ID: 929225425 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:39507252-39507274 |
Sequence | AGCAGGTGGCTCCACTATGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929225423_929225425 | -8 | Left | 929225423 | 2:39507237-39507259 | CCAGGGTTCTCTATGAGCAGGTG | No data | ||
Right | 929225425 | 2:39507252-39507274 | AGCAGGTGGCTCCACTATGATGG | No data | ||||
929225421_929225425 | 2 | Left | 929225421 | 2:39507227-39507249 | CCAATGGGTGCCAGGGTTCTCTA | No data | ||
Right | 929225425 | 2:39507252-39507274 | AGCAGGTGGCTCCACTATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929225425 | Original CRISPR | AGCAGGTGGCTCCACTATGA TGG | Intergenic | ||