ID: 929224078

View in Genome Browser
Species Human (GRCh38)
Location 2:39495021-39495043
Sequence TGGGCTTCCCCCACCCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929224075_929224078 9 Left 929224075 2:39494989-39495011 CCAAGCTGGTTGAGGGGCAGAGC No data
Right 929224078 2:39495021-39495043 TGGGCTTCCCCCACCCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929224078 Original CRISPR TGGGCTTCCCCCACCCAGCT TGG Intergenic
No off target data available for this crispr