ID: 929212859

View in Genome Browser
Species Human (GRCh38)
Location 2:39377469-39377491
Sequence ATGTGGGTTTTGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 556}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929212859 Original CRISPR ATGTGGGTTTTGAGGGAAGT AGG Intronic
900750521 1:4394069-4394091 ATGTGGGTATGGAGGGTACTTGG + Intergenic
901989426 1:13100716-13100738 CTGTGGGTTTTGCAGGATGTGGG + Intergenic
901992387 1:13126048-13126070 CTGTGGGTTTTGCAGGATGTGGG - Intergenic
902991037 1:20187035-20187057 ATTTGGGTTGTGAGTGAAATAGG + Intronic
903071188 1:20727669-20727691 ATGTGTGTTTGGGGGGAATTTGG - Intronic
904823080 1:33257589-33257611 ATGGGAGTTTTGGGGGAACTGGG + Intronic
906409839 1:45569595-45569617 ATTGGGGTTGGGAGGGAAGTCGG + Intronic
906564072 1:46784046-46784068 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
906672734 1:47668518-47668540 AGGTGGGCTTTGAAGGATGTAGG - Intergenic
906877178 1:49552062-49552084 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
908175134 1:61547753-61547775 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
908476783 1:64496822-64496844 ATCTAGGTTTTGAGGAAATTGGG - Intronic
908828089 1:68152730-68152752 ATGTGGCTTCAGGGGGAAGTGGG + Intronic
908981722 1:69967181-69967203 ATGCTGGTTGTCAGGGAAGTAGG - Intronic
910077586 1:83298922-83298944 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
910739005 1:90494779-90494801 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
910919299 1:92326713-92326735 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
911678916 1:100691803-100691825 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
913339754 1:117747108-117747130 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
913493505 1:119405103-119405125 ATGCAGGTTGTGAGAGAAGTGGG - Intergenic
915320228 1:155052194-155052216 ATGAGGGTGTTTAGGGAGGTGGG + Intronic
916098114 1:161369280-161369302 ATGAGGATTTTGGGGGAAGAAGG - Exonic
917461566 1:175234799-175234821 ATGCAGGTTTTCATGGAAGTGGG - Intergenic
917844086 1:179006035-179006057 AAGTGGGTTTTGCGGGGGGTGGG + Intergenic
917898513 1:179517208-179517230 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
918133502 1:181649105-181649127 TTGAGGGTTTTAAGGGAGGTAGG - Intronic
918158342 1:181872648-181872670 ATGCAGGTTGTTAGGGAAGTGGG - Intergenic
918677008 1:187299387-187299409 ATATGGGGTTTGAGGGAAATAGG + Intergenic
919277892 1:195444891-195444913 ATGCCGGTTGTCAGGGAAGTGGG - Intergenic
919397415 1:197068690-197068712 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
920149578 1:203893757-203893779 ATGTGAGTTTTGAGAGAAACTGG + Intergenic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
922058120 1:222061381-222061403 ATGTGGTTCTTGTTGGAAGTGGG + Intergenic
922396082 1:225202449-225202471 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
922652757 1:227355406-227355428 AGGTGGATCTTGAGGGAGGTGGG - Intergenic
922673411 1:227532452-227532474 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
923648203 1:235845720-235845742 ATGAAGGTTGTCAGGGAAGTGGG - Intronic
923808670 1:237288569-237288591 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
923961129 1:239084937-239084959 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1064136883 10:12758719-12758741 AGGTAGGTTTTGAGGGACGCAGG + Intronic
1067943079 10:50672375-50672397 ATGTGGTTTTTGCAGGAAGCAGG - Intergenic
1069150529 10:64953995-64954017 ATGCAGGTTGTCAGGGAAGTTGG + Intergenic
1069153592 10:64997543-64997565 ATGTGGGTTTTTAGGGTGATAGG + Intergenic
1071172948 10:82889045-82889067 AATTTGGTTTTGAGTGAAGTGGG + Intronic
1071858975 10:89653490-89653512 GTGTGGGTTTTGTGGTCAGTGGG + Intergenic
1072026174 10:91460230-91460252 ATATGTGTTGTGAGTGAAGTGGG + Intronic
1072650803 10:97293648-97293670 CTGTGGGTTCTCTGGGAAGTTGG - Intergenic
1074103700 10:110373773-110373795 AGGTGGGTCTTGTGGGAAATAGG - Intergenic
1074985830 10:118658783-118658805 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1075333423 10:121591838-121591860 ATGTGGGTATTGTTGGAAGCAGG - Intronic
1075660643 10:124193340-124193362 ATGCAGGTTGTCAGGGAAGTCGG + Intergenic
1075946786 10:126440272-126440294 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1075982776 10:126755659-126755681 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1076270059 10:129144567-129144589 ATGTGAGTTCAAAGGGAAGTAGG - Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077382408 11:2250283-2250305 AGGTGTGTTTTGAAGGAGGTGGG - Intergenic
1077852039 11:6082446-6082468 ATGTGGGGTTGGGGGGAAGGTGG + Intergenic
1078846388 11:15122630-15122652 ATATGGGTTTTGAGGGAGAGAGG - Intronic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1079273727 11:19013650-19013672 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1079947474 11:26762072-26762094 ATGTGGGTATTGAGCGGGGTTGG + Intergenic
1079952174 11:26819275-26819297 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1080007064 11:27420758-27420780 ATGTGTGTCTTGGGGGAAGGTGG + Intronic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1080738500 11:35041162-35041184 ATGTGTGCTTAAAGGGAAGTGGG + Intergenic
1080944619 11:36957620-36957642 AAGTGTGTTGGGAGGGAAGTGGG + Intergenic
1081732742 11:45383157-45383179 ATTTGGGGGTTGAGGGCAGTTGG - Intergenic
1082040043 11:47677303-47677325 ATGTAGATTTAGAAGGAAGTTGG - Exonic
1082778329 11:57265620-57265642 ATGTGGGTTTTTAGGGCATCTGG + Intergenic
1083041053 11:59687901-59687923 ACGTGGGGTTGGAGGGAAGGTGG + Intergenic
1083072834 11:60003921-60003943 ATGCAGGTTGTCAGGGAAGTAGG - Intergenic
1083528552 11:63395962-63395984 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1084704180 11:70806371-70806393 AAGTAGGGTTGGAGGGAAGTTGG - Intronic
1084840532 11:71842904-71842926 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1085414876 11:76313234-76313256 ATGGGGGGTTGGAGGGATGTGGG + Intergenic
1085904947 11:80749149-80749171 ATGTGGGTTTACAGGGAAGATGG + Intergenic
1086091198 11:83006887-83006909 TACTTGGTTTTGAGGGAAGTTGG - Intronic
1086300694 11:85423687-85423709 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1086825442 11:91489950-91489972 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1087468832 11:98545896-98545918 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1087615918 11:100486644-100486666 ATACAGGTTTTCAGGGAAGTGGG - Intergenic
1087619464 11:100525555-100525577 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1087983703 11:104650638-104650660 AGCTGGGGTTTGAGGGAAGCTGG - Intergenic
1088137735 11:106578060-106578082 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1088206395 11:107397398-107397420 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1088718049 11:112566149-112566171 ATCTGGGGTTTGTGGGAACTTGG + Intergenic
1089954248 11:122555821-122555843 ATGCAGGTTGTTAGGGAAGTTGG + Intergenic
1089973822 11:122715644-122715666 ATGTGTGCTTTGAAGGAAGTAGG - Intronic
1090743910 11:129691926-129691948 TAGTGGGTTTTGAGGGAACTGGG - Intergenic
1090757297 11:129803731-129803753 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1091408041 12:221122-221144 ATGTTGGTGATGAGGGAAGCTGG - Intronic
1091993092 12:4972747-4972769 AGGTGAGTTTTAAGGGAAGAAGG + Intergenic
1092901601 12:13064873-13064895 ATCTGGGTTTAGAGTGAAGTGGG + Intronic
1093172545 12:15875929-15875951 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1093720549 12:22437333-22437355 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1093994930 12:25631036-25631058 ATGCAGGTTGTGAGGGAAGTGGG - Intronic
1094718396 12:33035169-33035191 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1094722290 12:33076947-33076969 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1095264545 12:40138600-40138622 ATATGGGTTTAGTAGGAAGTTGG + Intergenic
1095665165 12:44788894-44788916 ATGAAGGTTGTTAGGGAAGTGGG - Intronic
1095932061 12:47637073-47637095 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1096248842 12:50013663-50013685 GTGTGGGACTTGAGGGAAATAGG - Intronic
1096347860 12:50866365-50866387 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1096888618 12:54743748-54743770 ATGCAGGTTGTCAGGGAAGTTGG + Intergenic
1097295471 12:57958116-57958138 ATGCAGGTTGTCAGGGAAGTAGG - Intergenic
1097298148 12:57989414-57989436 ATGTGGGGATTGAGGGAAAGAGG + Intergenic
1097385993 12:58950515-58950537 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1097760525 12:63459411-63459433 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1097992323 12:65848911-65848933 ATTTGGGTTTTCTGGGAACTTGG - Intronic
1098162557 12:67659175-67659197 ATCTGGGTGTTGGGGGTAGTGGG + Exonic
1098602605 12:72350091-72350113 ATGTGTTTGTTGAGGAAAGTTGG - Intronic
1099477180 12:83121910-83121932 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1100706306 12:97203742-97203764 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1101635289 12:106535527-106535549 ATGCAGGTTATCAGGGAAGTGGG + Intronic
1101721241 12:107352470-107352492 ATGTTTGTTTTCAGGGCAGTGGG + Intronic
1102916759 12:116760106-116760128 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1103761127 12:123251094-123251116 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1104388579 12:128372694-128372716 ATGTGGGCTGAGAGAGAAGTTGG + Intronic
1105314431 13:19244200-19244222 ATGCAGGTTGTCAGGGAAGTTGG - Intergenic
1105908235 13:24835057-24835079 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1106134745 13:26965723-26965745 AAGTGGGGTGTGAGGAAAGTTGG - Intergenic
1106938165 13:34747327-34747349 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1107200708 13:37713706-37713728 ATGGGTTTTTTGAGGGAGGTGGG - Intronic
1107731250 13:43351268-43351290 ATGTGTGTTTTGGGGGTAGAAGG - Intronic
1108469803 13:50756474-50756496 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1108817078 13:54305286-54305308 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1108825521 13:54408143-54408165 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109272703 13:60272238-60272260 GTGTGGATTTTGAGGGAAGCTGG - Intergenic
1109601463 13:64635336-64635358 TTGTAGTTTTTGATGGAAGTTGG - Intergenic
1109783684 13:67146797-67146819 AAGTGTGTTTTGACTGAAGTAGG - Intronic
1110561847 13:76917986-76918008 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1111165779 13:84455610-84455632 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1111399076 13:87708572-87708594 ATGTAGGTTTTGAGATACGTTGG + Intergenic
1111748526 13:92298079-92298101 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1112086975 13:96041755-96041777 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1112253870 13:97809694-97809716 ATTTTGGTTTTGAGGGTAGGTGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113240236 13:108328861-108328883 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1113329934 13:109317840-109317862 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1114173422 14:20297184-20297206 ATCTGTGTTTTAAGGGAACTTGG - Intronic
1114618898 14:24082939-24082961 ACTTGGGCTTTGAGGGAAGAGGG - Intronic
1115265145 14:31493005-31493027 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1115299226 14:31865528-31865550 ATGTAGGTTGTCAGGGAGGTAGG - Intergenic
1115775121 14:36706691-36706713 ATGTGCGTGTTGAGAAAAGTAGG - Intronic
1115871878 14:37813792-37813814 ATGTGGGGTGTGAGGAAAGAGGG - Intronic
1115969794 14:38932511-38932533 ATGCAGGTTATCAGGGAAGTAGG - Intergenic
1115996900 14:39204089-39204111 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1116593539 14:46810778-46810800 ATGAGGCTTTTGAGAGAAGCAGG + Intergenic
1117835672 14:59803396-59803418 ACTTGGCTTTTGAGGGAAGTAGG - Intronic
1118165581 14:63332520-63332542 ATGCAGGTTGTCAGGGAAGTTGG - Intergenic
1119472235 14:74907307-74907329 ATGTGGGTGCAGAGGGCAGTAGG - Intronic
1119530027 14:75353472-75353494 GTGGGGGATTTGAGGGCAGTGGG + Intergenic
1119598034 14:75954648-75954670 TTCTGGGTTTTGATGGAACTTGG + Exonic
1120104941 14:80483134-80483156 ATGTGGGTTTTTAGGGAAGGTGG - Intronic
1121104070 14:91269512-91269534 ATGTGGGATGTGAGGAAAGGAGG + Intergenic
1121388379 14:93551713-93551735 GTGTGGGTTTTGAGATCAGTGGG + Intronic
1122281208 14:100623504-100623526 ATGTGGGGGATCAGGGAAGTAGG - Intergenic
1123104242 14:105830651-105830673 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1124161860 15:27277906-27277928 ATGTGGTCCCTGAGGGAAGTGGG - Intronic
1126369955 15:47934965-47934987 ATATGAGTGTTGAGAGAAGTTGG + Intergenic
1126415303 15:48412154-48412176 ATGTGGAGTGTGAGGGAACTTGG - Intronic
1126572702 15:50168913-50168935 ATGCAGGTTGTCAGGGAAGTCGG - Intronic
1126577483 15:50210868-50210890 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1127008234 15:54594585-54594607 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1127194450 15:56568776-56568798 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1127469212 15:59275620-59275642 GGGTGGGTTTTTAGGGGAGTGGG - Intronic
1127525265 15:59786586-59786608 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1128350208 15:66883441-66883463 ATGTGGGTTGTGGGGGAGATGGG - Intergenic
1128415001 15:67436784-67436806 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1128892239 15:71341774-71341796 AAGAGGGTTGTGAGGGAGGTAGG - Intronic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1129161860 15:73752075-73752097 GTGGGGGTTCTGAGGGAAGGCGG - Intronic
1129415188 15:75372841-75372863 ATGTGGGTTTTGGGGGTTTTGGG - Intronic
1129937509 15:79463163-79463185 ATGTGGGCCTTGAGGGAGGCAGG - Exonic
1130206501 15:81880409-81880431 ATCTGGGCTTTGATGGACGTAGG + Intergenic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131326862 15:91456275-91456297 ATGTAGGTTGTCAGGGAGGTCGG + Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131700338 15:94928619-94928641 ATGTGTGTTGGGAGGGGAGTTGG + Intergenic
1131874146 15:96787006-96787028 ATGTGGGTTTTGTGATCAGTGGG - Intergenic
1132210308 15:100017124-100017146 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1133657390 16:7879039-7879061 TGGTAGGCTTTGAGGGAAGTGGG + Intergenic
1137431638 16:48422843-48422865 ATGTGGGCTTTGAGGGGGGCGGG + Intronic
1138173110 16:54871515-54871537 ATGTGGATTTAGTGGGAGGTGGG - Intergenic
1138962839 16:62047949-62047971 ATGTGTATTTTAAGGGAAATAGG + Intergenic
1139765063 16:69221246-69221268 ATTTAGGTTTAGAAGGAAGTGGG - Intronic
1140116950 16:72050394-72050416 CTGTGGGTCCTCAGGGAAGTGGG - Intronic
1140219559 16:73033706-73033728 ATTTGGGTTTGGAGGGAGGGAGG - Intronic
1140619796 16:76716455-76716477 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1143587130 17:7855882-7855904 AAGTGGGTTTTCCGGGATGTGGG - Exonic
1143663888 17:8345124-8345146 ATGAGGGTTTTGTGGGTGGTGGG + Intronic
1143718859 17:8796454-8796476 ATGTGTGTTGGGGGGGAAGTGGG - Intergenic
1145112792 17:20178932-20178954 AGGTCTGTTTTGAGGGAAATTGG + Intronic
1146489692 17:33271470-33271492 ATATGGGTGTTGAGAGAGGTGGG - Intronic
1146913569 17:36663824-36663846 ATGTGGGGTTTGTGGGTAGGTGG + Intergenic
1147463209 17:40589199-40589221 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1148205812 17:45779125-45779147 AGCTGGGTATTGAAGGAAGTGGG - Intergenic
1148374422 17:47129582-47129604 ATGTTGGTTTTGAGTCACGTTGG - Intronic
1149272406 17:54994658-54994680 ATGTAGGTTGGGAGGGAAATAGG - Intronic
1150848594 17:68683671-68683693 AGGGGGGATTTGAAGGAAGTGGG + Intergenic
1151558125 17:74857168-74857190 CTGGGGAGTTTGAGGGAAGTAGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1153009568 18:525760-525782 TTGTGGGGTTTGTGGGAAGTAGG + Intergenic
1153079919 18:1210510-1210532 ATGCAGGTTGTCAGGGAAGTAGG + Intergenic
1155109348 18:22698653-22698675 ATGTGGATTTTGAAGAAAATTGG - Intergenic
1155581548 18:27313862-27313884 ATGTGGGTTGGAAGAGAAGTGGG + Intergenic
1155821171 18:30379686-30379708 ATGTCTTTTTTGGGGGAAGTTGG - Intergenic
1156667479 18:39425469-39425491 ATGCAGGTTGTCAGGGAAGTTGG - Intergenic
1156853734 18:41757557-41757579 ATGGGGGTGTTGAAGGAAATAGG - Intergenic
1156944645 18:42814451-42814473 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1157082021 18:44535704-44535726 AGGTGGGTTTTGAGGGAAAGAGG + Intergenic
1157196246 18:45622514-45622536 ATGTGAGTTTTGAGGGTCATCGG + Intronic
1157492054 18:48130343-48130365 CTGGGGGCTTTAAGGGAAGTGGG + Intronic
1157873369 18:51250089-51250111 ATGTGAATTTTGAGGGGAGAGGG + Intergenic
1158002601 18:52636567-52636589 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1158104130 18:53865339-53865361 ATGTGGACTGTGAGGGAACTGGG + Intergenic
1158829741 18:61264047-61264069 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1158888401 18:61850379-61850401 ATGTGGTTTTTAAGTGAAATAGG + Intronic
1158888620 18:61852519-61852541 TTTTGAGTTTTGAGAGAAGTGGG - Intronic
1159454052 18:68638666-68638688 ATGTAGGTTGTCGGGGAAGTGGG + Intergenic
1159787070 18:72727092-72727114 ATGCAGGTTGTCAGGGAAGTAGG - Intergenic
1161168607 19:2801997-2802019 ATGTGGGTATTGGGAGATGTGGG - Intronic
1161560829 19:4971633-4971655 CTGTGGGTTTAGAGTGTAGTGGG + Intronic
1163374935 19:16924249-16924271 AAGTGGGTTTGGGGGGAAGATGG + Intronic
1163480551 19:17553583-17553605 AGGTGGGGTTGGAGGGAAATAGG - Exonic
1164267436 19:23632863-23632885 ATGTATGTTGTTAGGGAAGTTGG - Intronic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1166598118 19:44069381-44069403 AGGTTGGTGGTGAGGGAAGTGGG - Intergenic
1166787358 19:45376394-45376416 AAGTGGGGTTTGCGGGTAGTGGG + Intergenic
1166813229 19:45526572-45526594 ATTTGGGTTTTGGGGGAAAAGGG + Exonic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167669825 19:50844311-50844333 ATGTGGGTCACCAGGGAAGTGGG + Intergenic
925343290 2:3151390-3151412 ATGGAGGTTGTCAGGGAAGTAGG - Intergenic
927964483 2:27260712-27260734 AACTGAGTTTTGAGGGAGGTAGG + Intronic
928733725 2:34261622-34261644 ATGCAGGTTATCAGGGAAGTTGG - Intergenic
928772553 2:34719729-34719751 ATGCAGGTTGTCAGGGAAGTAGG + Intergenic
929212859 2:39377469-39377491 ATGTGGGTTTTGAGGGAAGTAGG + Intronic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
930725622 2:54678550-54678572 ATGTAGGATTTGAGGCATGTGGG - Intergenic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
931547854 2:63408781-63408803 ATGCAGGTTGTCAGGGAAGTCGG - Intronic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
932270357 2:70403680-70403702 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
932384915 2:71323434-71323456 ATGCAGGTTGTCAGGGAAGTCGG + Intronic
932954657 2:76337402-76337424 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
933247117 2:79987971-79987993 CTGTGTGGTTTAAGGGAAGTTGG + Intronic
935069486 2:99681475-99681497 ATGTGAATTTTGAGGGAACACGG - Intronic
936164439 2:110107424-110107446 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
937057839 2:118954301-118954323 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
937069275 2:119050404-119050426 ATGCAGGTTGTGAGGGAAGTGGG + Intergenic
937521769 2:122720865-122720887 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
937529257 2:122808750-122808772 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
937663011 2:124452275-124452297 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
937723064 2:125126306-125126328 ATGCAGGTTGTTAGGGAAGTGGG + Intergenic
937767638 2:125680250-125680272 ATGTAGGTTGTTAGGGAAGTGGG + Intergenic
937822007 2:126320771-126320793 CTGTGGTTTTTGAGGCAAGTAGG + Intergenic
937828956 2:126399460-126399482 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938038098 2:128053282-128053304 ATGCAGGTTGTCAGGGAAGTTGG + Intergenic
938598273 2:132811507-132811529 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
940217512 2:151315736-151315758 ATGCCGGTTGTCAGGGAAGTGGG - Intergenic
940360379 2:152790484-152790506 ATGTGTTTTTTGAGTGAACTTGG + Intergenic
940618699 2:156083889-156083911 ATGCAGGTTGTAAGGGAAGTGGG + Intergenic
940784998 2:157971752-157971774 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
941627418 2:167844976-167844998 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
941894003 2:170611489-170611511 ATGCGGGTGTTGAGGACAGTGGG + Intronic
942167477 2:173255904-173255926 ATGTGGGTCCTGAGGTAAGTGGG - Intronic
942425977 2:175861284-175861306 TTGTGGGGGTTGAGGGGAGTTGG + Intergenic
942660184 2:178255708-178255730 ATCTGGGTTTGGAGGAATGTTGG + Intronic
944528895 2:200648846-200648868 ATGCAGGTTGTTAGGGAAGTAGG + Intronic
944874068 2:203943900-203943922 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
944991466 2:205241901-205241923 ATGTGAGTTATAAAGGAAGTTGG + Intronic
946036439 2:216746180-216746202 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
946130933 2:217606419-217606441 ATGTGGCTTTAGATGGCAGTAGG - Intronic
946320941 2:218954142-218954164 ATGTGGGTTCTGAGGTCATTCGG - Intergenic
946731586 2:222714964-222714986 ATGTGGGTTTGCAGTGATGTGGG + Intergenic
947590127 2:231380686-231380708 AGGTGGGTTTTGAAGGAAGATGG - Intergenic
947983023 2:234426074-234426096 AAGTGGGTTTTGTGGGTAGGTGG - Intergenic
948363372 2:237438126-237438148 ATGTGCTTTTTGAGAAAAGTTGG - Intergenic
948713962 2:239847017-239847039 ATGTGGGTTTTCAGGGAAGTGGG - Intergenic
1168819349 20:762668-762690 ATGGAGGATTTGAGGGAAGCAGG - Intronic
1169838599 20:9908636-9908658 ATGGGGGTCCTGGGGGAAGTGGG - Intergenic
1170245783 20:14220288-14220310 ATGCAGGTTGTCAGGGAAGTTGG + Intronic
1170721037 20:18879391-18879413 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1170863175 20:20127948-20127970 ATGCAGGTTGTCAGGGAAGTTGG + Intronic
1171066950 20:22026722-22026744 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1171242381 20:23582129-23582151 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1172035664 20:32009207-32009229 ATGTGCATTTTCAGGGAGGTGGG - Intergenic
1175085779 20:56457430-56457452 ATGTAGGATTTGGGAGAAGTTGG + Intronic
1175328753 20:58148236-58148258 ATGTGGCTTTGGGTGGAAGTGGG - Intergenic
1175508665 20:59506136-59506158 GTGTGGGTTTTGGGGGAACTTGG + Intergenic
1176292721 21:5054798-5054820 AGGTGGGCTTTCAGGCAAGTGGG + Intergenic
1177174456 21:17689290-17689312 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1177195602 21:17900949-17900971 ATGCAGGTTGTCAGGGAAGTCGG + Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1177847396 21:26306361-26306383 ATGCAGGTTGTCAGGGAAGTAGG - Intergenic
1177995373 21:28090051-28090073 ATGCAGGTTGTCAGGGAAGTCGG + Intergenic
1178390001 21:32190447-32190469 ATATGCATTTTGAGGGAACTGGG - Intergenic
1178801662 21:35801301-35801323 ATGCAGGTTGTCAGGGAAGTCGG - Intronic
1178867352 21:36340407-36340429 AGTGGGGTTATGAGGGAAGTGGG - Intronic
1178959014 21:37047247-37047269 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1179295472 21:40058233-40058255 ATGTGGGTTTTGGGGGTAGCAGG - Intronic
1179864539 21:44208852-44208874 AGGTGGGCTTTCAGGCAAGTGGG - Intergenic
1183658003 22:39201514-39201536 AGCTGGGCTTGGAGGGAAGTGGG + Intergenic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184250095 22:43255112-43255134 ATGTGGGTGTTCACGCAAGTCGG + Intronic
1184541536 22:45128834-45128856 CTGTGGATTTTGAGTAAAGTGGG - Intergenic
1184549383 22:45196421-45196443 ATTTGGATTCTGAGGGTAGTCGG - Exonic
1185153696 22:49180585-49180607 AGGTGGGTTGAGACGGAAGTGGG - Intergenic
949814240 3:8041025-8041047 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
950260270 3:11538173-11538195 ATGGGGGTTTTGTGGGGACTGGG + Intronic
950592408 3:13947896-13947918 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
950603567 3:14057879-14057901 ATGTAGGTTGTCAGGGAAGTTGG + Intronic
950901155 3:16499002-16499024 ATGTTGCTTTTGAGGGCAGTGGG + Intronic
951657304 3:25023870-25023892 ATGTGGGTGTTTGGGGAGGTGGG + Intergenic
952123637 3:30274797-30274819 ATGTTGGTTTTGGTGGAATTTGG - Intergenic
952598471 3:35048512-35048534 ACTGGGGTTTTGAGGGAAGCTGG - Intergenic
953683355 3:45056910-45056932 ATAAGGAGTTTGAGGGAAGTAGG - Intergenic
953723968 3:45381650-45381672 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
954466501 3:50658266-50658288 AGGTGGGTTTGGAAGGAAGATGG + Intergenic
954887305 3:53887037-53887059 ATGTGGGTTAGGAGCTAAGTGGG - Intronic
955175651 3:56611327-56611349 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
955250862 3:57280795-57280817 ATGTGTGTTATGAGTTAAGTGGG - Intronic
955352701 3:58205842-58205864 ATGCGGGTTTTGGGGTGAGTTGG - Intronic
956693218 3:71896814-71896836 ATGTGGGTTTAGGGAGAAGGTGG - Intergenic
958013783 3:87914577-87914599 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
958490507 3:94766406-94766428 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
958647124 3:96887849-96887871 ATGCAGGTTATCAGGGAAGTGGG + Intronic
958770653 3:98421857-98421879 ATGCTGGTTGTCAGGGAAGTGGG - Intergenic
958969959 3:100600727-100600749 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
959997251 3:112693359-112693381 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
960280278 3:115773747-115773769 ATGAGGGTTCTAGGGGAAGTGGG + Intergenic
960451030 3:117808401-117808423 ATGTTGTTTTTAAGAGAAGTGGG - Intergenic
960512865 3:118571727-118571749 ATGCAGGTTATCAGGGAAGTGGG + Intergenic
960827730 3:121810111-121810133 ATGTGCATTTTAAGGAAAGTAGG - Intronic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
961870190 3:129981925-129981947 ATGTGGGTAATAAGGGAAGGAGG - Intergenic
962401866 3:135067451-135067473 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
964537401 3:157738880-157738902 ATGTCTTTTATGAGGGAAGTTGG - Intergenic
964643808 3:158936866-158936888 ATCCAGGTTTTCAGGGAAGTGGG - Intergenic
964917498 3:161854579-161854601 ATGCAGGTTGTTAGGGAAGTGGG + Intergenic
965125682 3:164626585-164626607 ATGAAGGTTTTCAGGGAAGAAGG - Intergenic
965321912 3:167261588-167261610 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
965874398 3:173299545-173299567 ATGCAGGTTGTCAGGGAAGTAGG + Intergenic
966020432 3:175202876-175202898 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
966122396 3:176536965-176536987 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
967480686 3:189969608-189969630 ATCTGGGCTTTGAAGGAAGAGGG - Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969781620 4:9408898-9408920 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
969838758 4:9865040-9865062 ATGTGTGATTTGGGGCAAGTTGG - Intronic
970549331 4:17163677-17163699 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
970996075 4:22268853-22268875 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
971056904 4:22923289-22923311 ATGTGGGTTTTGTGTGGGGTTGG - Intergenic
971183142 4:24349559-24349581 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
971657622 4:29369856-29369878 TTAAGGGTTTTGAGGGGAGTTGG - Intergenic
971737819 4:30479742-30479764 ATGTGGGCTTTGAAGTCAGTTGG - Intergenic
972699798 4:41483061-41483083 ATGAGGGTTTTTAGGGAAAGAGG + Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973801920 4:54486942-54486964 ATATGAATTTGGAGGGAAGTGGG - Intergenic
973835139 4:54802124-54802146 AGGTGGGGTTTGAGTGAAATTGG - Intergenic
974474462 4:62361654-62361676 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
974726183 4:65801526-65801548 ATGTGTGTTTTGAGAGAAATTGG - Intergenic
975033796 4:69657109-69657131 ATGTAGGTTGTCAGGTAAGTAGG - Intergenic
975517242 4:75260222-75260244 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
975534567 4:75435771-75435793 ATATGGGTCATCAGGGAAGTGGG - Intergenic
975680184 4:76868261-76868283 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976515461 4:85959296-85959318 ATGTTGGTTTTGAGGGGGTTTGG + Intronic
976686356 4:87819517-87819539 ATGCAGGTTGTCAGGGAAGTCGG + Intergenic
976856465 4:89610157-89610179 ATGCAGGTTGTCAGGGAAGTTGG - Intergenic
976963132 4:91003481-91003503 ATGAAGGTTGTCAGGGAAGTGGG + Intronic
977020009 4:91746965-91746987 ATGTAGGTTGTCAGGGAAGTGGG + Intergenic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
977733205 4:100379871-100379893 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
977746766 4:100558618-100558640 ATGCAGGTTTTCAGAGAAGTTGG - Intronic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978685077 4:111431190-111431212 ATGTGGGGGCTGAGGGAAGAGGG + Intergenic
978726711 4:111977717-111977739 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
979704832 4:123709238-123709260 ATGCAGGTTGTCAGGGAAGTTGG - Intergenic
979787014 4:124728697-124728719 ATATAGGTTTTAAGGGCAGTAGG - Intergenic
979995458 4:127426102-127426124 ATGCTGGTTGTCAGGGAAGTGGG - Intergenic
980087201 4:128403662-128403684 ATGTAGGTTGTCAGGAAAGTGGG + Intergenic
980523513 4:133960796-133960818 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
981559707 4:146033465-146033487 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
981713934 4:147733985-147734007 ATGTGTGTTGGGTGGGAAGTAGG + Intronic
981760807 4:148192738-148192760 ATGCAGGTTTTCAAGGAAGTGGG + Intronic
981856730 4:149303213-149303235 AGGTGCTTTTTGAGGGCAGTAGG + Intergenic
981857971 4:149317744-149317766 ATGTGCATTTTGAGGGATGGAGG - Intergenic
981913578 4:150009936-150009958 ATGTATGTCTTGAGGGATGTTGG - Intergenic
982074985 4:151730157-151730179 ATGCGGGTTGTCAGGGAAGAAGG - Intronic
983325722 4:166253481-166253503 ATGATGGTGTAGAGGGAAGTAGG - Intergenic
983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG + Intergenic
984266719 4:177505493-177505515 ATGCAGGTTATCAGGGAAGTGGG + Intergenic
984323553 4:178224299-178224321 ATGCAGGTTGTCAGGGAAGTAGG - Intergenic
985082076 4:186276548-186276570 ATGTTGGGTTTGTGGTAAGTAGG - Intronic
985092878 4:186381853-186381875 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
985217777 4:187671994-187672016 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
985672417 5:1213424-1213446 ATGTGGGATGGGCGGGAAGTTGG - Intronic
985930406 5:3052488-3052510 AGATGTGTTATGAGGGAAGTCGG - Intergenic
986137231 5:4992095-4992117 ATGTGGGTCTTGAAAGAAGAGGG - Intergenic
989069846 5:37498722-37498744 ATGTGGGGTGTGAGGGAAAAGGG - Intronic
989566218 5:42904017-42904039 ATGTGGGTTTTGATGGCGATTGG - Intergenic
989567049 5:42911057-42911079 ATGTGGGTTTTGATGGCCATTGG + Intergenic
990196133 5:53318528-53318550 ATGAGAGTTTTTAGGGAAGAAGG + Intergenic
990776240 5:59309003-59309025 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
991260415 5:64661872-64661894 TTGATGGTTTTGGGGGAAGTGGG - Intergenic
991272707 5:64803877-64803899 ATGTGGCTTTTGAAGGCAGTTGG - Intronic
991769365 5:70026110-70026132 TTCTGGCTTTTGAGGGGAGTGGG - Intronic
991848660 5:70901528-70901550 TTCTGGCTTTTGAGGGGAGTGGG - Intronic
992340101 5:75814618-75814640 ATGCAGGTTGTCAGGGAAGTAGG + Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992998382 5:82355082-82355104 GTGTGGGGTTGGGGGGAAGTTGG + Intronic
993018607 5:82564200-82564222 ATGAGGGCTTTCAGGGAAGAGGG - Intergenic
993917035 5:93756108-93756130 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
993964753 5:94347042-94347064 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
993983304 5:94568576-94568598 CTGTGAGTTTTAAGTGAAGTGGG - Intronic
994568390 5:101483021-101483043 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
994875290 5:105413881-105413903 ATGCAGGTTTTCAGGGAAGTAGG - Intergenic
995045622 5:107643338-107643360 TTGTGGGTTGTGAGTCAAGTGGG + Intronic
995817790 5:116191524-116191546 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
996010737 5:118479076-118479098 ATGCAGGTTTTCAGGGAAGCAGG - Intergenic
996128506 5:119753253-119753275 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
996288957 5:121829110-121829132 ATGCAGATTTTCAGGGAAGTGGG + Intergenic
996513201 5:124340786-124340808 ATGTGGGTTTGGAGGTAATCAGG - Intergenic
997105993 5:131019832-131019854 ATGCGGGTTGTCAGGGAAGTGGG + Intergenic
998036394 5:138920529-138920551 ATCTGGCTTTTGAGGTAGGTGGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999677083 5:154015029-154015051 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
999818492 5:155200909-155200931 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1000511633 5:162190273-162190295 ATTTAGGTTGTCAGGGAAGTGGG + Intergenic
1000779631 5:165464913-165464935 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1002813830 6:660086-660108 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1003112589 6:3261978-3262000 ATGTGGGAGTTTAGGGAAGCTGG - Intronic
1003450864 6:6230325-6230347 ATGCAGGTTGTCAGGGAAGTTGG - Intronic
1003629172 6:7771420-7771442 ATGAGGGTTTTGTGTGAAGGAGG - Intronic
1003867138 6:10373455-10373477 TTGGGGGGTTTCAGGGAAGTGGG + Intergenic
1004110819 6:12716965-12716987 ATGGGGGTTGTGGGGGGAGTGGG + Intronic
1004558652 6:16725974-16725996 ATGTGGGTATTGTGGGGAGGAGG - Intronic
1005760254 6:28961160-28961182 ATGTAGGTTGTCAGGGAAGTGGG - Intergenic
1006394735 6:33779948-33779970 ATGTGGGTTAGGATGGAAGTGGG - Intronic
1006739574 6:36297714-36297736 ATGTGGGTGCTGAGTGAGGTTGG + Intronic
1008121475 6:47622102-47622124 ATGCTGGTTGTCAGGGAAGTAGG + Intronic
1009453157 6:63825135-63825157 ATGAAGGTTGTCAGGGAAGTAGG - Intronic
1009666452 6:66687499-66687521 ATGTGTGATTTGAGGAGAGTGGG - Intergenic
1010054573 6:71550643-71550665 ATATGTGTTTGGGGGGAAGTGGG - Intergenic
1010076385 6:71803468-71803490 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1010707775 6:79135128-79135150 ATGTAGGTTGTCAGGGAAATGGG + Intergenic
1011093535 6:83633635-83633657 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1011283817 6:85703735-85703757 AGGTGGGTTCTGAGGGAGATGGG + Intergenic
1011789748 6:90885538-90885560 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1011833720 6:91404426-91404448 ATGCAGGTTGTGAGGAAAGTCGG - Intergenic
1011893326 6:92194168-92194190 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1012713218 6:102634901-102634923 ATGTGGGTTTTGGGGGGCTTTGG + Intergenic
1013136585 6:107288553-107288575 ATTTAGATTTGGAGGGAAGTAGG + Intronic
1013289080 6:108705506-108705528 GTGTGGGATGTGAGGGAAGAGGG - Intergenic
1013852653 6:114534699-114534721 ATGCAGGTTGTCAGGGAAGTAGG + Intergenic
1014336810 6:120147390-120147412 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1014531407 6:122563720-122563742 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1016290037 6:142518684-142518706 ATGTAGGTCGTCAGGGAAGTGGG + Intergenic
1017013291 6:150079655-150079677 ATGTGGCTTCTGAGGGTGGTAGG - Intergenic
1017190504 6:151648451-151648473 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1019437300 7:1028672-1028694 ATGGGGGAGATGAGGGAAGTAGG - Intronic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1020915227 7:14184510-14184532 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1021486632 7:21175331-21175353 GTGTGGGTCTTGAGAGAGGTGGG - Intergenic
1021689796 7:23221010-23221032 ATGGGGATTTTGAGAGAAGATGG - Intergenic
1021842153 7:24729527-24729549 ATGTGGCTCCTGAAGGAAGTGGG + Intronic
1022777725 7:33544952-33544974 ATGCAGGTTGTCAGGGAAGTGGG + Intronic
1023159086 7:37279873-37279895 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1023701255 7:42893528-42893550 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1024313901 7:47995349-47995371 ATGAGGGTTTTGATGGAGATGGG + Intronic
1025772777 7:64528557-64528579 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1027295360 7:76764127-76764149 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1027417660 7:77990310-77990332 ATGCGGGTTGTCAGGGAAGTGGG + Intergenic
1027707442 7:81551956-81551978 ATGTGGGTTTTGGGGGCCCTAGG + Intergenic
1028087272 7:86651829-86651851 TTTTGGGTGTTGGGGGAAGTGGG - Intronic
1028962253 7:96761912-96761934 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1030681515 7:112439293-112439315 ATGGGACTTTTAAGGGAAGTAGG + Intronic
1031761265 7:125716071-125716093 ATGTGGGTTGTCAGGGAAGTGGG + Intergenic
1031827952 7:126589358-126589380 ATGTAGGTTGCCAGGGAAGTGGG - Intronic
1032155246 7:129462600-129462622 GTGTGGGTTTAAAAGGAAGTTGG - Intronic
1033264459 7:139872877-139872899 ATATGGGGTTTGGGGGAAATGGG - Intronic
1034058912 7:148067906-148067928 ATATAGGTTTCCAGGGAAGTGGG + Intronic
1034428084 7:151025121-151025143 GTGTGTGTGTGGAGGGAAGTGGG - Intergenic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1035268952 7:157708630-157708652 ATGTGTGGTTTTACGGAAGTTGG - Intronic
1035415927 7:158685988-158686010 ATGTGTGGTTTGTGGGAGGTAGG - Intronic
1036837800 8:12089832-12089854 ATGCAGGTTGTCAGGGAAGTTGG + Intergenic
1036859592 8:12336080-12336102 ATGCAGGTTGTCAGGGAAGTTGG + Intergenic
1038367226 8:26948505-26948527 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1039083308 8:33755431-33755453 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1039095565 8:33880983-33881005 ATGCAGGTTCTCAGGGAAGTCGG + Intergenic
1039123559 8:34175569-34175591 ATGCTGGTTGTCAGGGAAGTAGG - Intergenic
1040017090 8:42708525-42708547 GTGTGTGTTTGGAGGGAGGTGGG + Intronic
1041293769 8:56333533-56333555 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1041364159 8:57083524-57083546 ATGCGGGTTGTCAGGGAAGTGGG - Intergenic
1041570566 8:59333180-59333202 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1041878002 8:62712495-62712517 ATGCAGGTTATCAGGGAAGTGGG + Intronic
1042088583 8:65133847-65133869 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1042467146 8:69140915-69140937 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1042477555 8:69266232-69266254 ATGGGGGTTATGAGGTAAGTTGG + Intergenic
1043048040 8:75352325-75352347 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044907236 8:97017641-97017663 ATGCAGGTTGTCAGGGAAGTAGG - Intronic
1045779808 8:105849709-105849731 ATGTAGGTTGTCAGGAAAGTGGG - Intergenic
1046394605 8:113625516-113625538 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1046546805 8:115663054-115663076 TTTTGGGTTTTGGGGAAAGTGGG - Intronic
1047032343 8:120896308-120896330 ATGCAGGTTGTGAGGGAAGTGGG - Intergenic
1047085738 8:121513430-121513452 ATGTGGGTCTTTAAAGAAGTTGG - Intergenic
1047130778 8:122017526-122017548 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1047141119 8:122140994-122141016 ATCTGGGATGAGAGGGAAGTTGG + Intergenic
1047399975 8:124538290-124538312 ATGTAGGTTTTGTGGGAAATAGG - Intronic
1048377257 8:133833654-133833676 GTGTGGGTATGGAGGGAATTGGG - Intergenic
1048822633 8:138393958-138393980 AAGTGGGGTTTGGGGGCAGTTGG + Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049702854 8:144022982-144023004 AAGAGGGTTTTCAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703339 8:144024731-144024753 AGGAGGGTTTTCAGGGAAGAGGG - Intronic
1050203700 9:3175982-3176004 TGGTGGGTTTTGAGTGAAGCAGG - Intergenic
1050307997 9:4325483-4325505 GGGATGGTTTTGAGGGAAGTGGG - Intronic
1051181130 9:14412989-14413011 AGGTGTGATTTGAGGGAAGGAGG - Intergenic
1051788498 9:20772739-20772761 ATGTAGATTTTGATGGAAGTTGG + Intronic
1051878728 9:21818087-21818109 ATCTGGGCTTTGAAGGAAGAGGG + Exonic
1052825227 9:33169259-33169281 ATGTGGGTGGGGAGGGAAATAGG - Intergenic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053307434 9:36994476-36994498 ATGTGTGTGGTCAGGGAAGTGGG - Intronic
1055092942 9:72381097-72381119 GTGTTTGTTTTGAGGGAAGGTGG + Intergenic
1055347004 9:75350127-75350149 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1056487158 9:87071036-87071058 ATGTGGCTTGTGAGCAAAGTAGG + Intergenic
1056924855 9:90825769-90825791 ATGTGGTTTTGGAGACAAGTAGG + Intronic
1057119515 9:92558890-92558912 ATGCAGGTTGTCAGGGAAGTTGG + Intronic
1058085053 9:100739827-100739849 ATGCAGGTTGTTAGGGAAGTAGG + Intergenic
1058417733 9:104805759-104805781 ATGTGAGTTTTGAGGGGAGAAGG - Intronic
1058935229 9:109763769-109763791 ATGTGGGGTGGGAGGGAAGTAGG + Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059587662 9:115623220-115623242 ATATGGGTTTGGTGGGGAGTGGG - Intergenic
1062030223 9:134358837-134358859 ATGTGGGTGGTGAGGGCTGTGGG + Intronic
1185509484 X:652444-652466 ATGTGAGCTGGGAGGGAAGTGGG + Intronic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186277570 X:7956659-7956681 ATGTGGAATTTGATGGAGGTGGG - Intergenic
1186445524 X:9624603-9624625 ATTTGGGTTTTGCAGGAAATGGG + Intronic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1188045919 X:25426202-25426224 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1188738022 X:33742197-33742219 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1189668316 X:43381068-43381090 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1189879202 X:45471470-45471492 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1189891157 X:45603873-45603895 ATGTGTATGTTGAGGGAGGTTGG + Intergenic
1189946097 X:46180394-46180416 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1189962147 X:46333838-46333860 ATGAAGGTTTTCAGGGAAGTGGG - Intergenic
1190448911 X:50557988-50558010 ATGAAGGTTGTCAGGGAAGTGGG - Intergenic
1190589289 X:51982136-51982158 ATTTGTGTTTTGTAGGAAGTTGG + Intergenic
1191045330 X:56129903-56129925 ATGCAGGTTGTTAGGGAAGTAGG - Intergenic
1191080346 X:56504216-56504238 ATGCAGGTTTTCAGGGAAGTGGG - Intergenic
1191684047 X:63870701-63870723 ATAAGGGTTTAGAGAGAAGTTGG + Intergenic
1191692313 X:63952906-63952928 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1191779889 X:64854047-64854069 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1191965271 X:66750915-66750937 ATGTGAGTTGTCAGGGAAGTGGG + Intergenic
1192014601 X:67315882-67315904 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1192276837 X:69640675-69640697 ATGAGGGTTTAGGGTGAAGTGGG + Intronic
1192491380 X:71579399-71579421 ATGGGGGCGTTGAGGGAAGTGGG + Intronic
1192914540 X:75638339-75638361 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1192950861 X:76014721-76014743 ATGCAGGTTGTCAGGGAAGTCGG - Intergenic
1192979062 X:76319208-76319230 ATGGAGGTTGTCAGGGAAGTGGG + Intergenic
1193007945 X:76642305-76642327 ATGTGGATCATCAGGGAAGTTGG + Intergenic
1193154578 X:78158796-78158818 ATGTAGGTTGTCAGGGAAGTGGG - Intergenic
1193253417 X:79319566-79319588 ATGCTGGTTGTCAGGGAAGTGGG + Intergenic
1193389937 X:80914202-80914224 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1193404240 X:81082545-81082567 ATGCAAGTTTTCAGGGAAGTGGG - Intergenic
1193578497 X:83232726-83232748 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1193786024 X:85760590-85760612 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1193937602 X:87641774-87641796 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1194134904 X:90129632-90129654 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1194165348 X:90508054-90508076 ATGCAGGTTTTCAGGGAAGCTGG - Intergenic
1194185645 X:90771596-90771618 ATTTGACTTTTGAAGGAAGTAGG - Intergenic
1194826918 X:98575964-98575986 ATGTGGACTTGGAGGGAAGGGGG + Intergenic
1194926934 X:99836610-99836632 ATGTAGGCTGTCAGGGAAGTGGG + Intergenic
1195019492 X:100812518-100812540 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1195152054 X:102082131-102082153 ATGTGGGTTGTGTGGGAATAAGG - Intergenic
1196574011 X:117297489-117297511 GTGGGGGTGTTGTGGGAAGTTGG - Intergenic
1196796802 X:119508373-119508395 AGGTGTGTTTTGTGGCAAGTGGG + Intergenic
1196948287 X:120850349-120850371 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197363557 X:125536382-125536404 ATGCAGGTTGTCAGGGAAGTGGG - Intergenic
1197476321 X:126929700-126929722 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1197518896 X:127473057-127473079 ATGCAGGTTATCAGGGAAGTGGG - Intergenic
1198526786 X:137509369-137509391 ATGCAGGTTGTCAGGGAAGTCGG + Intergenic
1198811689 X:140542243-140542265 AGTGGGGTTTTGGGGGAAGTAGG + Intergenic
1198885736 X:141334109-141334131 ATGTGGCTTCAGATGGAAGTGGG + Intergenic
1199057875 X:143319174-143319196 ATGCAGGTTGTCAGGGAAGTGGG + Intergenic
1199892287 X:152097825-152097847 ATAGGGGTTTGGGGGGAAGTAGG + Intergenic
1199913704 X:152315731-152315753 ATGCAGGTTGTCAGGGAAGTGGG - Intronic
1200480690 Y:3699723-3699745 AAGTTGGTACTGAGGGAAGTGGG + Intergenic
1200511617 Y:4085864-4085886 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
1200532263 Y:4353675-4353697 ATTTGACTTTTGAAGGAAGTAGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic