ID: 929212053

View in Genome Browser
Species Human (GRCh38)
Location 2:39367971-39367993
Sequence GCCCTCCTTCCCTGACTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929212053_929212058 30 Left 929212053 2:39367971-39367993 CCAGGTAGTCAGGGAAGGAGGGC 0: 1
1: 0
2: 2
3: 24
4: 272
Right 929212058 2:39368024-39368046 TTTGGTCTCCTTTTCTTACCTGG 0: 1
1: 0
2: 1
3: 25
4: 325
929212053_929212054 12 Left 929212053 2:39367971-39367993 CCAGGTAGTCAGGGAAGGAGGGC 0: 1
1: 0
2: 2
3: 24
4: 272
Right 929212054 2:39368006-39368028 TCCTGACCTATAAACCTGTTTGG 0: 1
1: 0
2: 0
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929212053 Original CRISPR GCCCTCCTTCCCTGACTACC TGG (reversed) Intronic
900271969 1:1795249-1795271 GCCCTCCTCCACTGGCTTCCTGG + Intronic
900274279 1:1813564-1813586 GCTCTGCTTCCCTGACTCCTGGG + Intronic
901379392 1:8862876-8862898 GCCCTCCTTACCTGAGGAGCTGG + Exonic
901630162 1:10644115-10644137 CCCCTGCTGCCCTGACCACCAGG + Intronic
901767957 1:11515736-11515758 GACCTCCTTCCCACACTTCCTGG - Intronic
901856355 1:12046740-12046762 GCCTTCCTTCCCTTCCTCCCTGG + Intergenic
902072243 1:13749695-13749717 GCCCTCCCGCCCTGCCGACCCGG + Intronic
902331663 1:15733954-15733976 GCCTTCCTTTCCTGCCCACCAGG - Exonic
902932533 1:19741625-19741647 CCCCTCCTTCCTTGCCCACCTGG + Intronic
903565056 1:24258989-24259011 GCCCTCCAGCCCTGATTACAGGG - Intergenic
905179526 1:36157242-36157264 GCCCTCCTTCCCAGCCTCTCTGG + Intronic
905815748 1:40949436-40949458 TCCCTCCTTACCTCACTCCCTGG - Intergenic
906063499 1:42963297-42963319 TCCCTTCTCTCCTGACTACCAGG + Intergenic
906511197 1:46411298-46411320 TCACTCCTTCCCTTACCACCAGG + Intronic
907237389 1:53061917-53061939 GCCCGCCTTCCCGGTCTCCCGGG + Intergenic
910302035 1:85716934-85716956 GCTCTCCTGCCCTGTCTTCCTGG - Intergenic
910934143 1:92473651-92473673 GCCCCCCTTTCCTGCCAACCTGG + Intergenic
912616167 1:111102170-111102192 CCCCCACTTCCCTGACAACCTGG - Intergenic
913264030 1:117026940-117026962 ACACTGCCTCCCTGACTACCAGG - Intronic
916059644 1:161089670-161089692 TCCCTCCTTCCCTCCCTCCCTGG - Intergenic
916452311 1:164932772-164932794 CCCCTCCTCCCCTGACTACTTGG + Intergenic
918231171 1:182533812-182533834 GCCCTCCTGCCTTGACTAATAGG - Intronic
918423687 1:184387448-184387470 GGCCTCCCTCCCTGCCCACCCGG - Intronic
920988825 1:210916022-210916044 TGTCTCCCTCCCTGACTACCAGG - Intronic
922431563 1:225560077-225560099 GCCAGCCTTCCCACACTACCAGG + Intronic
922958697 1:229626293-229626315 GCCGTCCTCCCCTGTCTACCCGG + Exonic
923614333 1:235524428-235524450 GCCCTCCCTCCCCGCCTCCCAGG - Intergenic
1063808723 10:9679226-9679248 GCCCTCCATTCATGAGTACCGGG + Intergenic
1064437617 10:15325086-15325108 TTCCTCCTTCCCTGACAGCCAGG + Intronic
1065390471 10:25176311-25176333 GCCCTCCCTACCTGAATTCCGGG - Exonic
1065658631 10:27981153-27981175 TTCCTTCTTCCCTGACTTCCTGG - Intronic
1069325268 10:67225104-67225126 CCCCCACTTCCCTGACAACCTGG + Intronic
1069857910 10:71451813-71451835 GCACTCCTTCCCTAAGTTCCAGG - Intronic
1071546152 10:86531395-86531417 TCCCTCCTCTCCTGACTAGCTGG + Intergenic
1072474404 10:95745909-95745931 GGCATTCCTCCCTGACTACCTGG + Intronic
1072487157 10:95866463-95866485 GCCATCCTTCCCTGTCTGCCAGG + Exonic
1072709253 10:97705258-97705280 GCCCTCCTTGCTTAACTACAGGG + Intergenic
1073660603 10:105471939-105471961 GCCCTTCTTCCAGGCCTACCAGG - Intergenic
1074857243 10:117482437-117482459 GCCCTCCCTCCCTCCCTCCCTGG - Intergenic
1075093295 10:119455171-119455193 GGCCTCCTTCCCCGGCTCCCGGG - Exonic
1075162569 10:120037444-120037466 TCCCTCCTTCCCTCTCTACCAGG - Intergenic
1075969294 10:126638933-126638955 GCAATCCTTCCCTCACCACCAGG + Intronic
1076875171 10:133212388-133212410 ACCCTCCTCCCCTGAGCACCCGG - Intronic
1077264685 11:1642819-1642841 TCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1077864217 11:6209973-6209995 GCCCTCCGGCCCTGCCGACCTGG - Exonic
1078535675 11:12171364-12171386 GCTCTCCTTCCCAGACTAAAAGG + Intronic
1078545892 11:12246719-12246741 GCCTTCCACCCCTGAGTACCTGG + Intronic
1079155805 11:17946963-17946985 CCCCTCATTCCCTGCCTAACAGG + Intronic
1082810107 11:57474463-57474485 GCACTCCCTCCCTCACTGCCTGG - Intronic
1082997010 11:59262799-59262821 GCTCTCCCTGCCTGACCACCAGG - Intergenic
1083647792 11:64182903-64182925 GCTTTCCTTCCCTGCCTCCCAGG + Intergenic
1084179539 11:67439521-67439543 CCACTCCCTCCCTGACTGCCTGG + Intronic
1085407208 11:76270326-76270348 GCCCTGCTTCCCTGGAAACCAGG + Intergenic
1086132036 11:83410976-83410998 GCCCTCCTTCCCAGGCCACAGGG + Intergenic
1087584903 11:100106251-100106273 GCCCTTATTCTCTGATTACCTGG - Intronic
1089466793 11:118690799-118690821 GCTCTCCTTCCCTGAGCTCCTGG + Intergenic
1089810724 11:121129277-121129299 CCCCTCCTTCCCTGCCTTTCTGG - Intronic
1089880852 11:121771987-121772009 GCCATCCTACCCTGAGTCCCTGG - Intergenic
1090380168 11:126320968-126320990 AGCCACCTTCCCTGGCTACCTGG - Intronic
1090522985 11:127498591-127498613 CAGCTCTTTCCCTGACTACCTGG + Intergenic
1090841984 11:130498330-130498352 GCTCTCCATCCCTGAGTAGCTGG + Intergenic
1091084983 11:132712795-132712817 CCTCTCCTTCCCTGACCACCAGG - Intronic
1091228835 11:133974746-133974768 GCCCTCCCTCCATAACTACCTGG - Intergenic
1091771166 12:3152226-3152248 GCCCTCCTTGCCTGGCCACCAGG + Intronic
1092245617 12:6862482-6862504 TGCCTCATTCCCTGACTACCTGG + Exonic
1095697507 12:45157854-45157876 CCCCTCCTTCCCTGAATATTAGG - Intergenic
1095951596 12:47784635-47784657 GCCCTCCTTTCCTGAGTGCTGGG - Intronic
1096072383 12:48782540-48782562 GCCCTCCATCCCTACCTCCCTGG + Intronic
1096789982 12:54038577-54038599 CCCCTCCCTCCCTCACTACCAGG + Intronic
1102083652 12:110118488-110118510 ACCAGCCTTCCCTGACCACCTGG + Intergenic
1102167207 12:110816109-110816131 TCCCTCCTTCCCTTGCTGCCTGG + Intergenic
1102493752 12:113305198-113305220 TCCCTCCTTCCCAGCCAACCTGG + Intronic
1103451871 12:121034895-121034917 GACCTCCTTCCATTACTAACAGG - Intronic
1104424225 12:128661415-128661437 GCCGTCCTTCCCTGAGACCCTGG - Intronic
1104943051 12:132403870-132403892 GCCCTCCCTCCCTGGCTCCTGGG - Intergenic
1106794165 13:33187215-33187237 CCCCTCTTTCCCTGCCTTCCCGG - Intronic
1107495911 13:40925530-40925552 CCCCACCCTCCCTGACAACCAGG - Intergenic
1108667741 13:52649759-52649781 CCCCACCCTCCCTGACAACCAGG + Intergenic
1113026673 13:105948281-105948303 ATCCTGCCTCCCTGACTACCTGG - Intergenic
1113790249 13:113024672-113024694 TATCACCTTCCCTGACTACCCGG + Exonic
1114354262 14:21890042-21890064 GCCTCCCTCCGCTGACTACCTGG + Intergenic
1116599551 14:46902379-46902401 TCCCTCCCTCCCTCACTACAGGG + Intronic
1117783597 14:59259487-59259509 GCCTTCCTGCCCTGTCTTCCTGG + Intronic
1119689402 14:76659297-76659319 GACCTCCTTCCCTGAAAATCTGG - Intergenic
1119920792 14:78444309-78444331 GCCCTCCTTCCCAGGGTTCCTGG + Intronic
1122236082 14:100331282-100331304 GCTCTCCTTGCCTGACCACTGGG + Intergenic
1122945735 14:105008061-105008083 GTCCTCCTTCCATCACTGCCGGG + Intronic
1124008600 15:25815093-25815115 TCCCTCCATCCCCTACTACCAGG + Intronic
1124797987 15:32801242-32801264 GCCCTCCTTGCCTCTCTCCCTGG + Intronic
1126087480 15:45023346-45023368 ACCCTCCTTCCCAGCTTACCAGG - Exonic
1127477691 15:59350217-59350239 GGCCTCCTTCCCTGATCACCAGG + Intronic
1130056466 15:80530569-80530591 GCCATCCTTCCCTGGTTGCCAGG + Intronic
1130569016 15:85023822-85023844 TCCCTCCTTCCCTGAACACTTGG - Intronic
1130695503 15:86127504-86127526 GCCATCTTTCCCTTGCTACCTGG - Intergenic
1131457933 15:92597741-92597763 ACCCTCATTCCCTGAATACTTGG + Intergenic
1131463869 15:92638997-92639019 GCCCTCCTTGCCTCACTGGCGGG - Intronic
1132731904 16:1366903-1366925 GGCCTCCTTGCCTGTCTCCCTGG - Intronic
1133026249 16:2990139-2990161 CCCCTCCTTCCCTCCCTCCCAGG + Intergenic
1133406823 16:5531160-5531182 TCCCACCTTCCCAGACCACCTGG - Intergenic
1133796908 16:9053502-9053524 GCCCTCCTCCTCTGTCCACCTGG + Intergenic
1134094901 16:11412830-11412852 GCCCCCCTCACCTGACTGCCTGG + Exonic
1136479930 16:30534737-30534759 TCCCTCCTTCCCTTGGTACCGGG - Exonic
1136491200 16:30609723-30609745 GCCCACCTCCCCTGACAACCTGG + Intronic
1136500412 16:30667350-30667372 GACCTCCTGCCCTGCCTTCCGGG + Exonic
1137288902 16:47038157-47038179 GCCCTCCCTCCCTTGCTTCCTGG - Intergenic
1137469716 16:48743445-48743467 GGCTTCCTTCCCTGACTGACTGG - Intergenic
1137559682 16:49494636-49494658 GCCCTCCTTGGCTGAGCACCTGG - Intronic
1138105570 16:54285753-54285775 CCCCTCCTTCCCTGGCTCCGCGG + Intronic
1138343704 16:56307244-56307266 TCCCTCCTTCCCAGAATCCCGGG + Intronic
1140049226 16:71464815-71464837 GCCCTTCCTCTCTGACCACCAGG + Intronic
1140838369 16:78816230-78816252 GCCCTCTTTCTCTGGCTTCCTGG - Intronic
1141154485 16:81587731-81587753 TCCCTCCTCCCCTGACTTCAGGG + Intronic
1141288411 16:82694548-82694570 CCCCTCCTTCCCTTCCTCCCAGG + Intronic
1141647739 16:85376535-85376557 GCCCTCCCTGCCTGCCTGCCGGG + Intergenic
1141805271 16:86337663-86337685 GCCCTCCGTCCCCGCCCACCTGG + Intergenic
1142000678 16:87662589-87662611 GCCCTCCTTTCCTGGCCCCCTGG + Intronic
1142115694 16:88355025-88355047 GCCCACGTTCCCTGAGTATCAGG - Intergenic
1142403594 16:89873810-89873832 GCCCTCCTTCCCTGCGCCCCCGG - Exonic
1144023950 17:11261174-11261196 GCCCTCATTCCCAGACCACGTGG - Intronic
1145762668 17:27435061-27435083 GCCCTCATTCCCTGGCTGCTAGG + Intergenic
1146064375 17:29623067-29623089 TCCCTCCCTCCATGACTCCCGGG + Intergenic
1147951403 17:44109942-44109964 CCGCTCCTTCCCTCACTCCCAGG - Intronic
1148758209 17:49985704-49985726 GCTGCCCTTCCCTGACTTCCTGG + Intergenic
1149660676 17:58332632-58332654 GCCCTCCCTCCCTCCCTCCCTGG + Intergenic
1151402709 17:73866368-73866390 GCCCTCCTTCCATCTCTCCCTGG - Intergenic
1155543307 18:26888585-26888607 GCTCTCCTGCCCTGACTATTAGG - Intergenic
1155760590 18:29560490-29560512 GCCCTGCTCCTCTGACTACAGGG + Intergenic
1155908233 18:31478029-31478051 TCCCTGGTACCCTGACTACCAGG + Exonic
1156899302 18:42282140-42282162 ACCCTGCTTCCCTTACTTCCAGG - Intergenic
1156915511 18:42461659-42461681 GCCCTCCTTCCCTAATAGCCTGG - Intergenic
1158881412 18:61782926-61782948 ACCCTCCTTCCCAGCCTACCTGG + Intergenic
1158954464 18:62524782-62524804 GCCGTCCTTCCCCGCCTGCCTGG + Intronic
1159928358 18:74289276-74289298 TCCCTCCTTTCCTGACTCACAGG + Intronic
1160691325 19:461693-461715 GCCCTTCTTCCCTCACTTCTGGG + Intergenic
1161853897 19:6753061-6753083 CCCCACCTTCCCCGACAACCTGG - Intronic
1161955154 19:7489776-7489798 GCCCTCCTCCCCTCTCTACCAGG + Intronic
1162110526 19:8397441-8397463 TCCCTCCTTCCCTGCCTGCAGGG - Intronic
1162199191 19:9008896-9008918 TCCCTCCGTCCCCGACTGCCCGG + Intergenic
1163434003 19:17284263-17284285 GCTTTCCTGCCCTGAGTACCTGG - Exonic
1163790266 19:19302254-19302276 GCCCCCCTTACCTGAATGCCTGG + Exonic
1164674053 19:30090227-30090249 GCCCACCTTAGCTGACTACTGGG + Intergenic
1164678226 19:30117348-30117370 CCCCTCCTGCCCTGGTTACCAGG - Intergenic
1164899997 19:31910225-31910247 GCACTCCTTCCCTGCCATCCCGG - Intergenic
1166123932 19:40702556-40702578 TCCCTCCTTCCCTCCCTCCCAGG - Intronic
1166343341 19:42151256-42151278 TCCCCGCTTCCCTGAGTACCAGG - Intronic
1168526240 19:57090778-57090800 GCACTCATTCCCTGAATCCCGGG + Intergenic
1168663644 19:58185986-58186008 TCCATCCCTCCCTGAATACCAGG + Intronic
925160562 2:1680841-1680863 GCCCCCCTTCCCACACTGCCTGG - Intronic
925939399 2:8801616-8801638 GCCATCATGCCCTGCCTACCTGG - Intronic
928303649 2:30147708-30147730 GCCCTCCTGCCCAGAGGACCCGG + Intronic
929212053 2:39367971-39367993 GCCCTCCTTCCCTGACTACCTGG - Intronic
929357402 2:41042196-41042218 GCCCTCCCTCTCTGTCAACCAGG + Intergenic
929614915 2:43298758-43298780 GCCTTCATTCCCTGGCTTCCTGG - Intronic
930044417 2:47156353-47156375 ACTCTCCTCCCTTGACTACCAGG + Intronic
931445216 2:62321440-62321462 GCCCACCTTGCCTGTCTCCCAGG + Intergenic
933705337 2:85285448-85285470 GTCATCCTTGCCTGACTCCCTGG - Intronic
936701039 2:115012016-115012038 CCCCTACTTCCCTGGCAACCTGG + Intronic
937295776 2:120808972-120808994 GTCCTCCCTCCCTGATGACCTGG - Intronic
937455853 2:122041076-122041098 GCCCAGCTTCCCTTACAACCAGG + Intergenic
937659576 2:124415082-124415104 GTCCTCCTTCCCTGCTCACCTGG - Intronic
938199577 2:129362021-129362043 GCCCTCCTTCTTAGACTGCCTGG - Intergenic
938265618 2:129926016-129926038 GCCCGCCTTCCCTTCCTCCCTGG - Intergenic
938383199 2:130848081-130848103 GCCCACCCTCCCTGCCCACCTGG - Intronic
938796075 2:134719043-134719065 GCCCTCCCTCCCTGTCCACGCGG - Intergenic
938803837 2:134787954-134787976 CCCCACCTTCACTGTCTACCTGG + Intergenic
938998019 2:136701252-136701274 GCTCTGCTTCCCTGACTTACTGG + Intergenic
939999738 2:148955097-148955119 TCCCTCCTTCCCTCACAAGCAGG + Intronic
941638112 2:167957994-167958016 GCCCTCCTTCCTCTGCTACCTGG + Intronic
944171420 2:196783251-196783273 TCCCTCCTTCCCTTCCTTCCTGG - Intronic
946011035 2:216563679-216563701 GCCCAGCTTCCCTGACTTCAAGG + Intronic
946686442 2:222276462-222276484 GCCCTGATTCCCTGGCTGCCTGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948316052 2:237029245-237029267 GCCTTGCTTCCTTGTCTACCTGG + Intergenic
948697863 2:239742444-239742466 GCCCTTCTTCAGTGAGTACCCGG + Intergenic
948739953 2:240039789-240039811 GCCAGCCTTCCCACACTACCAGG - Intergenic
1168895180 20:1319350-1319372 CCCCTCCCTCCTTGACTGCCTGG - Intronic
1174643156 20:52062740-52062762 GCTCTCCTTCCCTGAGTTCTGGG + Intronic
1175543193 20:59761196-59761218 CCCCTCCCTCCCTGGCTCCCAGG - Intronic
1176124788 20:63470648-63470670 ACCCTCCTGCCCTGACAGCCTGG - Intronic
1179008044 21:37531686-37531708 GCCCTCCTTCCCTCCCTGCCTGG + Intergenic
1181934720 22:26429977-26429999 CCCCTCCTCCCCTGACCTCCTGG + Intronic
1182756326 22:32682521-32682543 GCCCTTCCTCCCTGGCTTCCAGG - Intronic
1183469085 22:37996291-37996313 CCCCTCTTTCCCTGCCTCCCTGG - Intronic
1183625349 22:38998059-38998081 TCCCTCCTTCCCTCCCTATCAGG + Intergenic
1184710302 22:46245672-46245694 GGCCTCCTGCCCAGACTAGCTGG - Intronic
1185038069 22:48489930-48489952 GCCTCCCTTCCCTGACTCCCCGG + Intronic
1185335522 22:50269542-50269564 CCCCTCCAGCCCTGGCTACCCGG + Intronic
949408537 3:3739819-3739841 GACCTCCTGGCCTAACTACCTGG + Intronic
950099433 3:10347949-10347971 GGCCTCCTTCCTTGTCTTCCCGG + Intronic
950829332 3:15859320-15859342 GCCCTGCTTCCCTTCCTTCCCGG + Intronic
951778895 3:26340852-26340874 GCCCCGCTTCCCTGAATACAGGG + Intergenic
952190682 3:31020026-31020048 GCTTTCCTTTCCTGACTCCCAGG + Intergenic
953790166 3:45941286-45941308 GCTCTCCTTACCTGAAGACCTGG - Intronic
956743076 3:72290013-72290035 ATTCTCCTTCCCTGACTGCCAGG - Intergenic
956761255 3:72447061-72447083 GCCCTCCCTCCCTCCCCACCTGG + Intergenic
960842050 3:121969295-121969317 TCCCTCCTCCCCTTTCTACCAGG - Intergenic
961450844 3:127001657-127001679 GCCTTCCTTCCCCCACTCCCTGG + Intronic
961536094 3:127572001-127572023 GCTTGCCTTCCCTGATTACCAGG + Intergenic
961539540 3:127590399-127590421 CCCCTCCTTACCTGACAGCCCGG + Exonic
963324206 3:143843204-143843226 GCCCAGCCTCCCTGACTGCCAGG - Intronic
964958614 3:162394324-162394346 GCCCTCTTTCCCTAATTAGCAGG + Intergenic
966191211 3:177272995-177273017 GCCCGCCTTCACTAACAACCTGG - Intergenic
968656190 4:1779478-1779500 GCCCCCATCCCCTGACCACCTGG + Intergenic
968699687 4:2048678-2048700 GACCCTCTTCCCTGACCACCTGG + Intergenic
969233784 4:5851031-5851053 CCCATCCTTGCCTGAATACCAGG + Intronic
970159613 4:13175708-13175730 TCACACCTTCCCTGACTCCCAGG + Intergenic
970236064 4:13959238-13959260 AGCCTTCATCCCTGACTACCTGG + Intergenic
972320431 4:37968771-37968793 TCCCTCCTTGCCTGTCTACATGG - Intronic
973784581 4:54323089-54323111 GCCCTCCTCACCTGCCTTCCTGG - Intergenic
976278616 4:83304292-83304314 CCCCTCCTTCCCTTTCTACCAGG - Intronic
976499747 4:85774037-85774059 GCCCTCCTTCCAGGACAACCAGG - Intronic
977053645 4:92162575-92162597 GCCCTTCTGCCCTCACAACCTGG + Intergenic
980179745 4:129389196-129389218 TCTTTCCTTCCCTTACTACCTGG - Intergenic
981069933 4:140524155-140524177 GGCCTCGCTCCCTGACTTCCGGG + Exonic
983597672 4:169489303-169489325 ACCCTCCTTGCCTGGCTGCCTGG - Intronic
985289521 4:188373697-188373719 GCCACTCTTTCCTGACTACCAGG - Intergenic
985947431 5:3197301-3197323 TCCCTTCTTCCCTGACACCCAGG + Intergenic
993197264 5:84764810-84764832 GCCCTCCATACCCAACTACCTGG + Intergenic
993375942 5:87149570-87149592 CTCCTCCTTGTCTGACTACCTGG + Intergenic
997435937 5:133875577-133875599 TCCCTCCTCCCCTCTCTACCAGG - Intergenic
1001171253 5:169420877-169420899 GCCCTCCTGCCAGGACAACCAGG - Intergenic
1002074381 5:176699428-176699450 TCCCTCCTTCACTGTGTACCTGG + Intergenic
1002164587 5:177336520-177336542 CCCTCCCCTCCCTGACTACCTGG - Intronic
1002211884 5:177604302-177604324 GCCCTTGTCCCCTGACTGCCCGG - Exonic
1003406551 6:5831334-5831356 GCTCTCCTACACTAACTACCTGG + Intergenic
1006413718 6:33891229-33891251 GCCTTCCTTCTCTGGCTCCCTGG + Intergenic
1006800833 6:36758741-36758763 GCCTTCCTTCTGTGTCTACCTGG - Intronic
1007681393 6:43636017-43636039 GCCCGTCTTCCCTGTCTTCCGGG + Intronic
1007817055 6:44531879-44531901 CTCCTCCTTCCCTGCCCACCTGG + Intergenic
1011651586 6:89511241-89511263 GCTTCCCTTCCCTGGCTACCTGG + Intronic
1014634360 6:123826518-123826540 TCTCCCCTTCCCTGAGTACCTGG + Intronic
1014797683 6:125745924-125745946 GGCTGCCTTCCCTGACTACAAGG - Intergenic
1015510055 6:134029535-134029557 GCCCTCCTTGCCTCACTCACCGG - Exonic
1018940275 6:168304871-168304893 GCCCTCCTGCCCCGTCTACCCGG - Intronic
1019045096 6:169139660-169139682 GCCCTTCATCCCTGACCGCCAGG + Intergenic
1019340789 7:507875-507897 CCCCTCCTTCCCTGACCCCCCGG + Intronic
1021110154 7:16684719-16684741 TCCCTCATTCCCTCACTCCCTGG + Intronic
1022029490 7:26479310-26479332 GGCCTCCTCCCCTGGCTAGCTGG + Intergenic
1024985064 7:55187494-55187516 GCCCTCCCTCCCTGAGCAGCAGG + Intronic
1028938161 7:96488944-96488966 GCCCTCCTTCTCTGCCTGCTGGG + Intronic
1029114943 7:98231999-98232021 GCCCTCCTCCCCTGGCACCCCGG - Intronic
1029549213 7:101228150-101228172 GCCATCCTTCCCTGAGTAGCTGG - Intergenic
1030299640 7:107962307-107962329 CCTCTCCTTCCCTCACAACCTGG - Intronic
1031130748 7:117830740-117830762 GCCACCCTTCCCTGGCTACTTGG + Intronic
1031341149 7:120603649-120603671 GACCTCCTCCCCTGACTCCTTGG + Intronic
1031891549 7:127299662-127299684 GCCCCCCTTCCCTGATTTCTTGG - Intergenic
1032475604 7:132209531-132209553 CCCCTCCTCCCCTGGCTGCCAGG - Intronic
1034395946 7:150824960-150824982 GCCCTCCTTCCATGCCTACCAGG - Intronic
1036417115 8:8561251-8561273 GTCCTCCTGCCCTGGCAACCAGG + Intergenic
1038104357 8:24416046-24416068 GACCTCCTGCCCAGACTAGCAGG + Intergenic
1038315040 8:26477040-26477062 GCCCTTCTTCCCTCACTAACTGG - Intronic
1038534774 8:28346260-28346282 TCCCTCCTTCCCAGCCCACCCGG - Exonic
1040536158 8:48312880-48312902 TCCCTCTGTCCCTGACTGCCTGG - Intergenic
1041436274 8:57845609-57845631 GCCCTCTTTCCCCCACTGCCTGG - Intergenic
1044186247 8:89255186-89255208 ACCATCCTTTCCTGACTCCCTGG - Intergenic
1047321354 8:123786979-123787001 GCTTTCCTTCCCTGACCAGCTGG - Intronic
1047448004 8:124937264-124937286 CCCCACCTTCCCTGAGTTCCTGG - Intergenic
1048334382 8:133491925-133491947 TCCCTCCTTTCCTGACTGCTGGG - Intronic
1048511159 8:135064088-135064110 TCTCTCCTTCCCTCACTTCCTGG - Intergenic
1048565568 8:135593093-135593115 TCCCTCCTCCCCTATCTACCAGG - Intronic
1049195131 8:141311598-141311620 GCACTCCTTCCCAGCCTACCCGG + Intergenic
1049201764 8:141343819-141343841 GCTCTCTTCCCCTGACTACATGG + Intergenic
1049345029 8:142134168-142134190 GGCCACCTTCCCTGGCTCCCTGG - Intergenic
1050611584 9:7359478-7359500 GCCTTCATGCCCTGACAACCTGG - Intergenic
1051135046 9:13910620-13910642 GCCCTCCTTAGCTGGCTACAAGG - Intergenic
1053286459 9:36852436-36852458 GCCCTCCCCTCCTGTCTACCTGG - Intronic
1053362705 9:37500709-37500731 GCCCTGCTTCTCTTACCACCTGG + Intronic
1054805720 9:69394232-69394254 GCCTTCCTTCCCTGACTTTAAGG + Intergenic
1054810476 9:69430271-69430293 TCCCTCCTTCCCAGACTCCTGGG + Exonic
1055447990 9:76402104-76402126 GCCCTTCTTCCCTCTGTACCCGG - Intergenic
1056918098 9:90762097-90762119 GCTCTCCATCCCTGACTATTAGG - Intergenic
1057138592 9:92713192-92713214 ACCCTTCTTCCCTGGCTGCCAGG - Exonic
1058081141 9:100702232-100702254 TCCCTCTTTCCCTCACTACTTGG - Intergenic
1059282801 9:113149271-113149293 GCACTCCTTCCCTGTCCCCCAGG - Intergenic
1059341857 9:113601776-113601798 GACCTCTATCCCTGACTTCCAGG + Intergenic
1059635077 9:116162391-116162413 TCTCTCCATCCCTAACTACCTGG + Intronic
1060022698 9:120146024-120146046 GCCCTCCGTCACAGACTGCCAGG + Intergenic
1060184018 9:121552888-121552910 GCCCTCCTCCCATGGCTTCCAGG + Intergenic
1061059150 9:128242097-128242119 CCCCACCCTCCCTGACTGCCAGG + Intronic
1061116661 9:128617749-128617771 GGCCTCCTTACCTGAATAGCCGG - Exonic
1061574419 9:131497133-131497155 GCCCTCCTGTCCTGACAACCTGG - Exonic
1061588284 9:131582645-131582667 GTCCTCCTTCCGAGCCTACCGGG - Exonic
1061802526 9:133120357-133120379 ACCCTCCTCCCCTCACCACCAGG + Intronic
1061816354 9:133199730-133199752 GGCCTCCGTCCCTGGCTCCCGGG - Intergenic
1062475758 9:136726266-136726288 GCCCTCCTTCCCTGCCTGCCGGG - Intergenic
1203758980 EBV:2218-2240 GCCCTCCTTCCGTCAGTTCCAGG + Intergenic
1185701529 X:2234454-2234476 TACCTCCTTCCCTGCCTTCCAGG + Intronic
1186301234 X:8201966-8201988 TCCAGCCTTCCCTGACTACTTGG + Intergenic
1188586029 X:31776693-31776715 TCCTTCCTTCCCTTACTGCCTGG - Intronic
1190242559 X:48668728-48668750 GGACTCCTTCCCTGACACCCTGG - Intergenic
1191129726 X:56995197-56995219 GCCCTGCTTCCAACACTACCCGG + Exonic
1191786179 X:64919137-64919159 GCCCCCCATCCCTGAGTCCCTGG - Exonic
1191996953 X:67105896-67105918 TACCACCTTCCCAGACTACCAGG - Intergenic
1195940615 X:110164669-110164691 GCCCTCATTCCTTTAGTACCTGG - Intronic
1196668988 X:118346185-118346207 GCCCTTCTTCCCTTACTGCGAGG + Exonic
1198097094 X:133390798-133390820 GCCCTCCTTTCATGAACACCGGG + Intronic
1199609596 X:149601222-149601244 GCCCTCCTGCCCTGCCTCCTGGG + Intronic
1199629520 X:149768132-149768154 GCCCTCCTGCCCTGCCTCCTGGG - Intergenic
1199664643 X:150087149-150087171 GCCCTGCTTCCCTGAGTGCCAGG + Intergenic