ID: 929210999

View in Genome Browser
Species Human (GRCh38)
Location 2:39357033-39357055
Sequence ATTATAACACAGTTGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929210999_929211003 4 Left 929210999 2:39357033-39357055 CCTTGTTCCAACTGTGTTATAAT 0: 1
1: 0
2: 1
3: 9
4: 176
Right 929211003 2:39357060-39357082 AATGGGACTGTATTTTAGCCTGG 0: 1
1: 0
2: 1
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929210999 Original CRISPR ATTATAACACAGTTGGAACA AGG (reversed) Intronic
907891636 1:58642116-58642138 ATTCTAACTTACTTGGAACATGG - Intergenic
909387179 1:75071432-75071454 ATTATAAATCAGTGGGAAAAGGG + Intergenic
909658583 1:78057671-78057693 ATTATAATACAGTTTTAAAATGG + Intronic
910146806 1:84089370-84089392 ATTATATCACAGTTGGTATGGGG + Intronic
911268568 1:95773463-95773485 CTTAAAACACAATTGGAATAAGG + Intergenic
911768145 1:101703945-101703967 CATATAAAACAGTTAGAACAGGG + Intergenic
912943234 1:114063354-114063376 ATTGGAATACAGCTGGAACAGGG + Intergenic
913565328 1:120068423-120068445 TTTCTAACACGGTTGGACCAAGG - Intronic
913632803 1:120725139-120725161 TTTCTAACACGGTTGGACCAAGG + Intergenic
914285917 1:146227778-146227800 TTTCTAACACGGTTGGACCAAGG - Intronic
914546949 1:148678531-148678553 TTTCTAACACGGTTGGACCAAGG - Intronic
914619559 1:149391831-149391853 TTTCTAACACGGTTGGACCAAGG + Intergenic
917769476 1:178261433-178261455 ATAAAAACACAGGTGGAATATGG - Intronic
918555081 1:185789433-185789455 ATTATATCACAGTGAGAATATGG - Intronic
919286779 1:195573597-195573619 ATAATAACCCAATTGGAAAATGG + Intergenic
919789020 1:201278130-201278152 GCTATAACACAGTTGGCACCAGG + Intergenic
920983129 1:210857073-210857095 ATTCTAACACAGTAGGCATAGGG - Intronic
1063563504 10:7150784-7150806 ATTATAAAAAAATTGGAACCAGG - Intergenic
1070672022 10:78384570-78384592 ATTATACCACAATTGGCAAATGG + Intergenic
1070989442 10:80718622-80718644 TTTAAAACACAGTTGGTACCTGG + Intergenic
1072317827 10:94220951-94220973 ACTGTAACCCATTTGGAACAAGG - Intronic
1072423394 10:95308749-95308771 ATTGTAACACACTTTGAAAATGG - Intergenic
1074541369 10:114367764-114367786 ATTATCCCACAGTTAGAAAAGGG - Intronic
1075775890 10:124987409-124987431 ATTAAAACCCAGGTGGACCATGG + Exonic
1077745149 11:4895291-4895313 ATTATAAGAACTTTGGAACAGGG - Intronic
1077779189 11:5306341-5306363 AATATAATACAGTTTGAAAAGGG - Intronic
1080604888 11:33857144-33857166 ATTAAAACACAGGTGGGGCACGG + Intergenic
1080807506 11:35667810-35667832 ATTATGACCAAGTTGGATCAAGG - Intronic
1081631864 11:44694770-44694792 ATTATATCCCAGTGGGGACAAGG - Intergenic
1086175983 11:83891538-83891560 TTTATAAAACAGCTGGAAAAGGG + Intronic
1087302451 11:96451526-96451548 ATTATAACACAGTGTGAAGTTGG + Intronic
1090039015 11:123274028-123274050 ATTATATGAGAGCTGGAACATGG + Intergenic
1090508654 11:127347485-127347507 ACTATAATAAAGTTGGAACTTGG - Intergenic
1090797414 11:130146908-130146930 ATTATTTCACAGCTGAAACATGG + Intergenic
1091760921 12:3086808-3086830 ATTATTGTACAGCTGGAACAAGG + Intronic
1092652469 12:10649362-10649384 ATTTTTATACAGTTGGACCATGG + Intronic
1094144831 12:27217437-27217459 ATGATAGCAGAGTAGGAACATGG - Intergenic
1097220628 12:57448733-57448755 ATTATAACAGAGTTGTGTCATGG + Intronic
1098922633 12:76316331-76316353 ATCATAACAAAGAGGGAACATGG - Intergenic
1100044769 12:90366332-90366354 ATTCTAACACAGCTGGCCCATGG + Intergenic
1100718737 12:97333112-97333134 ATTATATTATAGTTGCAACATGG - Intergenic
1103426056 12:120835127-120835149 ATTAAAAGGAAGTTGGAACAGGG - Intronic
1104320988 12:127750570-127750592 ATCATAACACAGATGGGACGTGG - Intergenic
1105958702 13:25308652-25308674 ATTAAAACAAAGTGGGAAAAGGG + Intronic
1106625127 13:31412857-31412879 GTTATAACATAGTAGGTACAGGG - Intergenic
1109101847 13:58195102-58195124 ATTATATGACATTTGGAATAGGG - Intergenic
1109752760 13:66718015-66718037 ATTAAAAAACAGTTGAAAAAGGG + Intronic
1110346324 13:74451810-74451832 ATTATAACACAGTATGAAGGGGG - Intergenic
1110704470 13:78588904-78588926 ATTATAATACAGTATGAATAGGG - Intergenic
1111504990 13:89176258-89176280 ATTTTAAAAGAGTTGGTACATGG - Intergenic
1118230862 14:63947861-63947883 ACTACAGCACAGTAGGAACATGG - Intronic
1119156549 14:72416937-72416959 TGTATAAAACACTTGGAACAGGG + Intronic
1120448346 14:84631304-84631326 AATATAACAGAGTTGTATCATGG - Intergenic
1120530840 14:85629490-85629512 GTTATCACACAGTTTGCACAAGG - Exonic
1122051175 14:99061164-99061186 TCTATAACACAGCAGGAACAGGG - Intergenic
1122168748 14:99853334-99853356 ATTAGAGCACAGTGGAAACAGGG + Intronic
1125038411 15:35154149-35154171 ATTACAAAACAGCTGGAAGAGGG + Intergenic
1125072154 15:35567826-35567848 AATATAACACAGATGGAATACGG - Intergenic
1125102256 15:35927963-35927985 AAAATAACACATTTTGAACAGGG - Intergenic
1125968074 15:43890276-43890298 ATTATTACAGAGTTGACACATGG + Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1131390726 15:92046031-92046053 CTTATAACCCAGTTGGAAAATGG - Intronic
1138319467 16:56099605-56099627 ATCACAACACAGTAGGACCAGGG + Intergenic
1138368714 16:56506308-56506330 ATTTTAACATAGTTGTAACAAGG - Intronic
1138937194 16:61741631-61741653 ATTATAACAAAGATGCCACAGGG - Intronic
1141936196 16:87239919-87239941 ATTATAAAACAGTTTGAAGTGGG + Intronic
1148937014 17:51171273-51171295 AGCATAATACAGTTGAAACAAGG + Intronic
1149079297 17:52634227-52634249 ATTATAACAGAGTTTGAAGTTGG - Intergenic
1149123096 17:53193835-53193857 ATAATAATACAGTTCTAACATGG - Intergenic
1149879691 17:60276204-60276226 ATTACAAAAAAGTTGAAACAGGG - Intronic
1150912522 17:69403428-69403450 ATTAAAAAACAGTTAGAACTAGG + Intergenic
1155506052 18:26533957-26533979 ATTGAAACACATTTGGAATATGG + Intronic
1156847414 18:41682705-41682727 ATTGTAACACAGCTGAAAGAAGG - Intergenic
1158259773 18:55593666-55593688 ATTTTAACACAGGTGGGACTCGG - Intronic
1158823987 18:61193957-61193979 TTTATAACACAATTGAGACAAGG + Intergenic
1163262600 19:16200166-16200188 ATTACCACACAGTTGGATCCAGG + Intronic
1165125651 19:33595006-33595028 ATTAGGACAGAGTTAGAACAAGG - Intergenic
1166914671 19:46186952-46186974 ATTATAAAACAGGAGGAACCTGG + Intergenic
1167481646 19:49735742-49735764 ATTCTAACAGTGTTGGACCAGGG + Intergenic
925429878 2:3782142-3782164 ATGACAACACAGTTGGAGCTAGG - Intronic
925585993 2:5464749-5464771 ATTATATTACATTTGGTACAGGG + Intergenic
926254476 2:11178296-11178318 ATTGTAACACAGATACAACAGGG + Exonic
927913767 2:26921024-26921046 ATTATAACACATTTTAAATAGGG + Intronic
929210999 2:39357033-39357055 ATTATAACACAGTTGGAACAAGG - Intronic
933097168 2:78200230-78200252 ATAATAACTCATTTGGAAGATGG + Intergenic
933280502 2:80327841-80327863 ATTATCACAAAGTTGAAAGAAGG - Intronic
933947790 2:87301743-87301765 ATTTTCACACACTTTGAACATGG - Intergenic
936332410 2:111559830-111559852 ATTTTCACACACTTTGAACATGG + Intergenic
936761359 2:115788366-115788388 ATTAAAACAAAGTTGAAAGAAGG + Intronic
938411350 2:131067313-131067335 CTTATATCACAATTGGAAGAGGG + Intronic
939287894 2:140156225-140156247 AATATAAAACGGTTGGATCAGGG - Intergenic
940904274 2:159154565-159154587 AACATAATACAGTTGAAACAAGG - Intronic
941630391 2:167877798-167877820 ATTATAACTCAGTAAAAACAGGG - Intergenic
941946356 2:171102596-171102618 ATTAAAACACAGTTAGAATGAGG - Intronic
942800455 2:179869181-179869203 ATTATATCATAGTTTGAATAAGG + Intergenic
943829560 2:192442669-192442691 ATTATTACAGAGATGGAAAAGGG - Intergenic
944055605 2:195519182-195519204 ATTTTAAAAGAATTGGAACAAGG + Intergenic
944222654 2:197317730-197317752 GCTACAACACAGTGGGAACAGGG + Intergenic
944363568 2:198889796-198889818 ATTAGAAGATAGTTGGAAGATGG - Intergenic
944418794 2:199506362-199506384 TTTTAAACACAGTTGTAACATGG - Intergenic
945795122 2:214353094-214353116 ATTATGACCCATTTGTAACAGGG - Intronic
946668444 2:222075953-222075975 ATTTAAATACAGTTGGAAAAGGG - Intergenic
1169537758 20:6564146-6564168 CATAGAACACAGTTGTAACAAGG - Intergenic
1169907884 20:10621731-10621753 ATTATATTAAAGTCGGAACAAGG - Intronic
1172938624 20:38639187-38639209 ATGAAAACACAGTTGGCCCAGGG - Intronic
1173490793 20:43479560-43479582 AGTAAAATACACTTGGAACAGGG + Intergenic
1173541772 20:43858526-43858548 ATCATAACAAAGTTGAAATAAGG - Intergenic
1173881660 20:46418223-46418245 ATCTGAACACAGTTGGAACACGG - Intronic
1175067739 20:56304442-56304464 ATCATAACACATGTGCAACATGG - Intergenic
1178174830 21:30084834-30084856 ATTATAACACACTTATAAAATGG - Intergenic
949295624 3:2519171-2519193 CTTGAAACACAGTTGGTACAAGG - Intronic
952186432 3:30974451-30974473 ATTGTAGAGCAGTTGGAACAGGG + Intergenic
953692240 3:45129398-45129420 ATAATAACAGACTTTGAACACGG + Intronic
955877621 3:63509861-63509883 ATTATAACGCAGTTTTCACATGG + Intronic
957824929 3:85429184-85429206 AATAGAACACAGCTAGAACATGG - Intronic
961361134 3:126367831-126367853 ATTATAACACTGTTGGAAAGAGG + Intergenic
962482459 3:135809525-135809547 ATTATAACACAGTGAGATAAGGG + Intergenic
962628092 3:137247530-137247552 ATTACAAAACAGCTGGAAGAGGG - Intergenic
962779529 3:138699018-138699040 ATTTTCACACAGTTGAGACAAGG + Exonic
964603017 3:158524051-158524073 ATTGTAACAGAGGTGAAACATGG - Intronic
965354815 3:167660721-167660743 ATTATTACACAGTTGGAAGAAGG + Intergenic
965540343 3:169865545-169865567 ATTATTACACATTGGTAACATGG + Intronic
971949194 4:33321936-33321958 TATAGAACACAGTTGTAACATGG + Intergenic
974732212 4:65882487-65882509 AATATATCACAGTGGCAACAAGG + Intergenic
976092144 4:81470355-81470377 TTTAAAACATAGTTGGACCATGG - Intronic
978727668 4:111988914-111988936 TTTATAATACAGTTAGAATAGGG + Intergenic
979123279 4:116930452-116930474 ATTATAAGACCATAGGAACAAGG + Intergenic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
984991136 4:185382682-185382704 ATTATAACCCAACTGGAAAATGG - Intronic
985209425 4:187576457-187576479 ATTTTACCACAGTTGCAAAAAGG + Intergenic
989438295 5:41440033-41440055 ATTCGCACACAGGTGGAACATGG + Intronic
990985330 5:61636357-61636379 ATTGTAACAATGTTGAAACATGG + Intergenic
991216582 5:64163256-64163278 ATTGTACCACAGTAAGAACAGGG + Intergenic
992127037 5:73652839-73652861 AGTATCACACAGTTAGAAAACGG + Intronic
993602407 5:89944015-89944037 ATTCTAACACATTTGGCAGAAGG + Intergenic
994042207 5:95271896-95271918 ATTATAAAACAATTGGAAGACGG - Intronic
996954789 5:129169936-129169958 ATGATAAGACACTGGGAACATGG + Intergenic
998733203 5:145105029-145105051 ATTATTACAGAGTTGGAATTAGG - Intergenic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1000994063 5:167941461-167941483 ACTATAACTCAGTAGGAAAATGG + Intronic
1002681119 5:180965565-180965587 AAAATAACACAGTTGTAAAACGG + Intergenic
1004472675 6:15943033-15943055 ATTATAATACAGTATGAAAAGGG - Intergenic
1009773489 6:68175501-68175523 AGTATAATACAGTAGGAACCAGG - Intergenic
1012269676 6:97193530-97193552 TTTATAACACAGTAGTAACAAGG + Intronic
1012698592 6:102422137-102422159 CTTATAACATAGTTTGAATATGG - Intergenic
1016801170 6:148170586-148170608 ATGATAACACAGTTGTGACAGGG - Intergenic
1016935481 6:149446460-149446482 ATTGTTACACATTTTGAACAGGG + Intergenic
1018383805 6:163284889-163284911 ATTAAAAAACAGCTAGAACATGG - Intronic
1019013266 6:168860492-168860514 ATTTAAACACAGTTTGAACCGGG - Intergenic
1020627361 7:10598573-10598595 ATTATAACAAAACTGGAAAATGG + Intergenic
1021298459 7:18939434-18939456 ATTATAATTCATTTGGAAAAAGG + Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023287386 7:38633085-38633107 ATTATAAAACAGTAGGTACCTGG + Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1029914700 7:104196968-104196990 ATAATATCACAGATGAAACAGGG - Intronic
1030340073 7:108368149-108368171 AATATAACACAGTGGGATCTAGG - Intronic
1030815520 7:114031783-114031805 GTTATAACAAAGTTAGAAAATGG - Intronic
1031263980 7:119560055-119560077 ATTTTAATATAGCTGGAACATGG + Intergenic
1031888385 7:127264657-127264679 ATTTTAACACAGTGGCATCATGG + Intergenic
1033146708 7:138877201-138877223 ATTATAAAACAGGCCGAACATGG + Intronic
1037157873 8:15727924-15727946 ATAATAACACAGTTAGTAGATGG + Intronic
1037951342 8:23020217-23020239 ATTATAACACATTTCAAATAGGG + Exonic
1038472293 8:27835486-27835508 AAGATAACACAGATGGAAGAAGG - Intronic
1038660810 8:29495078-29495100 CTGATAACACAGTTGAAAGAAGG + Intergenic
1044103093 8:88165681-88165703 ATAATAAAACATCTGGAACATGG - Intronic
1046866258 8:119153732-119153754 ATGAAAACACAGTTGTATCATGG - Intergenic
1047085038 8:121506675-121506697 ATTTTAAAACAATTGGAACAGGG + Intergenic
1051909695 9:22139134-22139156 ATTTGAACACAGTGGGAAGATGG + Intergenic
1055417945 9:76104431-76104453 ATTATAACACAGTGGGGATTTGG + Intronic
1055833137 9:80406508-80406530 ACTTTAACACAGCTGGAATAAGG + Intergenic
1056882229 9:90406678-90406700 TTTATAACACAGATGAAATAAGG - Intergenic
1057706269 9:97397197-97397219 AATATTACACTGTTGGAACCCGG - Intergenic
1058345484 9:103955993-103956015 ATTTTGAAACAGTTGGGACACGG + Intergenic
1060159758 9:121350784-121350806 ATAATAACAATGTTGTAACATGG + Intronic
1187193543 X:17059332-17059354 ATTAGAAAAAAGTTGGAAAAAGG - Intronic
1187382638 X:18818926-18818948 ATTATAATATAGTAGGAAGATGG + Intronic
1187686597 X:21821729-21821751 TTTCTACCACAGTTGGTACATGG + Intergenic
1187873601 X:23784414-23784436 ATTATCACACACTTCAAACACGG + Intronic
1189160027 X:38801775-38801797 GTTATCACACTGTTGGAACTGGG + Intronic
1189849427 X:45164119-45164141 GGTATAACACAGTTGGGAGAAGG + Intronic
1190376349 X:49792118-49792140 AATACAACACACTTTGAACATGG - Intergenic
1190454743 X:50616732-50616754 ATTCTAACACAGGTGGTTCAGGG + Intronic
1194090424 X:89577891-89577913 ATTATGACACAGTTTGAAATAGG - Intergenic
1197629355 X:128840638-128840660 GTTCTAGCACTGTTGGAACAGGG - Intergenic
1197905153 X:131416861-131416883 ATTCTCACACAGTTGGCAGAGGG - Intergenic
1200443075 Y:3233940-3233962 ATTATGACACAGTTTGAAATAGG - Intergenic
1200832480 Y:7700475-7700497 ATTATGCCCCAGTTGGACCAGGG + Intergenic