ID: 929229350

View in Genome Browser
Species Human (GRCh38)
Location 2:39543272-39543294
Sequence TCATGATTACTGTAGCAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929229350_929229352 -4 Left 929229350 2:39543272-39543294 CCACTTTGCTACAGTAATCATGA No data
Right 929229352 2:39543291-39543313 ATGACCCCCCCAGGTCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929229350 Original CRISPR TCATGATTACTGTAGCAAAG TGG (reversed) Intergenic
No off target data available for this crispr