ID: 929231933

View in Genome Browser
Species Human (GRCh38)
Location 2:39568956-39568978
Sequence CTCATCTGAGATGGGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929231933_929231941 16 Left 929231933 2:39568956-39568978 CCTCATTCCCCATCTCAGATGAG No data
Right 929231941 2:39568995-39569017 AACCAGGTCAAGACTGCATCTGG No data
929231933_929231944 23 Left 929231933 2:39568956-39568978 CCTCATTCCCCATCTCAGATGAG No data
Right 929231944 2:39569002-39569024 TCAAGACTGCATCTGGGTTGTGG No data
929231933_929231942 17 Left 929231933 2:39568956-39568978 CCTCATTCCCCATCTCAGATGAG No data
Right 929231942 2:39568996-39569018 ACCAGGTCAAGACTGCATCTGGG No data
929231933_929231938 0 Left 929231933 2:39568956-39568978 CCTCATTCCCCATCTCAGATGAG No data
Right 929231938 2:39568979-39569001 GCCTCCAAGAAAAATGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929231933 Original CRISPR CTCATCTGAGATGGGGAATG AGG (reversed) Intergenic
No off target data available for this crispr