ID: 929242422

View in Genome Browser
Species Human (GRCh38)
Location 2:39666172-39666194
Sequence GCTGCGGGACTCGCCCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929242417_929242422 -6 Left 929242417 2:39666155-39666177 CCGCTGTCGCACCTGCCGCTGCG 0: 1
1: 0
2: 0
3: 6
4: 112
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242411_929242422 20 Left 929242411 2:39666129-39666151 CCCCGGACCAGAAGAACCGCCTG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242415_929242422 4 Left 929242415 2:39666145-39666167 CCGCCTGATGCCGCTGTCGCACC 0: 1
1: 0
2: 0
3: 5
4: 70
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242414_929242422 13 Left 929242414 2:39666136-39666158 CCAGAAGAACCGCCTGATGCCGC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242413_929242422 18 Left 929242413 2:39666131-39666153 CCGGACCAGAAGAACCGCCTGAT 0: 1
1: 0
2: 0
3: 4
4: 66
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242408_929242422 26 Left 929242408 2:39666123-39666145 CCGACCCCCCGGACCAGAAGAAC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242410_929242422 21 Left 929242410 2:39666128-39666150 CCCCCGGACCAGAAGAACCGCCT 0: 1
1: 0
2: 0
3: 5
4: 46
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242416_929242422 1 Left 929242416 2:39666148-39666170 CCTGATGCCGCTGTCGCACCTGC 0: 1
1: 0
2: 0
3: 16
4: 92
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242409_929242422 22 Left 929242409 2:39666127-39666149 CCCCCCGGACCAGAAGAACCGCC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82
929242412_929242422 19 Left 929242412 2:39666130-39666152 CCCGGACCAGAAGAACCGCCTGA 0: 1
1: 0
2: 1
3: 13
4: 148
Right 929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929242422 Original CRISPR GCTGCGGGACTCGCCCCCGC TGG Exonic
900138380 1:1128386-1128408 GCTGCGGGCTTGGCCACCGCTGG + Intergenic
901109823 1:6785617-6785639 GCGGCGGGACCCGGCCCCGCCGG + Intronic
901757962 1:11452883-11452905 GCTGCGTGCCTGGCCCCTGCGGG + Intergenic
901791154 1:11654396-11654418 GCGCCGGGACTCGCCGCCCCGGG - Exonic
910858403 1:91719345-91719367 GCTGCGGTACTCGGCCCCGGTGG - Exonic
922620785 1:226986739-226986761 GCTGCGGGCCACGCCCAGGCCGG + Exonic
923429344 1:233905396-233905418 GCCGCGGCGCTCGCCCCCGGAGG + Intronic
924436808 1:244049260-244049282 GCTCCGCGCCGCGCCCCCGCGGG + Intronic
1067055817 10:43049285-43049307 GCTGCGTGGCTTGCACCCGCTGG + Intergenic
1067132114 10:43574388-43574410 GCCGCGGGCCGCGCCTCCGCTGG + Intronic
1070264934 10:74893037-74893059 GCTGCGGGCCTAGCCCTGGCAGG - Intronic
1072021724 10:91409872-91409894 CCCGCGGGACTCGGCGCCGCAGG + Intergenic
1077253649 11:1571505-1571527 GCTCCGGTTCTGGCCCCCGCGGG + Intronic
1079128477 11:17734715-17734737 GCAGCCGCACTCGCCCCCGGAGG - Intergenic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1097925380 12:65121401-65121423 CTTGCGCGACTCGCGCCCGCTGG - Exonic
1105034387 12:132908360-132908382 GCTCCGGGTCTCGCCTGCGCCGG + Intronic
1114643782 14:24242301-24242323 GCTGCGGGACCCGCCACCAGGGG + Exonic
1117718193 14:58602291-58602313 GCTGTGTGACTCTACCCCGCTGG + Intergenic
1119046395 14:71321346-71321368 GAAGCCGGACTCGCCCCCGCCGG - Intronic
1121828892 14:97033272-97033294 GCTGCGGGATCCGCCGCCCCGGG + Intergenic
1122409600 14:101519115-101519137 GCTGGGTGACCCGCCCCAGCAGG + Intergenic
1122517665 14:102319969-102319991 GCTGCGGGACGCGGCCCAACAGG + Exonic
1130342565 15:83011717-83011739 GCCACGAGACTCGCTCCCGCCGG - Intergenic
1132512753 16:352464-352486 GCCCCGGGCCGCGCCCCCGCCGG - Exonic
1132859491 16:2062965-2062987 GCCTCGGGACTCGCTCCTGCGGG - Exonic
1134554416 16:15154089-15154111 CCTCCGGGCCCCGCCCCCGCTGG + Intergenic
1142161239 16:88558708-88558730 GATGCGGGACTCACACCCCCAGG - Intergenic
1143108191 17:4539781-4539803 GCTGGGGGGCTGGCTCCCGCCGG + Exonic
1143882549 17:10040694-10040716 GGTGGGGGACTCCCCACCGCTGG - Intronic
1144565136 17:16353465-16353487 GCAGCGCGGCGCGCCCCCGCCGG + Exonic
1144950364 17:18990554-18990576 GCTGGGGGACGTGCCCCAGCAGG + Intronic
1145017938 17:19411187-19411209 GCTGCTGGACTCACCCCAGGGGG - Exonic
1145765440 17:27456070-27456092 ACTGCGGGACGCACACCCGCCGG + Intergenic
1151408775 17:73907086-73907108 GCTGCAGGAATGGCCCCCACGGG + Intergenic
1151683440 17:75633740-75633762 GCTGCAGGACTCCCCTCCACAGG + Intronic
1152357291 17:79813381-79813403 GCTGCGGCGCCCGCCCCCGCCGG + Intergenic
1152570717 17:81120147-81120169 GCTGGGGGTCGCGCTCCCGCAGG - Intronic
1152628655 17:81399818-81399840 GCCGCGCGTCTCGCCCCGGCTGG + Exonic
1152722509 17:81929869-81929891 TCTGTGGGACTGGCCCCCGCAGG + Intergenic
1160100581 18:75916522-75916544 CCTCCGGGACGCGGCCCCGCAGG - Intergenic
1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG + Exonic
1165420073 19:35718098-35718120 GCCGCGGCCCCCGCCCCCGCCGG - Exonic
1165696920 19:37907482-37907504 GCGCCGGGACTCGCGCCCTCCGG + Intronic
1166297534 19:41896396-41896418 GCTGGGGGACTCATCCCCGCAGG + Exonic
1166746055 19:45142367-45142389 CCTGCAGGACTCGGCCCAGCTGG + Exonic
926718578 2:15942557-15942579 GCTGCGGGAGCCGGCCGCGCCGG + Exonic
928093349 2:28390117-28390139 GCTGCGGGACTGACCTCCCCCGG - Intergenic
929133744 2:38603045-38603067 CCTGCGGGAAGCGCCCCCCCCGG + Intronic
929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG + Exonic
932363463 2:71130049-71130071 GCTGTGGAACGCGCCCCCGGGGG + Intronic
933655102 2:84880731-84880753 CCTGCGGGCTGCGCCCCCGCGGG + Intronic
937221289 2:120344512-120344534 GCGGCGGGAGTCGCCTCTGCTGG + Intergenic
946367019 2:219254515-219254537 GCTGCGGGGCTCGACTCTGCGGG - Intronic
1169143564 20:3238945-3238967 GCTGCGGGATTCCCAGCCGCGGG - Intronic
1171788645 20:29497611-29497633 GCTTCCAGACTCGCCGCCGCAGG - Intergenic
1172444670 20:34986783-34986805 CCTGCTGGGCTTGCCCCCGCAGG + Intronic
1175949325 20:62574780-62574802 GCTGCGGGAGTCGGCCCACCAGG - Intergenic
1181317891 22:21982696-21982718 GCTGCGGGACCCTCGCCCGGCGG - Exonic
1185079314 22:48701041-48701063 GCTGCGGGCCTCTCCACAGCTGG - Intronic
1185342937 22:50299712-50299734 GCCGCCGGTCTCGCCCTCGCCGG - Intronic
962826150 3:139102254-139102276 GCTGTGGGACTGGCCCCTGCTGG + Intronic
968629779 4:1644307-1644329 GACGCGGGACTCGCACTCGCGGG + Intronic
974055141 4:56976874-56976896 GCTGCCCGACTTGCCCGCGCTGG - Exonic
981475294 4:145180841-145180863 GCCGCGGGAATCGCGCGCGCCGG + Intergenic
982288781 4:153759897-153759919 TCTGCGGGACCCTCCCCGGCAGG - Exonic
984795731 4:183658879-183658901 GCTGCGCGCCGCGCCCGCGCTGG + Intronic
985595927 5:787809-787831 GCTGTGGGACACACCCCCACGGG - Intergenic
985805798 5:2042205-2042227 GCTGGGGGACTGGCCGCAGCTGG + Intergenic
994197399 5:96935825-96935847 GCTGCGGCGCTCTCCCCGGCCGG - Exonic
997297507 5:132777201-132777223 GCTGCGGGACGCGCTCCGCCCGG + Exonic
999767775 5:154754723-154754745 GCTCCGCGCCTCGCCGCCGCTGG - Intronic
1002632477 5:180590893-180590915 GGTCCAGGACGCGCCCCCGCGGG + Intronic
1002692507 5:181059875-181059897 GCCGCGGGACTGGCCCCGGGGGG + Exonic
1002887871 6:1312176-1312198 CCTCGGGGACTCGCCTCCGCGGG + Intergenic
1004272896 6:14211161-14211183 GCCGCGCGCCCCGCCCCCGCGGG + Intergenic
1006606080 6:35259006-35259028 GGTGAGGGACTCGCCTCCGCAGG - Intronic
1011277300 6:85643346-85643368 GCCTCGGGACGCGCGCCCGCGGG + Intronic
1015497469 6:133896036-133896058 GCAGCGGGACACGCACCCGCTGG - Intergenic
1021845333 7:24757547-24757569 GCCGCGGGACTGGCCGCCGGAGG + Intronic
1022946972 7:35295900-35295922 ACTGCAGGCTTCGCCCCCGCAGG + Intergenic
1025829631 7:65038220-65038242 GCTCCGGGCCCCGCCCCCACAGG - Intergenic
1025916872 7:65873194-65873216 GCTCCGGGCCCCGCCCCCACAGG - Intergenic
1027172049 7:75879331-75879353 CCTCCGGGACTCGCCCCTTCAGG + Intronic
1035289364 7:157827779-157827801 GCTGCCGGCCCCGCCCTCGCCGG + Intronic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1049620819 8:143597677-143597699 GCTGCCGGACCCGCCCCCACCGG - Intronic
1049643755 8:143727106-143727128 GCTGCGGCGCTCGCCCCCCACGG + Exonic
1049647060 8:143740230-143740252 CCTGCGCCACTCGCCCTCGCGGG + Intergenic
1054804752 9:69387054-69387076 GCTGCTGTTCTTGCCCCCGCAGG - Intronic
1056475256 9:86946671-86946693 GCTGCTGGGCTCGGCGCCGCGGG - Exonic
1057311469 9:93945853-93945875 GCAGAGGGACTCGACCCCGAGGG - Intergenic