ID: 929243461

View in Genome Browser
Species Human (GRCh38)
Location 2:39676504-39676526
Sequence GAGACCGGTGGGAAGTCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929243461_929243469 30 Left 929243461 2:39676504-39676526 CCTGCAGACTTCCCACCGGTCTC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 929243469 2:39676557-39676579 TTAAAGCAATCCCGGGCAAGTGG 0: 1
1: 0
2: 1
3: 6
4: 98
929243461_929243467 23 Left 929243461 2:39676504-39676526 CCTGCAGACTTCCCACCGGTCTC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 929243467 2:39676550-39676572 ACCATTCTTAAAGCAATCCCGGG 0: 1
1: 0
2: 1
3: 10
4: 139
929243461_929243466 22 Left 929243461 2:39676504-39676526 CCTGCAGACTTCCCACCGGTCTC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 929243466 2:39676549-39676571 GACCATTCTTAAAGCAATCCCGG 0: 1
1: 0
2: 1
3: 9
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929243461 Original CRISPR GAGACCGGTGGGAAGTCTGC AGG (reversed) Intronic
904134384 1:28300095-28300117 GAGTCCGCTGGGAAGCCTGAGGG + Intergenic
904746898 1:32716829-32716851 GAGGACGGTGGGAAGTGGGCGGG + Intergenic
905866510 1:41379775-41379797 GAGACTGGTGGGAAGGAGGCAGG + Intronic
906538008 1:46562658-46562680 GGGACCGGGGCGAGGTCTGCAGG - Exonic
906709890 1:47921420-47921442 GAGACCCTTTGGAAGTCTGATGG - Intronic
908982476 1:69975780-69975802 CAGACTGGAGGGAAGACTGCAGG - Intronic
910615659 1:89195409-89195431 GAGCCCAGAGGGAAGCCTGCAGG + Exonic
910632408 1:89369539-89369561 GAGCCCAGAGGGAAGCCTGCAGG - Exonic
910981843 1:92965830-92965852 GAGGGCGCTGGGAAGGCTGCAGG + Intergenic
921128065 1:212195662-212195684 GTGCCCAGTGGGAACTCTGCTGG - Intergenic
922537473 1:226391709-226391731 GAGAAGGGTGAGAAGGCTGCGGG + Intronic
922585682 1:226733590-226733612 GAGACTGGTGGGAAGTGGGGTGG - Intronic
923859457 1:237878443-237878465 GAGAGAAGTTGGAAGTCTGCTGG - Intronic
1066586785 10:36944490-36944512 GGGACCGGGGTGAGGTCTGCAGG - Intergenic
1067745404 10:48931982-48932004 AAGGCCGGTGGGTAGGCTGCAGG + Intronic
1069901386 10:71708490-71708512 GGGACAGGTGGGAAGTGTGAGGG - Intronic
1070401145 10:76054766-76054788 GAGGCCGGTGGGAGCTCTACTGG + Intronic
1070671535 10:78380898-78380920 CAGGCAGGTGGGAAGGCTGCCGG - Intergenic
1074355882 10:112782664-112782686 GTGTCCGATGAGAAGTCTGCAGG - Intronic
1076045089 10:127286031-127286053 GAGCCCAGTGGGAAGCCAGCTGG - Intronic
1077425570 11:2474406-2474428 GAGCCCTGTGGGAAGCCTCCTGG + Intronic
1079359385 11:19757902-19757924 GAGACTGGGGGTAAGACTGCAGG - Intronic
1083312145 11:61789432-61789454 GAGGCTGCTGGGAAGTCAGCTGG - Intronic
1084184210 11:67463126-67463148 GATGAGGGTGGGAAGTCTGCGGG + Exonic
1084720466 11:70902435-70902457 GAGACAGGTGGGGAGGCGGCAGG - Intronic
1088644513 11:111906691-111906713 GAGACAGGAGGGAAGTCTGTTGG - Intergenic
1088899310 11:114103218-114103240 GAGACAGGTGTGGAGTGTGCAGG + Intronic
1089432164 11:118434241-118434263 AACACAGGTGGGAGGTCTGCAGG - Exonic
1089541007 11:119188953-119188975 GACACCGGGGGAAAGTTTGCTGG - Intronic
1090383966 11:126345828-126345850 GAGAATGGTGGAAAGTCTCCAGG + Intergenic
1090655165 11:128837672-128837694 AAGAACAGTGGGAAGTCTGATGG - Intronic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1101998099 12:109539492-109539514 GAGGCCGGTGGAAAGTTTCCTGG + Intergenic
1104208521 12:126663959-126663981 GAGTCCGATGGGAGGTTTGCTGG + Intergenic
1109207611 13:59499633-59499655 GAAACCAGAGGGAAGTCTACCGG - Intergenic
1114241392 14:20871641-20871663 GAGACTGGTAGGAAGCCTGGAGG + Intergenic
1115753013 14:36508768-36508790 GGGACTGGCGGGGAGTCTGCGGG - Intronic
1117512162 14:56463461-56463483 GAGAGCAGTGGGAATTCTGTAGG + Intergenic
1124008892 15:25818985-25819007 GAAACCCGAGGGAAGACTGCTGG + Intronic
1125753287 15:42045131-42045153 GAGGCCGGTGGGGAGTCTCAGGG + Intronic
1126451277 15:48811482-48811504 GAGTTCGGTGGGGAATCTGCGGG - Intergenic
1127007215 15:54583982-54584004 GAGCCCGAGGGGAAGTCTGGAGG - Intronic
1130973046 15:88749609-88749631 GATACTGGTGGGAAGACTGGAGG - Intergenic
1132290934 15:100703515-100703537 GGGCCCAGTGGGGAGTCTGCTGG + Intergenic
1132396958 15:101481321-101481343 GTGACGGGTGGGAAGGCTGAGGG + Intronic
1132396968 15:101481353-101481375 GTGACGGGTGGGAAGGCTGAGGG + Intronic
1132396978 15:101481385-101481407 GTGACGGGTGGGAAGGCTGAGGG + Intronic
1134846794 16:17447255-17447277 GAGACAGATGGGAAGTCCCCTGG + Intronic
1141593870 16:85085950-85085972 GAGACTGGTGGGAAGCGTGGGGG + Intronic
1141658762 16:85430456-85430478 GACACAGGTGGGAACTGTGCTGG + Intergenic
1142759325 17:2034181-2034203 GTGATCAGTGGGAGGTCTGCCGG + Intronic
1144211150 17:13016815-13016837 GAGGCTGGTGGGAAGTCTCTGGG - Intronic
1145241461 17:21243002-21243024 GAGCCCGGTGGGCAGGATGCAGG + Exonic
1146514744 17:33480416-33480438 GAGACTGGGGTGGAGTCTGCAGG + Intronic
1148074189 17:44926255-44926277 GAGACAGGTGGGAGGTGGGCTGG - Intronic
1150264252 17:63821693-63821715 GAGGCCGGGGGCAAGACTGCGGG - Intronic
1151448349 17:74181861-74181883 GAGAAGGGAGGGAAGCCTGCAGG - Intergenic
1151809089 17:76425844-76425866 GAGACAGGATGGAATTCTGCAGG - Intronic
1152092047 17:78252499-78252521 GAGACAGGTGTGAGGTCTGCCGG - Intergenic
1154193136 18:12246798-12246820 GACACTGGCGGCAAGTCTGCAGG + Intergenic
1158558287 18:58492969-58492991 GAGGCTGGAGGGAAGTCTGAAGG - Intronic
1159832566 18:73294835-73294857 GAGACGGTTGGGAAGTGTGCAGG + Intergenic
1160738427 19:675137-675159 GAGAGCGGTTGGGTGTCTGCTGG - Intergenic
1161851841 19:6741172-6741194 GGGAGCGGTGGGAGGGCTGCGGG + Intronic
1162113433 19:8413572-8413594 AAGGCCGGTGGGAGGTCTCCGGG + Intronic
1166231458 19:41427564-41427586 GAGACAGCTGGGAAGGGTGCAGG + Exonic
1167297826 19:48662132-48662154 GAGACCGGTGGGTGGGCTTCTGG + Intronic
1168253039 19:55151710-55151732 GAGACAGATGGGAAGACTGCAGG - Intergenic
926375094 2:12219353-12219375 GAGACTGATGCGAAGTCTGTAGG + Intergenic
926731357 2:16038147-16038169 GAGCCTGGTGGGCAGTCTGCCGG + Intergenic
927502946 2:23594332-23594354 GAGCCGGGCAGGAAGTCTGCGGG - Intronic
928953327 2:36834682-36834704 GAGATATGTGGGAAGTCTGTTGG + Intergenic
929243461 2:39676504-39676526 GAGACCGGTGGGAAGTCTGCAGG - Intronic
932415970 2:71574150-71574172 GAGGCCGGTGGGAAGGCTGGGGG - Intronic
934151505 2:89151926-89151948 GAGACCTGGGGGAAGGCTGTGGG - Intergenic
934215754 2:90029980-90030002 GAGACCTGGGGGAAGGCTGTGGG + Intergenic
934708641 2:96501657-96501679 GAGTCCTGTGGGAAGTCCCCTGG - Intronic
935285770 2:101562554-101562576 GACACAGGCGGGAAATCTGCAGG - Intergenic
935535146 2:104285164-104285186 GAGAACGGTGTGAACTCGGCAGG - Intergenic
935939083 2:108219973-108219995 GAGACTGGTTTGAAGTCTGGTGG - Intergenic
936010692 2:108923524-108923546 GAGCACGGTGGCCAGTCTGCAGG + Intronic
937234233 2:120420791-120420813 AAGACTGGTGGGCAGTGTGCTGG - Intergenic
937328792 2:121009049-121009071 GAGACTAGTGAGAAGGCTGCTGG - Intergenic
940832110 2:158478496-158478518 GAGAGCGGTGGGCAGACTACAGG - Intronic
946405068 2:219488187-219488209 AAGACTGGGGGGAAGTCTGGAGG - Exonic
947992908 2:234500862-234500884 GAGACCTGTGGGTTATCTGCTGG + Intergenic
1172071634 20:32261630-32261652 GAGACCAAGGGGAAGGCTGCTGG - Intergenic
1174408821 20:50320828-50320850 GAGAGCTGTGGGAAGTTTCCAGG - Intergenic
1177693835 21:24546008-24546030 GAGTCCAGTGGGAAGTCTCCAGG - Intergenic
1184334898 22:43847428-43847450 GAGACCAGTGGGAGGAGTGCTGG - Intronic
953018013 3:39096943-39096965 GAGCCCAGTGTCAAGTCTGCTGG - Exonic
956273351 3:67471218-67471240 GAGAACCCTGGGAAGTCTGAAGG + Intronic
956582418 3:70829212-70829234 GAGAGAGGTTGGAAGTTTGCGGG - Intergenic
957011594 3:75012011-75012033 GAGCCTGGTGGGAAGTATTCGGG + Intergenic
961985159 3:131124199-131124221 GAGACACAAGGGAAGTCTGCTGG - Intronic
962373628 3:134841406-134841428 GGGACAGGTGGGAGGTCTCCAGG + Intronic
964627911 3:158776754-158776776 GGGAAGGGTGGGAAGGCTGCAGG + Intronic
969435869 4:7189070-7189092 GAGAATGGAGGGAAGCCTGCAGG - Intergenic
970593711 4:17580585-17580607 GAGGCTGGTGGGAAGGCAGCTGG - Intronic
970849875 4:20589180-20589202 GGGACCGGGGGGAAGGCTTCTGG + Intronic
971119365 4:23687113-23687135 GAGAATGGTTGGAAGGCTGCAGG + Intergenic
986206824 5:5632480-5632502 GAGACAGGTGAGAAGGCTGGAGG + Intergenic
998936488 5:147234855-147234877 GAAACCGCTGGGCAGTCTCCTGG - Intergenic
1001865903 5:175105253-175105275 GGGTCAAGTGGGAAGTCTGCAGG + Intergenic
1002833887 6:849128-849150 GAGACCAACGGGAAGTTTGCAGG + Intergenic
1003091706 6:3109363-3109385 CAGATCGGTGGGAAATCTGGTGG + Intronic
1004252596 6:14034410-14034432 GAGACAAGTGGGAAGTCATCTGG + Intergenic
1006189473 6:32198793-32198815 GAGAGGGGTGGGAAGCCTGCTGG - Intronic
1017736378 6:157368784-157368806 GAGGCCAGTGGGGAGTCTGGAGG - Intergenic
1019345955 7:531106-531128 CAGGCTGGTGGCAAGTCTGCAGG - Intergenic
1022756700 7:33300345-33300367 GAAACAGATGGGAAGTTTGCAGG + Intronic
1023237786 7:38108682-38108704 CAGGCTGGTGGGAAGTCAGCTGG - Intergenic
1026988058 7:74567353-74567375 GAGAGAGGTGGAAAGTCCGCAGG + Intronic
1027753437 7:82180772-82180794 GAGGCCAGTGGGAAGTCTTGAGG + Intronic
1029704781 7:102270497-102270519 GAGACTGGAGGGAAGGCTGTGGG - Intronic
1030638276 7:111974648-111974670 GAGACCAGGGGGAAGTAGGCAGG + Intronic
1033306605 7:140230369-140230391 GAGACCGCTGGGGAGTTTCCCGG + Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1038324795 8:26564696-26564718 AGGACCAGTGGGAAGTCTTCAGG + Intronic
1039917836 8:41872787-41872809 GTGACCTGTAGGAGGTCTGCTGG + Intronic
1040288684 8:46113314-46113336 AAGACCGCTGGGAATTCTGGGGG - Intergenic
1045568841 8:103349267-103349289 GAGACTGGAGGGAAGCCTTCAGG + Intergenic
1048502264 8:134988967-134988989 GAGACCTGTAGGAAGCCAGCAGG + Intergenic
1050061967 9:1718860-1718882 GAACCCAGTGGGAAGTCTGGAGG - Intergenic
1050126492 9:2361610-2361632 GATATCGATGGGTAGTCTGCAGG + Intergenic
1053513107 9:38706325-38706347 GGGAGCGGTGGGAAGAGTGCAGG - Intergenic
1061371153 9:130198285-130198307 GAGCCCTGGGGGAAGGCTGCTGG + Intronic
1061636231 9:131910885-131910907 GGGATAGATGGGAAGTCTGCTGG - Intronic
1061737213 9:132669966-132669988 GAGCCCGGTGCGCAGACTGCTGG + Exonic
1062349570 9:136132441-136132463 GAGGCCGGTTGGATGCCTGCAGG + Intergenic
1062635585 9:137488881-137488903 TAGACAGTTGGGATGTCTGCTGG - Intronic
1062635604 9:137488981-137489003 TAGACAGTTGGGATGTCTGCTGG - Intronic
1187842583 X:23504481-23504503 GAGACAGATGGGAAAACTGCTGG - Intergenic
1190122751 X:47676078-47676100 GAGGCGGGGGGGAAGTCTCCTGG + Intergenic
1191226376 X:58048759-58048781 GAGAAAGGTGGGAAGACTGATGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193593413 X:83418688-83418710 GAGAACGCTGGGAACTCTCCAGG + Intergenic
1199746763 X:150776571-150776593 TAGCCCAGTGGGAAGCCTGCAGG - Intronic
1202392717 Y:24387887-24387909 GAGACTGGAGGGAATTTTGCCGG + Intergenic