ID: 929210165

View in Genome Browser
Species Human (GRCh38)
Location 2:39347433-39347455
Sequence TCACACAGCTTACAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929210163_929210165 10 Left 929210163 2:39347400-39347422 CCTAGAGTTCTTAAGATGCAAGC 0: 1
1: 0
2: 1
3: 6
4: 148
Right 929210165 2:39347433-39347455 TCACACAGCTTACAAAAAACAGG 0: 1
1: 0
2: 3
3: 27
4: 243
929210162_929210165 14 Left 929210162 2:39347396-39347418 CCAGCCTAGAGTTCTTAAGATGC 0: 1
1: 0
2: 1
3: 10
4: 140
Right 929210165 2:39347433-39347455 TCACACAGCTTACAAAAAACAGG 0: 1
1: 0
2: 3
3: 27
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929210165 Original CRISPR TCACACAGCTTACAAAAAAC AGG Intronic
902412359 1:16218920-16218942 CCACGCAGCTTACAAGAAGCAGG + Intergenic
906789370 1:48645210-48645232 TCACTCAGGTTACATAAAGCAGG + Intronic
907039371 1:51244735-51244757 TCACACAAATAACAAATAACTGG - Intronic
907295412 1:53448975-53448997 TCACACAGCTAGAAAAAAAATGG - Intergenic
907427688 1:54391233-54391255 TCACCCAACTTCCAAAAAGCTGG + Intronic
907721849 1:56979505-56979527 TCACACAGCTTTTAAAAATAAGG + Intergenic
908158368 1:61380034-61380056 TCATATAGCTTAGAAAAAAATGG + Intronic
908517214 1:64905287-64905309 TCAAACAGCTTACGAAAACCTGG + Intronic
908853740 1:68399568-68399590 TCACACAGCTGATATAAAAAAGG - Intergenic
909174690 1:72341949-72341971 TCATACAGATTACAAAATATTGG + Intergenic
909363631 1:74794287-74794309 TGGCACAGCTTTAAAAAAACAGG + Intergenic
910179477 1:84465473-84465495 AAACACAGCTTCCAAAACACAGG + Intergenic
911180177 1:94853525-94853547 TCACACAGGTTAGAAAGAATGGG + Intronic
911348657 1:96725544-96725566 TCAAACAACTAACAAAAAACTGG - Intronic
911779286 1:101855350-101855372 TCACACAGCTAATAAATGACAGG + Intronic
912101782 1:106216602-106216624 TCACACAAGTTACATAAAGCAGG - Intergenic
912250046 1:108001658-108001680 TCAAACAGCCTCCAAATAACCGG + Intergenic
912311727 1:108628841-108628863 CTACACAGATTACAAAAACCTGG - Intronic
912672002 1:111638227-111638249 TCATACAGCTTACAAGAATGAGG - Intronic
912911818 1:113768746-113768768 TCACACAGTTAACAAAACTCTGG + Intronic
913702006 1:121383029-121383051 TCACCCACCTGACAAAAAGCCGG - Intronic
914042563 1:144063498-144063520 TCACCCACCTGACAAAAAGCCGG - Intergenic
914135524 1:144896990-144897012 TCACCCACCTGACAAAAAGCCGG + Intronic
917211288 1:172634287-172634309 TCAAACGGCTTACAAAACTCAGG - Intergenic
920489429 1:206401749-206401771 TCACCCACCTGACAAAAAGCCGG - Intronic
922617914 1:226974031-226974053 TCAAACAACTTCCAACAAACAGG - Intronic
1063188757 10:3673618-3673640 TGAAAGAGCTTACATAAAACTGG - Intergenic
1064385235 10:14884788-14884810 TCACACAACTTATAAATAAGGGG - Intronic
1064750927 10:18527787-18527809 TCACAGAGTATAGAAAAAACAGG + Intronic
1065542949 10:26788333-26788355 TAACACAGCTTATATAAAATGGG + Intronic
1066231427 10:33438560-33438582 TAACACAGTTTACTAAAAACCGG - Intergenic
1066315076 10:34237571-34237593 TCAAACAGCTTTCAAAAGGCAGG + Intronic
1066794609 10:39105657-39105679 TCACAGATTTTACAAAAAAAAGG - Intergenic
1068806068 10:61195125-61195147 TCACACAGCTAATAAAAAACAGG - Intergenic
1069081272 10:64090623-64090645 TCATTAAGCTTTCAAAAAACTGG - Intergenic
1069622954 10:69849147-69849169 TCACAGTGCTTACAGAGAACGGG + Intronic
1071365499 10:84896119-84896141 TTACACAGACTACAAAAAAATGG - Intergenic
1072460785 10:95616839-95616861 TCACACAGCTTATAAATAACAGG + Intronic
1074225637 10:111481551-111481573 TCCCAAAGCTTAGAAATAACTGG + Intergenic
1074665576 10:115719488-115719510 GCACACAGTTGACAAAAACCAGG + Intronic
1076549999 10:131272195-131272217 ACACACAGCTTGCAAGAATCAGG + Intronic
1078944472 11:16048203-16048225 TCTCACAACTTCCAAAAATCCGG + Intronic
1080350003 11:31372833-31372855 CCACACATCTTACAAAGCACAGG - Intronic
1080699784 11:34634957-34634979 TCACACAGTTTAGAAAGAATTGG - Intronic
1081298396 11:41420336-41420358 TCACACAACTTACAATATAGTGG - Intronic
1081540471 11:44031067-44031089 TCACACAGCTAACACAAGGCAGG - Intergenic
1082106642 11:48228607-48228629 TCACACAGCTAACAGATGACAGG - Intergenic
1083090727 11:60197473-60197495 TCATACAGCTTACAACTACCTGG - Intergenic
1084409160 11:68996608-68996630 TCACCCAGATTGCAAAAAACAGG + Intergenic
1085742210 11:79087205-79087227 TCACACAGCTAGCAAAAAGCAGG + Intronic
1085784174 11:79437193-79437215 TCACACATAGCACAAAAAACAGG - Intronic
1086489816 11:87348037-87348059 TCACACAGTTCACAAGAAACAGG - Intergenic
1088049733 11:105497724-105497746 CCTCTCAGCTAACAAAAAACGGG + Intergenic
1088090575 11:106034690-106034712 TCTCACAGCTAACAAAAGAAAGG + Intergenic
1089051146 11:115547226-115547248 TCACACAGCTTATGAACAGCAGG - Intergenic
1089337551 11:117735429-117735451 TCACACAGGTTAAAAAGAACAGG + Intronic
1089636849 11:119820010-119820032 TCAAACACCTTACAAAAGTCAGG + Intergenic
1090746347 11:129708274-129708296 TCAAAAAGTTTACAAAAAATTGG - Intergenic
1093531585 12:20171518-20171540 TCAAAAAACTTTCAAAAAACTGG - Intergenic
1094091856 12:26659318-26659340 CCAAACAGCTTACAAATAACAGG + Intronic
1094316830 12:29145030-29145052 ACTCAAAGCTTACCAAAAACAGG - Intergenic
1094675871 12:32619889-32619911 TCACACTGCTTTCCAAAATCAGG + Intronic
1095329400 12:40939763-40939785 TCACACAGCTAATAAACAATGGG + Intronic
1097415699 12:59313592-59313614 TCACTCAGCTTACTAAAACAAGG + Intergenic
1098000455 12:65936827-65936849 TCACACAGCTTACGCATACCTGG + Intronic
1099057673 12:77865864-77865886 TCACAAATCTTAGGAAAAACAGG - Intronic
1102028323 12:109726061-109726083 TCACACAGCCTACAGAGAACGGG - Intronic
1102544212 12:113642848-113642870 TCACACAGCCTGCAAAAGCCAGG - Intergenic
1103026604 12:117579310-117579332 TCACACAGCTCGAAAGAAACAGG - Intronic
1104338074 12:127919232-127919254 TCACCCAGGTAGCAAAAAACAGG - Intergenic
1105653014 13:22401586-22401608 TCACACAGCTAACAAGAAAAAGG - Intergenic
1106634917 13:31518387-31518409 TCTCACAGTTTTCAAAAATCTGG + Intergenic
1106676771 13:31968193-31968215 TCACAAGGCATACAAAAAAGAGG - Intergenic
1107094724 13:36523724-36523746 TCACACAGCTTATAAGAGTCAGG + Intergenic
1107225859 13:38046148-38046170 CCACACAGATGAGAAAAAACTGG + Intergenic
1108200476 13:48038176-48038198 TCTCACAGCTTACACACAAAAGG + Intronic
1108486549 13:50932714-50932736 TCAAACAGCTTAGAAGAATCTGG + Intronic
1108509239 13:51139975-51139997 TCACACTTCTTACCAAAAAAGGG - Intergenic
1108753116 13:53468923-53468945 TCACCCAGCTTAGTAGAAACAGG + Intergenic
1108985949 13:56587654-56587676 TCACAAAGCTTATAAAAAGTTGG + Intergenic
1109640183 13:65181221-65181243 TCACACAGATTTCAAAAAAATGG + Intergenic
1111804473 13:93022411-93022433 TCACACAGGTTACACAGAAGAGG - Intergenic
1112524099 13:100127238-100127260 TCCCACAGATTAAAAAAAGCTGG - Intronic
1113098903 13:106695918-106695940 CCACACAGCATGCAAAGAACTGG - Intergenic
1119619396 14:76120306-76120328 TCAACAAGCTAACAAAAAACAGG - Intergenic
1121773217 14:96571168-96571190 TAACACAGCTTAAAAATTACAGG - Intergenic
1122110742 14:99499337-99499359 TCACACAGTGTAAAAAAAACTGG - Intronic
1122223866 14:100261095-100261117 TCCAACAGGTTACAAAAAATAGG - Intronic
1122571152 14:102702814-102702836 TCACAGAGCATACAAAGAAATGG + Intronic
1123917175 15:25043181-25043203 TCACAACTCTTCCAAAAAACAGG - Intergenic
1124809886 15:32925401-32925423 TCAGACAGTTTATAGAAAACAGG + Intronic
1125175477 15:36817388-36817410 GCAAACCCCTTACAAAAAACAGG + Intergenic
1125835785 15:42749509-42749531 GCACACAGCTTACAAGAACCAGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1127159109 15:56162169-56162191 CCACAATGCTTTCAAAAAACTGG + Intronic
1127702230 15:61512756-61512778 TCACACAGCAAACAATAAATGGG - Intergenic
1130033497 15:80336972-80336994 TAACACAGCTGATAAAATACTGG + Intergenic
1130684012 15:86021354-86021376 TCACACAGGAAACAAAAAAGTGG - Intergenic
1131116144 15:89797189-89797211 CCACACAGCTGGCAAAAGACAGG + Intronic
1131955155 15:97727743-97727765 TCACCTACCTTATAAAAAACTGG + Intergenic
1132784881 16:1651192-1651214 TCACACAGGTCACAAAAAGGTGG + Intronic
1134868179 16:17627712-17627734 TCACACAGCTTACAAGCAGCAGG - Intergenic
1135252037 16:20908473-20908495 TCACACAGCTAACAATAGGCAGG - Intronic
1139273177 16:65702301-65702323 TCATAAAGATTACAAAACACAGG + Intergenic
1140232410 16:73128463-73128485 TCACACAGCTTATAAATGACAGG + Intronic
1140413600 16:74757095-74757117 TAACACAGATGCCAAAAAACAGG + Intronic
1143073547 17:4319206-4319228 TCCCACAACTCAGAAAAAACTGG + Intronic
1147022390 17:37547094-37547116 TCATACAGATTAGAAAACACTGG - Intronic
1153530012 18:6036661-6036683 TCACAAAACTTACAAGAAACAGG - Intronic
1154245875 18:12697536-12697558 TCAGAAAGCATGCAAAAAACTGG + Intronic
1155472769 18:26208159-26208181 TGACACAGGTTACAACAAAGAGG - Intergenic
1156195297 18:34768063-34768085 TCACCCAGATTACAAATAAAAGG + Intronic
1156645184 18:39152532-39152554 TGACACAGCTAACAAAAATGGGG + Intergenic
1157180126 18:45489763-45489785 TCACAAAGTGTAGAAAAAACTGG + Intronic
1157369725 18:47099661-47099683 TCACACAGCTAACAAGCAGCAGG - Intronic
1157458146 18:47856504-47856526 TCACAAACCTTCCAGAAAACTGG + Intronic
1157844964 18:50994651-50994673 TCACACAGCTAGCAGATAACAGG + Intronic
1158457240 18:57619036-57619058 TAACACAGTTAACAAAAAAAGGG + Intronic
1158990909 18:62867560-62867582 TCAGAAAGCTTACAAATACCAGG - Intronic
1160805017 19:988816-988838 TCTCTCAGCTTACAACAACCGGG + Intronic
1162253262 19:9465062-9465084 TCAAACATCTTACATAAAAAGGG + Intergenic
1164036060 19:21456712-21456734 TCGCACTGTTTCCAAAAAACCGG - Intronic
1167851685 19:52207168-52207190 TCATACATTTTACACAAAACAGG + Intronic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
925813559 2:7725094-7725116 TGACACAGCTTAAAAAAGAAAGG - Intergenic
926200075 2:10788603-10788625 GAACACAGCTTACAAAAACACGG + Intronic
927243126 2:20935922-20935944 TCCCAGAGCTTCCAAAACACAGG - Intergenic
927848406 2:26484037-26484059 TCCCCCAGCTCACAAAAGACAGG + Intronic
929210165 2:39347433-39347455 TCACACAGCTTACAAAAAACAGG + Intronic
932400483 2:71477458-71477480 ACACAGAGCTTGAAAAAAACAGG + Intronic
933946592 2:87291584-87291606 TCACACAGCTGATAAAGAAAGGG - Intergenic
934117321 2:88809878-88809900 TCACACAGCTTAGGCAAAAATGG - Intergenic
934158650 2:89227291-89227313 TCACAAAGTTTACAAATAGCTGG - Intergenic
934189343 2:89772143-89772165 TTACAAGGCTTACAAAGAACGGG - Intergenic
934208624 2:89955136-89955158 TCACAAAGTTTACAAATAGCTGG + Intergenic
936026921 2:109038625-109038647 CCACATAGCTGACAAAAGACTGG + Intergenic
936333600 2:111569957-111569979 TCACACAGCTGATAAAGAAAGGG + Intergenic
938320710 2:130360565-130360587 ATACACTGTTTACAAAAAACAGG - Intronic
939027878 2:137035153-137035175 ACACACAACTTCCAAAAAAAGGG - Intronic
939752783 2:146068182-146068204 TCTCAGAGCTTACAAAAAGAAGG + Intergenic
940233176 2:151480903-151480925 TCACAGATAGTACAAAAAACAGG - Exonic
940697818 2:157002020-157002042 TCACACAGCTTAAGATAACCAGG - Intergenic
940793930 2:158057018-158057040 TCAGACACATTCCAAAAAACGGG - Intronic
943643362 2:190382928-190382950 TAACTCAGCTTTCAAATAACTGG - Intergenic
944300411 2:198118032-198118054 TTACAGAGCTTACAATAAGCAGG - Intronic
946951998 2:224886355-224886377 TACTACAGCTTACAACAAACCGG + Intronic
947476481 2:230453020-230453042 TCACACTGCTAATAAAAGACTGG + Intronic
1168895689 20:1321853-1321875 TCCCACTGCTCCCAAAAAACAGG + Intronic
1171222459 20:23411628-23411650 ACAAACAGCTTAAAAAAAAAGGG + Intronic
1172167051 20:32905951-32905973 TCACACAGGTTGCAAACAATGGG - Intronic
1174479002 20:50817849-50817871 TCACACAGTTAACAAACAGCGGG - Intronic
1176545422 21:8195408-8195430 TCATACAGTTTACATACAACCGG - Intergenic
1176564373 21:8378453-8378475 TCATACAGTTTACATACAACCGG - Intergenic
1177476730 21:21633414-21633436 TAAAACAGCTTACAAATAAAAGG - Intergenic
1179041514 21:37806561-37806583 TCAGACAGCTTTCAAATATCAGG + Intronic
1179375662 21:40848042-40848064 TCAGACAGCTCACAAAACACAGG + Intergenic
1181711064 22:24689497-24689519 TCACACTAATTACAAAATACAGG + Intergenic
1182154126 22:28053180-28053202 TCACACAGCTCACTAAGGACTGG - Intronic
1182308270 22:29386643-29386665 TCACACAGCTTAAAAAAAAAAGG + Intronic
1182985272 22:34710413-34710435 TCACACAGCATAGAAGAAAAGGG - Intergenic
1184900189 22:47441806-47441828 TTATGCAGCTTACAAAATACAGG + Intergenic
1203250292 22_KI270733v1_random:111646-111668 TCATACAGTTTACATACAACCGG - Intergenic
950360302 3:12445136-12445158 TCACAAAGCTTGTAAAAACCAGG - Intergenic
951937211 3:28034949-28034971 TCACACATTTTAGAAAAAAAAGG + Intergenic
953076618 3:39577656-39577678 TCACATAGCCAACGAAAAACTGG + Intergenic
955319200 3:57962070-57962092 TCACACAGCTTAGACATAGCAGG - Intergenic
955443602 3:58983276-58983298 GCAAACAGCTTCCATAAAACAGG - Intronic
956171128 3:66434179-66434201 TCACATATCTAACAAAGAACTGG + Intronic
956454210 3:69404913-69404935 TCACAGTGCTTGCAAATAACAGG + Intronic
956689831 3:71865253-71865275 TTACTCAGCATACAAAAAACAGG + Intergenic
956932598 3:74062100-74062122 TCACATAGCAAACAAAAAATAGG + Intergenic
957480620 3:80788783-80788805 TGACCCAGCCTAAAAAAAACAGG - Intergenic
958513579 3:95081729-95081751 TCACACATCTTCCAAAAAGTAGG - Intergenic
960047865 3:113214191-113214213 TCACACAGCTTACCAAGAGTTGG - Intronic
963043000 3:141082980-141083002 TCACACAGCTCAGCAAAACCTGG - Intronic
963043024 3:141083143-141083165 TCACACAGCTCAGCAAAACCTGG - Intronic
963485143 3:145926374-145926396 TCACACAGCTAATAAGCAACAGG - Intergenic
963717231 3:148817472-148817494 TCTCCCAGCTTTCAAAATACTGG + Intronic
964195778 3:154062724-154062746 TCACGTAGCCCACAAAAAACTGG - Intergenic
965481846 3:169228301-169228323 GCACTGAGCTTAGAAAAAACAGG - Intronic
965848230 3:172989529-172989551 TCACACAGCCAGCAAATAACAGG - Intronic
966578584 3:181532928-181532950 TCAAGCAGTTTACAAAAGACAGG - Intergenic
967188531 3:186965711-186965733 TCACAGAGCTTACATATAACTGG + Intronic
970560893 4:17281366-17281388 TCACACAGCTTATAAAAAGTAGG - Intergenic
970874992 4:20858901-20858923 TCATACAGCTTACAAGTGACAGG + Intronic
972240592 4:37187673-37187695 TCACCCAGCTGACACAAAGCTGG - Intergenic
975225832 4:71870777-71870799 TCCCACAGAGTACAAACAACAGG - Intergenic
977841532 4:101712509-101712531 TCACACCTCCTACAACAAACTGG + Intronic
978533965 4:109741564-109741586 TCACACAGCTAACAAACGACAGG + Intronic
980274745 4:130634604-130634626 TCACACTGTTTACTAAAGACAGG - Intergenic
980668087 4:135966170-135966192 TCACACAGCTTATTAGAACCTGG - Intergenic
982534111 4:156586928-156586950 TCACACAACTAACAGATAACAGG + Intergenic
982579200 4:157156826-157156848 TCACTCATCATACAAAAAACTGG - Intronic
982720953 4:158859622-158859644 TCAAACGGCTGACATAAAACTGG - Exonic
983117908 4:163842729-163842751 TCACTCACTTTACAAAACACAGG - Intronic
983990921 4:174118654-174118676 TGACATAGCTTATACAAAACAGG - Intergenic
984497788 4:180520091-180520113 TCACACAGCTAGTAAAACACTGG + Intergenic
986409593 5:7464157-7464179 TCAAACAGCTTACAATGAAGAGG - Intronic
987137027 5:14909717-14909739 GAACACAGTTTAAAAAAAACTGG + Intergenic
987598133 5:20028370-20028392 TTACACAGATTAGAAAATACTGG - Intronic
988407202 5:30839132-30839154 TCCCATAGCTTACAAATGACAGG + Intergenic
988449404 5:31325727-31325749 TGACACAGCATACCAAGAACAGG + Exonic
990823116 5:59865281-59865303 TCATACAGTTTTCGAAAAACAGG - Intronic
991949748 5:71935991-71936013 TGTGACAGCTTACAAAAAATGGG + Intergenic
992808042 5:80357768-80357790 TCAAACAGCTCACAACCAACTGG - Intergenic
993397601 5:87410031-87410053 TCACACAGCTAATAAGGAACAGG + Intronic
993559308 5:89384603-89384625 TCACACAGCTTACAGTCTACAGG + Intergenic
995134797 5:108669684-108669706 TCACAAAGCTGACAAAAACTGGG + Intergenic
996538442 5:124603384-124603406 TCACAGAGCATGGAAAAAACTGG + Intergenic
996931057 5:128887920-128887942 TCAAACAGCTAAAAAAAAAATGG + Intronic
997637258 5:135421723-135421745 TTAAACAGATTTCAAAAAACTGG - Intergenic
998874267 5:146583593-146583615 TCACACAGCTCACAGATAGCGGG - Intronic
999208247 5:149865598-149865620 TCACACAGCATAAAGAGAACTGG + Intronic
999638612 5:153648463-153648485 TCACACAGCTGACAAACGGCAGG - Intronic
1001012435 5:168110479-168110501 TCACACAGCTGGCAAAAACAAGG + Intronic
1001541382 5:172542303-172542325 TCACACAGCTGATGAAACACAGG - Intergenic
1002171324 5:177376277-177376299 CCACACAGCAGACAAAGAACTGG + Intergenic
1003397753 6:5767596-5767618 TCACACAGCTAACAAGTAAGTGG - Intronic
1003904112 6:10683105-10683127 TCACTCAGCTTGCTAGAAACTGG - Intronic
1006710511 6:36065205-36065227 GAACACAGCTTACAAAGAAAGGG - Intronic
1008293339 6:49746259-49746281 TCCCACAGCTTACAAATATTAGG - Intergenic
1008461841 6:51784352-51784374 TCTCAGAGCTGACAAAAAACAGG - Intronic
1008847587 6:55986186-55986208 TCATACAGTTTACAAATAATAGG - Intergenic
1011494674 6:87926259-87926281 TCACACAGGTGACAAAAACAGGG + Intergenic
1012873755 6:104701039-104701061 TCACACAGCTGACATCAGACAGG + Intergenic
1015595244 6:134860235-134860257 TCACACAGGTTACTTAACACAGG + Intergenic
1019759353 7:2798172-2798194 TCACACAGCTCAGGAAAAGCAGG + Intronic
1019806302 7:3128678-3128700 TGACACAGATTGCAAAACACTGG - Intergenic
1021951013 7:25774917-25774939 TCACACAGTTTGCCAATAACTGG + Intergenic
1024184569 7:46936994-46937016 TCACACTGCATACCAAAGACTGG - Intergenic
1024418211 7:49132960-49132982 TGGCACAGCTGACAAACAACTGG - Intergenic
1026423647 7:70267578-70267600 TCACACAGCTAACGAAATTCAGG - Intronic
1029080046 7:97965933-97965955 TCACACAGTATACACAAAAGGGG - Intergenic
1030401769 7:109059883-109059905 TCAGCCATCTTCCAAAAAACTGG + Intergenic
1034150213 7:148909430-148909452 TCACACAGCTAACAAGGAATAGG + Intergenic
1034317912 7:150150914-150150936 TCAAACAAATTACAAAAATCAGG - Intergenic
1034838990 7:154378176-154378198 TCTCACAGCTTCCAAAAAAATGG - Intronic
1035897301 8:3417827-3417849 TCACACTGTCTCCAAAAAACAGG - Intronic
1036519509 8:9477305-9477327 ACACACAGCTTCCAGAACACAGG - Intergenic
1037382260 8:18298794-18298816 TCACACAGCCAAAAAAAAATAGG + Intergenic
1037388249 8:18365569-18365591 TAGCACAGCTTACAGAAAAGTGG + Intergenic
1040123598 8:43710041-43710063 TCACAGATCTTTCAAAAAAAAGG - Intergenic
1041128629 8:54671877-54671899 TCACAAAGCCTACAAAGAAGAGG - Intergenic
1042483623 8:69329281-69329303 TCACACATCTCACAAAGTACTGG + Intergenic
1043041100 8:75263043-75263065 ACCCACAGCTGACAAAATACTGG + Intergenic
1043522939 8:81065589-81065611 TCAGACTGCTAATAAAAAACTGG + Intronic
1043750094 8:83923953-83923975 TCATAAAACTTTCAAAAAACTGG - Intergenic
1044032478 8:87255655-87255677 TCACACAGTTAACAAAGGACAGG + Intronic
1044668233 8:94652638-94652660 ACAAACAGCTAACAAAAAGCAGG - Intronic
1046983941 8:120366885-120366907 TCACACAGCCTGCCAAGAACTGG - Intronic
1047594158 8:126359960-126359982 TCACACATCATACCAAGAACCGG + Intergenic
1047899123 8:129400613-129400635 TCAGAGAGCATACAAACAACTGG + Intergenic
1055615891 9:78072588-78072610 TCACACAGATTAAACTAAACTGG - Intergenic
1059188572 9:112301106-112301128 TCACACATCTCACAAGAAACTGG + Intronic
1060136560 9:121161109-121161131 TCACACATTTTAAAATAAACTGG - Intronic
1060269938 9:122133136-122133158 TCACACAGCTAATAAATAAGTGG + Intergenic
1060472480 9:123959882-123959904 TCACACAGCTGGAAAGAAACTGG + Intergenic
1203466694 Un_GL000220v1:94917-94939 TCATACAGTTTACATACAACCGG - Intergenic
1186042404 X:5495413-5495435 TGACAAAGCTTACAAGAAAGAGG + Intergenic
1186102459 X:6171536-6171558 TCACACAGCTTTCCAAGAAAGGG + Intronic
1186943981 X:14544425-14544447 TCAGGCAGCTTTCAAAAAATGGG + Intronic
1189321316 X:40089306-40089328 TCACACAGCTAGTAAAAAATGGG + Intronic
1191855878 X:65626330-65626352 TCACAAAGCATACAAAAAAATGG - Intronic
1192736850 X:73857233-73857255 TTACAAGGCATACAAAAAACAGG + Intergenic
1194476621 X:94366878-94366900 TCACATAGCCCACAAAAAACTGG - Intergenic
1195785323 X:108513633-108513655 ACATACATCTGACAAAAAACTGG - Intronic
1197835207 X:130686823-130686845 TGACACAGCTTAAAGTAAACTGG - Intronic
1197918250 X:131559500-131559522 TCACACAGGTTTCTCAAAACAGG - Intergenic
1201246251 Y:12006661-12006683 TCACACAGCTATTAAAGAACAGG - Intergenic
1201862544 Y:18615221-18615243 TCACACAGCCCCTAAAAAACTGG - Intergenic
1201870779 Y:18705159-18705181 TCACACAGCCCCTAAAAAACTGG + Intergenic
1202016309 Y:20410378-20410400 TTACAATGCTTACAAAAATCTGG + Intergenic
1202386584 Y:24332349-24332371 CCACACAGCTAAAAAAAAAATGG + Intergenic
1202484201 Y:25337779-25337801 CCACACAGCTAAAAAAAAAATGG - Intergenic