ID: 929226297

View in Genome Browser
Species Human (GRCh38)
Location 2:39514826-39514848
Sequence TGGTCCAAACAGAAGGACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929226297_929226303 3 Left 929226297 2:39514826-39514848 CCCTGGTCCTTCTGTTTGGACCA No data
Right 929226303 2:39514852-39514874 CTCCAAATCTGTAGGCCTTTGGG No data
929226297_929226302 2 Left 929226297 2:39514826-39514848 CCCTGGTCCTTCTGTTTGGACCA No data
Right 929226302 2:39514851-39514873 GCTCCAAATCTGTAGGCCTTTGG No data
929226297_929226300 -5 Left 929226297 2:39514826-39514848 CCCTGGTCCTTCTGTTTGGACCA No data
Right 929226300 2:39514844-39514866 GACCAGTGCTCCAAATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929226297 Original CRISPR TGGTCCAAACAGAAGGACCA GGG (reversed) Intergenic
No off target data available for this crispr