ID: 929226751

View in Genome Browser
Species Human (GRCh38)
Location 2:39519015-39519037
Sequence AAACTCAGCTTCCCAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929226751_929226755 29 Left 929226751 2:39519015-39519037 CCTGTCTTTGGGAAGCTGAGTTT No data
Right 929226755 2:39519067-39519089 AGAGAAAATCAGTGTGGAATAGG No data
929226751_929226752 23 Left 929226751 2:39519015-39519037 CCTGTCTTTGGGAAGCTGAGTTT No data
Right 929226752 2:39519061-39519083 GTACCCAGAGAAAATCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929226751 Original CRISPR AAACTCAGCTTCCCAAAGAC AGG (reversed) Intergenic
No off target data available for this crispr