic
1171874613 20:30562423-30562445 TGATACACACACAACTTAGAGGG + Intergenic
1172820601 20:37730201-37730223 TTATTACCAAACAACTTAGCAGG + Intronic
1173592617 20:44236924-44236946 TGAAAAGTACAAAAGTTAGCTGG + Intergenic
1174387600 20:50196663-50196685 TGAAAAACACAAAAATTAGCCGG - Intergenic
1174556432 20:51398705-51398727 TGATAGACACACACCTTAGCTGG - Intronic
1176621264 21:9063940-9063962 TGATGAGGACACAGCTTTGCAGG + Intergenic
1179790688 21:43754375-43754397 GGGTAAGCACACAGCTCAGCGGG + Intronic
1180734975 22:18009704-18009726 TAAAAAACACAAAACTTAGCTGG + Intronic
1180860545 22:19077988-19078010 TGAAAAATACAAAACTTAGCTGG - Intronic
1181924599 22:26348340-26348362 TAATAAGCATAAAAATTAGCTGG + Intronic
949707212 3:6832411-6832433 TGATAAGTATACAGCTTATCTGG + Intronic
953822884 3:46223444-46223466 TGAGAAGCTTACAATTTAGCTGG - Intronic
954324403 3:49855284-49855306 TGAAAAACACAAAAATTAGCTGG + Intronic
956364926 3:68490998-68491020 TAAAAAGTACAAAACTTAGCTGG - Intronic
956676983 3:71744581-71744603 TGAAAAGTACAAAAATTAGCTGG + Intronic
962589809 3:136878245-136878267 CTATAAACACACAAATTAGCCGG + Intronic
962637555 3:137346564-137346586 TGAAAAATACAAAACTTAGCTGG - Intergenic
963576190 3:147063440-147063462 TTATCAGAACACAACTTACCAGG + Intergenic
964664137 3:159153419-159153441 TGACAAGCACACAACTCCACTGG - Intronic
965111736 3:164433467-164433489 TAATAAACACAAAAATTAGCTGG - Intergenic
966183788 3:177210386-177210408 TGAAAAATACAAAACTTAGCTGG + Intergenic
966785824 3:183621735-183621757 TGATAGGAACAGTACTTAGCTGG - Intergenic
969445114 4:7240295-7240317 TGATAAGAACAAAGCTCAGCAGG - Intronic
973643582 4:52927701-52927723 TCAGAAACACACAACTCAGCTGG + Intronic
975324468 4:73043764-73043786 TCATACACACACAACTGAGCAGG - Intergenic
977779724 4:100966753-100966775 TTAAAAGCACAAAAATTAGCTGG - Intergenic
981286137 4:143020938-143020960 AGGTAAGCACAGAACATAGCAGG + Intergenic
983472233 4:168171670-168171692 TAATAAGGAAACAACTGAGCTGG + Intronic
985775106 5:1837381-1837403 TGATCAGCACACACCTGGGCTGG + Intergenic
985916597 5:2924320-2924342 TGAAAAACACAAAAGTTAGCTGG - Intergenic
987025083 5:13918630-13918652 TAAAAAGCACAAAAATTAGCTGG - Intronic
989386284 5:40857967-40857989 TGAGAAACACAAAAATTAGCTGG - Intronic
990149987 5:52805918-52805940 TGACCAGCACACAATTTTGCTGG + Intronic
996789758 5:127280483-127280505 TGATGAGCACACAACTTGATGGG - Intergenic
996882744 5:128318843-128318865 GAATCAGAACACAACTTAGCTGG + Intronic
997699926 5:135890045-135890067 TGAAAAATACAAAACTTAGCTGG - Intergenic
999195918 5:149781570-149781592 TGGCAAGCAGACAACTTAGAGGG - Intronic
1001878457 5:175221361-175221383 CGAAAAGCACAAAAATTAGCTGG + Intergenic
1001896482 5:175386453-175386475 TGGTAAGCAGACAGCTCAGCTGG - Intergenic
1004228107 6:13806090-13806112 TGAAAAACACAAAAATTAGCTGG + Intronic
1004647525 6:17577108-17577130 AGATGAGAACACACCTTAGCTGG - Intergenic
1005652633 6:27898478-27898500 TGAAAAGCACAAAAATTATCTGG - Intergenic
1006063462 6:31442755-31442777 GGATACGTGCACAACTTAGCTGG + Intergenic
1006491985 6:34395474-34395496 TGAAAAATACAAAACTTAGCTGG + Intronic
1008275903 6:49544058-49544080 TGAAAAACACAAAAATTAGCTGG + Intergenic
1009345216 6:62606717-62606739 TGAAAAGTACAAAAATTAGCTGG + Intergenic
1010258302 6:73786003-73786025 TGAAAAACACAAAAATTAGCTGG - Intronic
1011080839 6:83489076-83489098 TTGTAAGCACATAACTTACCTGG - Intergenic
1012579802 6:100853052-100853074 TGATCAGAACTCAACTTGGCTGG + Intronic
1012805395 6:103886572-103886594 TTAAAAGTACACAAATTAGCTGG - Intergenic
1013825376 6:114204910-114204932 TGATAAGTACACAACATGCCTGG + Intronic
1014869379 6:126573151-126573173 TGAAAAACACAAAAATTAGCCGG - Intergenic
1015255913 6:131179333-131179355 CTATAAACACAAAACTTAGCTGG - Intronic
1017131684 6:151113337-151113359 AGATAAGCACACAACTTCCATGG + Intergenic
1019270849 7:147726-147748 TCATAATCTCACAACTGAGCAGG - Intergenic
1025712711 7:63927117-63927139 GGATAAGGTCACAACTTTGCAGG + Intergenic
1027384963 7:77650664-77650686 TGAGAAATACAAAACTTAGCTGG - Intergenic
1027652258 7:80883327-80883349 ACAGAAGCACACACCTTAGCAGG + Intronic
1028170792 7:87593086-87593108 TGAAAAGTACAAAAATTAGCTGG - Intronic
1028849014 7:95515575-95515597 TGAAAAACACAAAAATTAGCTGG - Intronic
1029407746 7:100386676-100386698 TGATAAATACAAAAATTAGCTGG - Intronic
1031357395 7:120803632-120803654 TAATAAGCCCCCATCTTAGCTGG + Intronic
1031528670 7:122850992-122851014 TTGTAGGCATACAACTTAGCTGG - Intronic
1035134223 7:156684793-156684815 TGAAAAACACAAAAATTAGCTGG + Intronic
1035932104 8:3791659-3791681 AGAAAAGCACAAAAATTAGCTGG + Intronic
1037939705 8:22942327-22942349 TGATAAACTCACAGCTTAGAAGG + Intronic
1038283806 8:26189478-26189500 TGAAAAACACAAAAATTAGCTGG + Intergenic
1039749163 8:40461021-40461043 TGATCTCCACACAACTTAGAGGG + Intergenic
1040427957 8:47308221-47308243 TAAGAAGCACAAAAATTAGCTGG - Intronic
1040767338 8:50928859-50928881 TGAAAAACACAAAAATTAGCTGG - Intergenic
1045186412 8:99842989-99843011 TGAAAAATACAAAACTTAGCTGG + Intronic
1046421630 8:113991957-113991979 TGAAAAGAAAACACCTTAGCAGG + Intergenic
1047375982 8:124296488-124296510 TGATACACACACAACTTGGATGG - Intergenic
1051145275 9:14020602-14020624 TGATAAACACTCAAATTAGAAGG - Intergenic
1051977324 9:22966688-22966710 TAATAACCTCACAACTTAGTAGG - Intergenic
1052301752 9:26959848-26959870 TGATAGTCACAAATCTTAGCTGG - Intronic
1052812335 9:33072665-33072687 TACTAAACACAAAACTTAGCTGG + Intronic
1056586731 9:87932199-87932221 TGATAAGACCACAATTTACCAGG + Intergenic
1057504591 9:95622500-95622522 TGAAAAACACAAAAATTAGCTGG + Intergenic
1059688150 9:116657677-116657699 TGAAAAACACAAAAATTAGCTGG + Intronic
1060263362 9:122094096-122094118 CGAGAAACACAAAACTTAGCCGG - Intergenic
1060970846 9:127736878-127736900 TTAAAAGCACAAAAATTAGCTGG + Intergenic
1203744471 Un_GL000218v1:34410-34432 TGATGAGGACACAGCTTTGCAGG + Intergenic
1203565635 Un_KI270744v1:85074-85096 TGATGAGGACACAGCTTTGCAGG - Intergenic
1187972398 X:24671998-24672020 TTAAAAGCACAGAAATTAGCTGG + Intronic
1189846357 X:45142180-45142202 TGGAAAGCAAATAACTTAGCAGG - Intergenic
1193110974 X:77730105-77730127 TGATAAGGACACATGTTAGGAGG - Intronic
1194350507 X:92820767-92820789 TTATCAGAACACAACTTACCAGG - Intergenic
1198675609 X:139127254-139127276 TGAGAATCACACATCTTAGATGG - Intronic
1199729930 X:150621857-150621879 TGATAAGCTCATAATTTATCAGG - Intronic
1200140271 X:153897660-153897682 TGAAAAACACAAAAATTAGCTGG - Intronic
1200658822 Y:5937407-5937429 TTATCAGAACACAACTTACCAGG - Intergenic
1201157803 Y:11149394-11149416 TGATGAGGACACAGCTTTGCAGG + Intergenic