ID: 929225425

View in Genome Browser
Species Human (GRCh38)
Location 2:39507252-39507274
Sequence AGCAGGTGGCTCCACTATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929225423_929225425 -8 Left 929225423 2:39507237-39507259 CCAGGGTTCTCTATGAGCAGGTG No data
Right 929225425 2:39507252-39507274 AGCAGGTGGCTCCACTATGATGG No data
929225421_929225425 2 Left 929225421 2:39507227-39507249 CCAATGGGTGCCAGGGTTCTCTA No data
Right 929225425 2:39507252-39507274 AGCAGGTGGCTCCACTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929225425 Original CRISPR AGCAGGTGGCTCCACTATGA TGG Intergenic