ID: 929235928

View in Genome Browser
Species Human (GRCh38)
Location 2:39605551-39605573
Sequence CAGAGCTAGCACATGTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929235928_929235930 -4 Left 929235928 2:39605551-39605573 CCTCAATACATGTGCTAGCTCTG No data
Right 929235930 2:39605570-39605592 TCTGATTGTGAGTGGAAGCCTGG No data
929235928_929235932 9 Left 929235928 2:39605551-39605573 CCTCAATACATGTGCTAGCTCTG No data
Right 929235932 2:39605583-39605605 GGAAGCCTGGGAGAGCTGTGTGG No data
929235928_929235931 -3 Left 929235928 2:39605551-39605573 CCTCAATACATGTGCTAGCTCTG No data
Right 929235931 2:39605571-39605593 CTGATTGTGAGTGGAAGCCTGGG No data
929235928_929235933 10 Left 929235928 2:39605551-39605573 CCTCAATACATGTGCTAGCTCTG No data
Right 929235933 2:39605584-39605606 GAAGCCTGGGAGAGCTGTGTGGG No data
929235928_929235935 15 Left 929235928 2:39605551-39605573 CCTCAATACATGTGCTAGCTCTG No data
Right 929235935 2:39605589-39605611 CTGGGAGAGCTGTGTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929235928 Original CRISPR CAGAGCTAGCACATGTATTG AGG (reversed) Intergenic
No off target data available for this crispr