ID: 929216445

View in Genome Browser
Species Human (GRCh38)
Location 2:39418615-39418637
Sequence GTGATCAAAGTTAACACTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 1, 2: 5, 3: 13, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929216441_929216445 20 Left 929216441 2:39418572-39418594 CCTGGTTAACTAAAAAGCCAGGT 0: 1
1: 0
2: 1
3: 9
4: 790
Right 929216445 2:39418615-39418637 GTGATCAAAGTTAACACTGCCGG 0: 1
1: 1
2: 5
3: 13
4: 149
929216442_929216445 3 Left 929216442 2:39418589-39418611 CCAGGTGATCAAAGTTAACATTG 0: 2
1: 2
2: 39
3: 187
4: 628
Right 929216445 2:39418615-39418637 GTGATCAAAGTTAACACTGCCGG 0: 1
1: 1
2: 5
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929216445 Original CRISPR GTGATCAAAGTTAACACTGC CGG Intronic
907155561 1:52330641-52330663 GTGATGAAAGTGACCACTGGAGG - Intronic
908491014 1:64644171-64644193 GTGGTCAGAGATAACACTGATGG - Intronic
915153502 1:153854841-153854863 GGGATCAAACTTTTCACTGCAGG + Intronic
915424383 1:155812174-155812196 GTGATGAAAGTTAACATTACAGG + Intronic
918580361 1:186119861-186119883 GGCATCAATGTTAACACTTCAGG + Exonic
923931433 1:238703287-238703309 GTGATCAAAATTAACACTACAGG - Intergenic
1063257668 10:4346292-4346314 ATGATCAAAGTTTTCACTGAAGG - Intergenic
1063634981 10:7773587-7773609 TTGATCAAAGTTAAGACATCTGG + Intronic
1064493233 10:15882567-15882589 GTGATCAAAGTAAACACCATTGG - Intergenic
1065389382 10:25167218-25167240 GTGAACAAAATCAACACTACTGG + Intergenic
1067244094 10:44521928-44521950 GTGATCAAGGTTAACATCACTGG - Intergenic
1068603607 10:58981131-58981153 ATGATCTAAATTTACACTGCAGG - Intergenic
1070190917 10:74111446-74111468 CAGAACAAAGTGAACACTGCTGG - Intronic
1073988189 10:109233124-109233146 GTGAGCAAGTTTAACACTGGGGG - Intergenic
1074090033 10:110242661-110242683 GTGAACAAAATTAAAACAGCAGG - Intronic
1074767769 10:116713126-116713148 GTTTTCAAAGATGACACTGCAGG - Intronic
1076325587 10:129618253-129618275 CTGATCAAAGTTTAGAGTGCTGG + Intronic
1076977314 11:184059-184081 GTGATAAAAGTTAACATTAATGG + Intronic
1077388447 11:2287214-2287236 GTGTTCCAAGTTAACACTGCCGG + Intergenic
1078158556 11:8819529-8819551 GTGATCAACGTTAACACCACAGG + Intronic
1080322927 11:31035612-31035634 GTGATCAAAGGTAACATCACTGG - Intronic
1081756849 11:45550921-45550943 GTGATCCAAGGTCACACAGCTGG + Intergenic
1086009891 11:82088789-82088811 ATGATCAAAGTTAATATTACAGG + Intergenic
1086750263 11:90484811-90484833 GTGATAAAGGTTAACTCTGATGG + Intergenic
1089870242 11:121666105-121666127 GTCATCAAAGTTGACACAGAGGG - Intergenic
1090103052 11:123822270-123822292 GTGATCTCAGATCACACTGCTGG + Intergenic
1094165403 12:27437913-27437935 GTGATCAGAGTAAACAGAGCAGG - Intergenic
1096527286 12:52218159-52218181 GCGATCAAAGTTAACATCACCGG - Intergenic
1096868929 12:54581191-54581213 GTGATCAAAGAAAACCCTGTTGG - Intronic
1100441465 12:94621239-94621261 GGGTTTAGAGTTAACACTGCGGG + Intronic
1100695552 12:97088990-97089012 GTGATCTAACTACACACTGCAGG + Intergenic
1104256660 12:127145708-127145730 GGGCTCAAAGTTGACTCTGCTGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1109171392 13:59101772-59101794 ATCATGAAACTTAACACTGCTGG + Intergenic
1111219246 13:85182018-85182040 GTGATCAAAGTTAACATCACTGG + Intergenic
1114967733 14:27984123-27984145 GTCAGCAAAGTTAACAATGTGGG + Intergenic
1115327857 14:32162573-32162595 TTTATCAAATTTAACACCGCAGG + Intergenic
1117154048 14:52920234-52920256 GCAATCAAAGTAAAGACTGCTGG + Intronic
1118844276 14:69534918-69534940 GTGAACATATTTAACACTACTGG - Intergenic
1119767635 14:77200376-77200398 GTGATGAAGGTTAGCCCTGCAGG - Intronic
1120599114 14:86478828-86478850 GTGATCAAAGTTAACATACTTGG - Intergenic
1121877344 14:97465384-97465406 CTGAACAAAGGTAAAACTGCTGG - Intergenic
1125407389 15:39367786-39367808 GTGATCAAAGAAGACACTGAAGG - Intergenic
1125444379 15:39737372-39737394 GTGCTCAAAGTTAACTGGGCAGG + Intronic
1128786464 15:70401045-70401067 GAAATCAAAGTTAATCCTGCAGG - Intergenic
1129142728 15:73615620-73615642 GTCATCAAGGTTAACAGTTCAGG + Intronic
1130373147 15:83304716-83304738 GTGAATACAGTTAACACTACTGG + Intergenic
1131959088 15:97769392-97769414 GTGATCAAAGTTAACATCATTGG + Intergenic
1137927816 16:52558014-52558036 GTGAGCCAAGATCACACTGCTGG - Intergenic
1138151068 16:54657581-54657603 CTGATCAAAGTTGAGAATGCTGG - Intergenic
1142442940 16:90112623-90112645 GTGATAAAAGTTAACATTAATGG - Intergenic
1142464765 17:128769-128791 GTGATAAAAGTTAACATTAATGG + Intergenic
1143239392 17:5431109-5431131 GAGATCATAGTTGACAGTGCCGG + Intronic
1143607900 17:8001162-8001184 GTGATCAAAATTAACCATGAGGG - Intergenic
1144450325 17:15371993-15372015 GTGATCATACTGAATACTGCAGG + Intergenic
1146311854 17:31775420-31775442 GTGATCAAAGTTAACCTCGCTGG - Intergenic
1149297014 17:55270191-55270213 GGGATCAAAGGGAACACTGAGGG + Intronic
1151451638 17:74201605-74201627 GTGCTCAATGCTAACATTGCAGG - Intergenic
1153287119 18:3467012-3467034 CTGATCAAAGGTACCTCTGCAGG - Intergenic
1153710138 18:7790417-7790439 GTGACCAAACTTTACCCTGCTGG - Intronic
1155601660 18:27555852-27555874 CTCATCAAAGATAACAGTGCAGG + Intergenic
1166022679 19:40046936-40046958 GTGTTAAAAGTTTACACTGGGGG + Intronic
1167769764 19:51507848-51507870 GTACTCAAAGGTAACACTGAAGG - Intergenic
924997200 2:373040-373062 ATGAACAAAGTTAATACGGCAGG - Intergenic
925590512 2:5504804-5504826 GTGAAAACTGTTAACACTGCAGG + Intergenic
929216443 2:39418593-39418615 GTGATCAAAGTTAACATTGCCGG + Intronic
929216445 2:39418615-39418637 GTGATCAAAGTTAACACTGCCGG + Intronic
929671553 2:43879823-43879845 GTGATCAAAGTGAACGTTGTTGG - Intergenic
931260908 2:60618271-60618293 GTGATCATACTGAATACTGCAGG - Intergenic
932406417 2:71515677-71515699 GTGGTCAAGGTTACCGCTGCAGG + Exonic
933567964 2:83974515-83974537 CTGATCCAAGATGACACTGCAGG + Intergenic
933896942 2:86820066-86820088 GTGATCAAACTTAACACATGAGG + Intronic
933988440 2:87613833-87613855 GTGATCAAAGTTATCATTCAAGG - Intergenic
934746872 2:96765081-96765103 GTGAGCAAAGTTAGAACAGCTGG + Intronic
934905450 2:98197313-98197335 ATGATCAAAGTAAACACTGCTGG - Intronic
935284745 2:101554519-101554541 ATGATCAAAATGAACACAGCAGG + Intergenic
935446748 2:103165718-103165740 GTGATCAAAATGAACTCTGGTGG + Intergenic
936305400 2:111336978-111337000 GTGATCAAAGTTATCATTCAAGG + Intergenic
939003402 2:136760566-136760588 GTGATCCAAGTTGTCACTCCAGG + Intergenic
939369307 2:141277485-141277507 GTATTCACAGTTAACACTGAAGG - Intronic
940055725 2:149510864-149510886 GTGATCAAAGTTAAAACCACTGG - Intergenic
941755252 2:169178548-169178570 GTTTGCAAAGTTAACCCTGCAGG - Intronic
942822946 2:180137879-180137901 ATGATTAAAGTAAACTCTGCTGG + Intergenic
942835542 2:180292347-180292369 GTGATTAAAGTAAACACTCAAGG - Intergenic
942895777 2:181052571-181052593 GTGCTGAAAGTTAACAGTGCAGG + Intronic
946055325 2:216896005-216896027 TGGAGCCAAGTTAACACTGCAGG + Intergenic
947236552 2:227947642-227947664 ATTATAAAAGTTAACACTTCTGG + Intergenic
1169396377 20:5234104-5234126 GTGACTATACTTAACACTGCTGG + Intergenic
1170802864 20:19604605-19604627 GAGATCTAGGTTAACACTGGGGG - Intronic
1171096158 20:22334173-22334195 GGAATCAGAGTTAACACTGACGG - Intergenic
1171980001 20:31621024-31621046 CTGATCAAGGTTAACATTGGTGG + Intergenic
1173231625 20:41203267-41203289 GTGATCGTAGATACCACTGCCGG - Exonic
1173437403 20:43045507-43045529 GTGAGCTGAGATAACACTGCTGG - Intronic
1175936203 20:62515232-62515254 GTGTTCACAGTCAACACAGCAGG - Intergenic
1177065474 21:16428377-16428399 GTGATCAAAGCCAACTCTCCAGG - Intergenic
1178968188 21:37144580-37144602 GTGGGCCAAGTTAACACTCCAGG - Exonic
1179573563 21:42292379-42292401 GGGACCAAAGATGACACTGCAGG + Intronic
950173377 3:10854495-10854517 GTAATCAGAGCTAACACTGCTGG + Intronic
952585990 3:34892901-34892923 GTTATCAAAGTTATAACAGCAGG - Intergenic
953508427 3:43509677-43509699 ATGTTCAAAGGTAACATTGCTGG - Intronic
954597208 3:51836505-51836527 GTGATCACAGCAAACACTGTAGG + Intergenic
956196905 3:66662033-66662055 GTGATGCAACTTCACACTGCAGG - Intergenic
956858326 3:73297676-73297698 GTGATTAAAATTGACACTCCAGG - Intergenic
961062766 3:123845432-123845454 GAGTTCAAAGTTGACAATGCTGG + Intronic
961160979 3:124725431-124725453 GTGATCAAAGTGCAAACTGTTGG + Intronic
963358037 3:144235336-144235358 ATGGTCAAAGTCATCACTGCAGG - Intergenic
965460279 3:168953578-168953600 GTGATGAAAGGAAAAACTGCGGG + Intergenic
967243178 3:187461286-187461308 TAGGTCAAAATTAACACTGCAGG + Intergenic
968363212 3:198163583-198163605 GTGATAAAAGTTAACATTAATGG - Intergenic
974351989 4:60760347-60760369 GTGATCAAAATTAACACCAACGG + Intergenic
974831450 4:67194517-67194539 GAGAACAAAGTTAATACTGAGGG + Intergenic
975457483 4:74609269-74609291 GTGAGCAAAGGTATGACTGCAGG - Intergenic
976292146 4:83430857-83430879 ATGATTAGAGTTAACACTGGGGG + Intronic
976501856 4:85799760-85799782 GTGATCAAAGTTAATACTACTGG + Intronic
978421628 4:108539397-108539419 GTGATCAGTTTTAACATTGCTGG - Intergenic
978653007 4:111030689-111030711 CTTATCAAAGTGAACACTGATGG + Intergenic
981104395 4:140864264-140864286 ATGACCAGAGTTGACACTGCAGG + Exonic
984143201 4:176028788-176028810 GTGATCAAAGTTAATATCACTGG + Intergenic
984284971 4:177717339-177717361 GTGATCACAGATAAAACCGCTGG - Intergenic
986987993 5:13520885-13520907 GTGATCAAGGTTAACATCACCGG - Intergenic
987290885 5:16506832-16506854 GTTATCAAAATTAAAACTACAGG + Intronic
988097362 5:26633950-26633972 GTGCTGAAAGTTAACACAGATGG - Intergenic
990514105 5:56516254-56516276 AAGATCAAAGGTAAAACTGCTGG - Intronic
991707822 5:69376116-69376138 GTGACCAAACTTAAGACAGCAGG - Intronic
994671927 5:102772290-102772312 GGGATGAAGGTTTACACTGCAGG - Intronic
997646244 5:135483914-135483936 GTGATCAGAGCTGACCCTGCTGG + Intergenic
1001256513 5:170187559-170187581 GAAATCAAAGTTCACAGTGCTGG + Intergenic
1005345594 6:24886721-24886743 CTGATCAAAGTTAACATCACCGG - Intronic
1009578707 6:65502904-65502926 GTGATCAAGGTTAACATTAATGG - Intronic
1009925093 6:70111282-70111304 ATGATCAAAGTAAAGACTGAAGG + Intronic
1011870880 6:91890980-91891002 GTGTCCAAAGTTATCATTGCAGG - Intergenic
1012273007 6:97237908-97237930 GTTATCAAAGTTCACACTGAAGG + Intronic
1013879960 6:114885564-114885586 GTGATCAAAGTTAACATCCCAGG + Intergenic
1018799860 6:167213625-167213647 GGGATCAAGGTTAACATCGCTGG + Intergenic
1018813147 6:167312262-167312284 GGGATCAAGGTTAACATCGCTGG - Intronic
1019252468 7:25128-25150 GTGATAAAAGTTAACATTAATGG + Intergenic
1021995223 7:26173140-26173162 ATGATCAAAATTCACACTACAGG - Intronic
1028436078 7:90806163-90806185 GAGATAAAAGTTAAAACTTCTGG + Intronic
1028687555 7:93608839-93608861 GTTATCAAAGTTAACAGTAAGGG + Intronic
1032190070 7:129759928-129759950 CTGAGCCAAGTTCACACTGCTGG + Intergenic
1033206806 7:139430104-139430126 GAAATGAAAGTTAAAACTGCCGG + Intergenic
1035535047 8:384531-384553 ATGATCAAAGTTAAATCAGCTGG - Intergenic
1038216705 8:25568225-25568247 TTGCTCCAAGTTCACACTGCTGG - Intergenic
1038752640 8:30311577-30311599 ATGATTCAAGTTACCACTGCAGG + Intergenic
1040909750 8:52505839-52505861 GTGATGAAGGTTAACATTACTGG + Intergenic
1043854625 8:85250899-85250921 GTCATCAAAGTCAACATTGAAGG - Exonic
1044248873 8:89983978-89984000 GTGATCACATTTCACACCGCTGG + Intronic
1044647747 8:94462208-94462230 GTGATCAAAGTTAATACCTCTGG - Intronic
1045825786 8:106396322-106396344 GTGATCAAAGTTAACGTTGCTGG + Intronic
1045869247 8:106906624-106906646 GTGCTCAAAGTTAAAACAGGTGG - Intergenic
1047467355 8:125130292-125130314 GTGATCAAGGTTGACATTACTGG - Intronic
1047549660 8:125856442-125856464 ATGATCAAAGTTAACATTTTGGG - Intergenic
1048749564 8:137656618-137656640 GTTATCAAAGTTGACACTCACGG - Intergenic
1051048236 9:12900837-12900859 ATGATCAAAGTGAACATTGTTGG - Intergenic
1052181590 9:25535092-25535114 GTGATCAAAGTTAAAAAACCTGG - Intergenic
1056553797 9:87672902-87672924 GTGACCCAAGTTAGAACTGCAGG - Intronic
1058027535 9:100158679-100158701 GTGAGCAAAGTTAACTCTGATGG + Intronic
1059517130 9:114906452-114906474 GGCATCAAAGTTAACCCTGCAGG - Intronic
1059883191 9:118715094-118715116 ATGAAGAAAGTTAACACTGAAGG + Intergenic
1062747899 9:138227243-138227265 GTGATAAAAGTTAACATTAATGG - Intergenic
1186283128 X:8015854-8015876 GTGATCAAGGTTAACAAGCCAGG - Intergenic
1186351321 X:8742543-8742565 GTGATAAGAGCTAACACTTCCGG - Intergenic
1187158224 X:16741122-16741144 GTGATCAAAATCAACAATGAGGG - Intronic
1188066242 X:25663498-25663520 GGGATCAAAGTTTACAATGGAGG - Intergenic
1189271264 X:39753696-39753718 GTGATCAATGTTAACATTACCGG + Intergenic
1189452998 X:41156966-41156988 GTGATCACAGTCAACCCTGGGGG + Intronic
1192924817 X:75745065-75745087 GTGGGCCAAGTTAACACTCCAGG + Intergenic
1193968344 X:88018405-88018427 TTGATCTAAGTTGACACAGCTGG + Intergenic
1200392869 X:155961984-155962006 GTGATCAAAATTAACATTAATGG - Intergenic