ID: 929249177

View in Genome Browser
Species Human (GRCh38)
Location 2:39733944-39733966
Sequence GATGATGAAATAGGAAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 933
Summary {0: 1, 1: 0, 2: 7, 3: 94, 4: 831}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929249177_929249180 -7 Left 929249177 2:39733944-39733966 CCCTTTTTTCCTATTTCATCATC 0: 1
1: 0
2: 7
3: 94
4: 831
Right 929249180 2:39733960-39733982 CATCATCTTTTCGTCTTTCCTGG 0: 1
1: 0
2: 0
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929249177 Original CRISPR GATGATGAAATAGGAAAAAA GGG (reversed) Intergenic
900311197 1:2033979-2034001 GATGAGGAAGGAGGAAAAACAGG + Intergenic
903311167 1:22457614-22457636 GATGAGGAAATTAGAAACAAAGG + Intronic
904191710 1:28749743-28749765 ATTAATGAAATAGAAAAAAAAGG + Intronic
904929672 1:34076672-34076694 TATGATGAGATAGAAACAAAAGG - Intronic
905272233 1:36794642-36794664 GATGATGTCATAGGAGAACATGG + Intergenic
906746925 1:48228584-48228606 AATGGTGAAGTGGGAAAAAAGGG - Intronic
906972046 1:50525722-50525744 CACAATTAAATAGGAAAAAAAGG - Intronic
907011632 1:50968784-50968806 GCTGATGAGGTCGGAAAAAAGGG + Exonic
907773901 1:57493717-57493739 GATGAAGAAAGAAGAAAAAGAGG + Intronic
907945716 1:59134831-59134853 TATGATGAAATATGAAACATGGG - Intergenic
908149966 1:61289756-61289778 GAAGATGAGATAAGAAATAAAGG - Intronic
908516383 1:64897118-64897140 CATGAAGAAATAGCAAAAGAAGG + Intronic
908808415 1:67954602-67954624 GAAGATGAGTTAGGAGAAAATGG + Intergenic
909085090 1:71161224-71161246 AGTGATGAGACAGGAAAAAAAGG + Intergenic
909239022 1:73188889-73188911 AATGATAAAATAGGGAAAATAGG + Intergenic
909283909 1:73790621-73790643 GAAGATGAAAAAAGAAAGAAAGG - Intergenic
909285310 1:73808988-73809010 GCTGAAGAGACAGGAAAAAAGGG + Intergenic
909630191 1:77762733-77762755 GATGCTGAAACCGGAAATAATGG - Intergenic
909650303 1:77967999-77968021 GATTGTAAAATAGGAGAAAAAGG + Intronic
909800445 1:79800553-79800575 TATGATGAAATGGTAAAAACAGG + Intergenic
910305731 1:85761073-85761095 GATGTAGAATTAGGAAGAAATGG + Intronic
910438453 1:87228816-87228838 GATGATGATACAGGGAAAAAAGG + Intergenic
910592768 1:88945167-88945189 GATGTTGAAAAAGGAAAGAAGGG + Intronic
910626541 1:89313705-89313727 GAAGGAGAAAAAGGAAAAAAAGG + Intergenic
910814469 1:91275795-91275817 GATGATAGAATAGGAACAAAGGG - Intronic
910959829 1:92750187-92750209 ATAAATGAAATAGGAAAAAAAGG + Intronic
911563793 1:99438658-99438680 GATGAATATATAGGAAGAAATGG + Intergenic
911577572 1:99596583-99596605 GAAGATGAAAGAAGAACAAAGGG + Intergenic
911665632 1:100548024-100548046 GAGGATGAGGTAGGAACAAAAGG - Intergenic
911832369 1:102568595-102568617 AAAAATAAAATAGGAAAAAAAGG - Intergenic
912013976 1:105008186-105008208 GATATTGCAATAGGAAATAAAGG - Intergenic
912015184 1:105025869-105025891 GAAGATGAAAGATGAAAAGAAGG + Intergenic
912276755 1:108266441-108266463 GAGGATGAAATAGTAAAGATAGG - Intergenic
912291475 1:108427914-108427936 GAGGATGAAATAGTAAAGATAGG + Intronic
912315386 1:108663191-108663213 AATGATGAAATAGGCAAATTTGG - Intergenic
912663221 1:111553780-111553802 GTTGACTAAATAGGAAAAAAGGG - Intronic
914440759 1:147704210-147704232 GAGGAGGAAAGAAGAAAAAAAGG - Intergenic
914473203 1:148001599-148001621 CCTGATGAAATAGATAAAAAAGG + Intergenic
914901787 1:151715062-151715084 GATGAGGAAATAGGGAAAATGGG - Intronic
914964509 1:152242608-152242630 TCTGATAAAATAGGAAAACAAGG - Intergenic
915048771 1:153044351-153044373 TATGATGAAATTGGAAGAAATGG + Intergenic
915050167 1:153060872-153060894 TATGATGAAATTGGAAGAGATGG + Intergenic
915051287 1:153075492-153075514 TATGATGAAATTGGAAGAAATGG + Intergenic
915053168 1:153098139-153098161 TATGATGAAATTGGAAGTAATGG + Intronic
915383567 1:155467779-155467801 ATTGATGAAATAAGAAATAAAGG - Intronic
916274645 1:162980540-162980562 GATGATGGAGTAAGAAAAAATGG - Intergenic
916291502 1:163171574-163171596 GAGCAAGAAATAGAAAAAAAAGG - Intronic
916427531 1:164695358-164695380 TATGATGAGATAGAAAAAAATGG - Intronic
917022679 1:170607304-170607326 AATGATGACACAGGAAGAAATGG - Intergenic
917235056 1:172883115-172883137 GATGATGAAGCAGGGAAACAGGG + Intergenic
917282092 1:173386900-173386922 AAGGAAGAAATAGGAAAGAAGGG - Intergenic
917365542 1:174228170-174228192 AATGATAAAATAGGCAAAGAAGG - Intronic
917594951 1:176519783-176519805 GAATATTAAAAAGGAAAAAATGG - Intronic
917775565 1:178330792-178330814 GAAGATGAAAGGTGAAAAAAAGG - Intronic
917779092 1:178372177-178372199 AATGATGAAGTGAGAAAAAAAGG - Intronic
917824366 1:178801442-178801464 AATGATGAAACAGGATCAAATGG - Intronic
917891710 1:179445174-179445196 GAATATGAAATAAGAATAAATGG + Exonic
917988805 1:180350775-180350797 GAAGAGGTAATAGGAAAAAAAGG - Intronic
918506347 1:185258138-185258160 AATAATGAAATAGAAATAAAAGG - Intronic
918961807 1:191288706-191288728 GATGATGGAAGTGGAAAAGAAGG - Intergenic
919163754 1:193865858-193865880 GATGTTGAAATATGTGAAAAAGG - Intergenic
919436423 1:197567952-197567974 CATGAGGAAATAGAAATAAAAGG + Intronic
919610471 1:199740131-199740153 AAGGATGAAAAAGGAAAAAATGG - Intergenic
919665885 1:200291434-200291456 CCTGATGAAATAGGAGAAGAGGG + Intergenic
919829116 1:201527373-201527395 GATTAGGAAATAGGAATAGAAGG + Intergenic
920605058 1:207373751-207373773 CATGGTGAAATAGTAAAGAAGGG + Intergenic
920816405 1:209337362-209337384 GATTATCCAATAGTAAAAAAGGG - Intergenic
920852266 1:209636094-209636116 GATGCTGAAATAGAAAATAATGG - Intronic
921541430 1:216421141-216421163 GGTGATTAAATAACAAAAAATGG + Intronic
921769271 1:219016019-219016041 GCTAATGAAGTAGGAAAATATGG + Intergenic
922287464 1:224182971-224182993 GAAGATGAAAAAGGAAGGAATGG - Intronic
922399984 1:225243367-225243389 AATGAGGAAAAAGAAAAAAAGGG + Intronic
922431467 1:225559159-225559181 CACGATGAAATAAGAAAAATTGG - Intronic
922867615 1:228873586-228873608 TGTGAAGAATTAGGAAAAAATGG - Intergenic
923212697 1:231819261-231819283 TAAGAAGAAATAAGAAAAAACGG + Intronic
923709234 1:236372256-236372278 CATGATAAAAAAGAAAAAAATGG - Intronic
923799726 1:237195739-237195761 GATGAGGAAACAGGTCAAAAGGG - Intronic
924094394 1:240536321-240536343 GATAATTAAATGGGAAGAAAGGG + Intronic
924527911 1:244868423-244868445 GAAAATGAAAAAGAAAAAAAAGG + Intergenic
924548626 1:245053646-245053668 CCTGATGATATAAGAAAAAAAGG - Intronic
924664732 1:246059490-246059512 GATAATAAAATAGGAGAAAAAGG - Intronic
1063003768 10:1948785-1948807 GATGAAGAAAGAAGAAAGAAAGG - Intergenic
1063640314 10:7823328-7823350 GATGATTAAAAAAAAAAAAAAGG + Intronic
1063732140 10:8709948-8709970 GATGAACAGATGGGAAAAAAAGG - Intergenic
1063801240 10:9580836-9580858 GTTGATAAAATAGGAATGAAAGG + Intergenic
1064205310 10:13318958-13318980 GTTAATGTAACAGGAAAAAAAGG + Exonic
1064630950 10:17310115-17310137 GATGATGAAATTAGTAGAAAAGG + Intergenic
1064820486 10:19324819-19324841 GGTTATATAATAGGAAAAAAGGG - Intronic
1064846972 10:19666498-19666520 AATTATGAAATATGTAAAAATGG - Intronic
1064850781 10:19706652-19706674 TATGTTTAAAAAGGAAAAAAAGG + Intronic
1064980230 10:21159214-21159236 GAAGAAGGAATAAGAAAAAAAGG - Intronic
1065906765 10:30261802-30261824 GTAGATGAAATAGAAAAATATGG + Intergenic
1066457444 10:35584656-35584678 GAGGATGAAAGAGGAATGAAGGG + Intergenic
1067266363 10:44748746-44748768 GATGTTGAAATAGACATAAATGG + Intergenic
1067811602 10:49431546-49431568 CATGAAGAAATAGGTCAAAAAGG + Intergenic
1068016227 10:51519407-51519429 GAAGATGGAATAGAACAAAATGG - Intronic
1068351793 10:55857208-55857230 TATGAAAAAATAGGAAAAAAGGG - Intergenic
1068421591 10:56801418-56801440 GATGATGAAATAAAACACAATGG - Intergenic
1068508666 10:57936459-57936481 AATGATAAAAGAGGAAATAATGG - Intergenic
1068559850 10:58501977-58501999 GAGGTTGAATTATGAAAAAAAGG - Intergenic
1068604179 10:58987360-58987382 AATGAAGAAGTAGGAAAAAATGG - Intergenic
1068696903 10:59977732-59977754 GATGAAGAAAGAAGTAAAAAGGG - Intergenic
1069086486 10:64145801-64145823 GCTGATGAAAAAGGAACAGATGG - Intergenic
1070035636 10:72720516-72720538 GATGATGAGAAAGGAACAAACGG - Intronic
1070038128 10:72748009-72748031 GAAGATTAAGTATGAAAAAAAGG - Intronic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1070248911 10:74756495-74756517 GGTGATGAAATAAGTAAACATGG + Intergenic
1070326126 10:75390408-75390430 GAAGAAGAAAGAGGAGAAAAAGG - Intergenic
1071408708 10:85364640-85364662 GATTATGAACTAGGAACCAAGGG - Intergenic
1071736303 10:88304161-88304183 GGTCATCAAATAGGATAAAAGGG + Intronic
1071844214 10:89505077-89505099 GATGCAGAAAAAGGAGAAAATGG + Intronic
1072403230 10:95126589-95126611 GAGGAGGGAAAAGGAAAAAATGG + Intergenic
1072411587 10:95207471-95207493 GATGATGATATATGAGAAAGTGG + Intronic
1072779049 10:98231778-98231800 GATGCTAAAATATGAAAAACGGG - Intronic
1072858285 10:98973838-98973860 AATGAGTAAAAAGGAAAAAAAGG + Intronic
1074178771 10:111038530-111038552 GGTGATGCAATAGGATAGAAGGG + Intergenic
1074295662 10:112185374-112185396 GATGATAAAATAAGAGAACAAGG + Intronic
1074673015 10:115816920-115816942 TTTGATGAAATAGAAAAATAAGG - Intronic
1075644005 10:124085864-124085886 GATGATGAAGTAGGCAAATGTGG + Intronic
1076593157 10:131605138-131605160 GGTGAAGATATGGGAAAAAAAGG + Intergenic
1076940757 10:133605782-133605804 GCTGCTGAAACAGGAAAAACTGG + Intergenic
1077723877 11:4654084-4654106 GAAAATTAAATAGGAAAAACAGG - Exonic
1077743815 11:4878589-4878611 TATGATGAAGTGGGATAAAAGGG - Intronic
1077775798 11:5270182-5270204 GATGATGAAGAGGGTAAAAAAGG - Intronic
1077859958 11:6169258-6169280 GAAGATGAAATAGAAAGAAGAGG + Intergenic
1078920364 11:15825187-15825209 GATGAGGAATTAGGGGAAAAAGG - Intergenic
1078952441 11:16149507-16149529 GAAGATGAAATAGGAATTTATGG - Intronic
1079192715 11:18294243-18294265 GATAATGAAAAAGAAAACAAGGG - Intronic
1079468166 11:20752907-20752929 GTAGAAGAAAAAGGAAAAAATGG + Intronic
1080484937 11:32696089-32696111 GCTGATGAAACAAGAAATAAAGG - Intronic
1080706194 11:34696567-34696589 GAAAATGAAACAGGAAAAATAGG - Intergenic
1080760144 11:35240775-35240797 AATGGTGAAATAGGAGGAAAGGG - Intergenic
1080834471 11:35927720-35927742 GATGGTGATAAAGGCAAAAATGG + Intergenic
1080858925 11:36136297-36136319 AATTGTGAAATAGGAAAAACAGG - Intronic
1081158900 11:39729277-39729299 ATTTATTAAATAGGAAAAAAAGG - Intergenic
1081240092 11:40694870-40694892 GATGATGATAAAAGAAAATAAGG - Intronic
1081267651 11:41046073-41046095 GATGATGCAAATGGAAAATATGG - Intronic
1081283260 11:41237347-41237369 GATACTAAAATAAGAAAAAAGGG + Intronic
1081542676 11:44047666-44047688 TTTGGTTAAATAGGAAAAAAGGG - Intergenic
1081649571 11:44814879-44814901 GATGATGAAATATGATAAGATGG + Intronic
1081782920 11:45725918-45725940 GAAGATTAAATAAGAAAACATGG - Intergenic
1081804059 11:45880522-45880544 GATGGAGAATCAGGAAAAAATGG - Intronic
1082668238 11:56002244-56002266 AATGATCAAAAAGGAAAAGAAGG + Intergenic
1082778070 11:57263299-57263321 GAAAAAGAAAAAGGAAAAAAGGG - Intergenic
1083906365 11:65674140-65674162 CATGATGAAACAGAAAAAAGTGG - Intergenic
1084551342 11:69844535-69844557 GATGGTGAAGTTGGTAAAAATGG + Intergenic
1085118100 11:73948233-73948255 GATAGTCAAATAGAAAAAAATGG + Intergenic
1085543259 11:77292608-77292630 GATAATTAAATAGAAAAAATAGG + Intronic
1085549777 11:77358149-77358171 GATCATGAAAGAAAAAAAAAAGG - Intronic
1085930598 11:81078349-81078371 GATTATGATATAGGAAAAGCTGG - Intergenic
1086297456 11:85386770-85386792 GATAGTGAAAAAAGAAAAAAAGG + Intronic
1086371679 11:86161737-86161759 GATGATTAAATGAGAAAAAAAGG + Intergenic
1086392412 11:86379070-86379092 TATGCTGAAAAAGGAGAAAATGG - Intronic
1086853310 11:91837248-91837270 GATGCAGAGATAGGAAAATAGGG + Intergenic
1087221258 11:95548785-95548807 GATGAGAAAAATGGAAAAAAGGG + Intergenic
1087439132 11:98160713-98160735 GATGATGAAGTGAGAAGAAAGGG + Intergenic
1087468591 11:98542553-98542575 GATGAAGAAAGTGGAAAAACAGG - Intergenic
1088072615 11:105809077-105809099 GATGTTAAAATAGGGAAAACTGG + Intronic
1088523384 11:110724812-110724834 TATGATGAAAAAAGAAAAAAAGG - Intergenic
1089236189 11:117028248-117028270 CATGCTGAAAAATGAAAAAAGGG - Intronic
1089380038 11:118023344-118023366 AATAATAAAATAGAAAAAAAGGG - Intergenic
1090177119 11:124660569-124660591 GGTGATGAAGAAGGAAAAGAAGG - Intronic
1090502976 11:127279748-127279770 GAGGAAGAAAAAGGAGAAAAAGG - Intergenic
1090590922 11:128266996-128267018 GATGATGAAATGTTCAAAAATGG - Intergenic
1090684619 11:129101179-129101201 GGTCATCAAATAGGATAAAAGGG + Intronic
1092664062 12:10774463-10774485 GATAATGAAGTAGAAAACAAAGG + Intergenic
1093254761 12:16853573-16853595 GATGAAGAAAAGGGAGAAAAGGG + Intergenic
1093301171 12:17457917-17457939 GAGGATGAAAAAAAAAAAAAAGG - Intergenic
1093645201 12:21578212-21578234 GATGATAATGTAGGACAAAATGG - Intronic
1093659869 12:21743775-21743797 TATGAAGAAACAGGAAAACATGG - Intronic
1093679578 12:21986328-21986350 GATGAGGAAATATTAAAAATGGG + Intergenic
1093710582 12:22325676-22325698 TAGGAAAAAATAGGAAAAAACGG - Intronic
1093843427 12:23935304-23935326 GATGATGAATTGGTAAATAATGG - Intronic
1094347485 12:29486674-29486696 GAAGATGAACTAGAAAAAATAGG + Intronic
1095197425 12:39336838-39336860 GATGATGACATAGAAGTAAATGG - Intronic
1095643278 12:44509988-44510010 GGTGATGAAATAGGATAAATAGG + Intronic
1095948705 12:47768868-47768890 GATGATGTATTAGGATAATAAGG + Intronic
1096661539 12:53128272-53128294 GAAGAAGAAAAAGGAAAAAAAGG - Intergenic
1097089003 12:56490364-56490386 GAGGCAGAAATAGGAAAAAAAGG - Intergenic
1097463891 12:59898697-59898719 GGTTATGAAAAAGAAAAAAATGG - Intergenic
1097514387 12:60586225-60586247 GGTATTCAAATAGGAAAAAAAGG + Intergenic
1098097395 12:66973358-66973380 AAGAATGAAAAAGGAAAAAAGGG - Intergenic
1098783152 12:74714033-74714055 TATGAAGAAAGAGCAAAAAAGGG + Intergenic
1099265346 12:80439404-80439426 GAAGAGGAAATGGGAAAAGATGG + Intronic
1099316206 12:81085092-81085114 AATTATGAAATAGGAATGAAGGG + Intronic
1099419790 12:82442555-82442577 GTTGCTGAAGTAGGAAAAGAGGG + Intronic
1099474973 12:83097015-83097037 AATGCTGAAATAGAAAAACATGG - Intronic
1099516573 12:83604049-83604071 GAAAATGTAACAGGAAAAAAAGG - Intergenic
1099589103 12:84563663-84563685 CAAGATGAAATAGGTAAAACTGG + Intergenic
1099837066 12:87920307-87920329 GCAGAAGAAATAGGAAAACAGGG - Intergenic
1100113212 12:91270800-91270822 TATGATGGTATAGGAAAAAAGGG + Intergenic
1100116338 12:91309308-91309330 AATGATGAAAAAAAAAAAAAAGG - Intergenic
1100146217 12:91681029-91681051 GATGACGAAACAAGATAAAAAGG - Intergenic
1100191730 12:92200274-92200296 GATAATGGAATGGGAAACAAAGG + Intergenic
1100684049 12:96966051-96966073 GTTGCATAAATAGGAAAAAATGG + Intergenic
1101158793 12:101953042-101953064 GCAGATGAATTAGAAAAAAATGG + Intronic
1101389698 12:104289292-104289314 GAAGGGGAAATAGGAGAAAAAGG - Intronic
1101580573 12:106037980-106038002 GAGGAAGAAAAAGGAAAGAAAGG - Intergenic
1103033445 12:117636966-117636988 GGTAATTTAATAGGAAAAAATGG + Intronic
1103220034 12:119236371-119236393 AATAATGCAAGAGGAAAAAATGG + Intergenic
1103412755 12:120724550-120724572 GATGAAGAAGCAGGAGAAAAGGG - Intergenic
1103675243 12:122650787-122650809 GAAGAGGAAAGAGGAAGAAATGG - Intergenic
1104375675 12:128264256-128264278 AATGAGGAAGAAGGAAAAAAGGG - Intergenic
1104434492 12:128744989-128745011 GAAGATGAAATAAGACAGAAAGG + Intergenic
1105724187 13:23144808-23144830 GATTATGAAATTTGAGAAAAAGG + Intergenic
1105834007 13:24192799-24192821 GAGGGTGACATGGGAAAAAAAGG + Intronic
1106460456 13:29963632-29963654 GATGGTAAAATGAGAAAAAATGG + Intergenic
1106700880 13:32227481-32227503 GATTATTAAATAGGGGAAAAGGG + Intronic
1106721793 13:32442100-32442122 GAGGATGAAGCAGGCAAAAAGGG - Intronic
1107072535 13:36286631-36286653 GATGATGAAGTTGGAAAAAAGGG - Intronic
1107191890 13:37598473-37598495 TATAAAGTAATAGGAAAAAAAGG - Intronic
1107436499 13:40385054-40385076 GTTCATAAAAAAGGAAAAAAAGG - Intergenic
1107762965 13:43701426-43701448 CATAAAGAAATAGGTAAAAAGGG - Intronic
1108094339 13:46884738-46884760 GATGATTAAATTAGAAAGAATGG - Intronic
1108483606 13:50901678-50901700 GAAAATAAAATAGTAAAAAAAGG + Intergenic
1108880496 13:55108317-55108339 AATGATGAACTAGCTAAAAAAGG + Intergenic
1109148483 13:58813794-58813816 AATGATGAAATAAGAATTAATGG - Intergenic
1109671482 13:65614149-65614171 AATGATAAAAAGGGAAAAAATGG - Intergenic
1110179708 13:72601085-72601107 GATGATAAAATAGGGAAATGAGG - Intergenic
1110592040 13:77274672-77274694 GATGATGAGATAGGGAAAAGTGG - Intronic
1110704101 13:78585627-78585649 GAGAATGAAATTGGAAAAGAAGG - Intergenic
1110771467 13:79352968-79352990 GCTGATGCAAAAGTAAAAAAAGG + Intronic
1110835449 13:80076852-80076874 GATCATAGAATAGAAAAAAAAGG + Intergenic
1111048021 13:82841686-82841708 GATGCTGAGAAAGGAAAAAGAGG + Intergenic
1111088805 13:83414702-83414724 GATGGTGTAATTGGAAAAGATGG - Intergenic
1111191653 13:84816005-84816027 GATGATTAATTAACAAAAAAGGG - Intergenic
1111277942 13:85976235-85976257 GAAGTAGAAATAGGAAAAATAGG + Intergenic
1111484586 13:88879913-88879935 CATGATGAATAAGGAAAAAGAGG - Intergenic
1112127196 13:96481034-96481056 GGTTATGAAATAGAAAATAAAGG - Intronic
1112151023 13:96764315-96764337 TCTGATGGAAAAGGAAAAAAAGG + Intronic
1113314877 13:109168144-109168166 GGGGATAAAATAGGAAAAATAGG + Intronic
1114744337 14:25131664-25131686 AAATATAAAATAGGAAAAAAAGG - Intergenic
1114972666 14:28053320-28053342 GATGATGAGATAAAAATAAATGG - Intergenic
1114976230 14:28103781-28103803 GAAGAAAAAATTGGAAAAAAAGG + Intergenic
1115605498 14:34997779-34997801 TATGAGGAACTAGGAAAAAAAGG - Intronic
1115662434 14:35510589-35510611 GATAATTAAAAAGGAAAAAGTGG - Intergenic
1115726536 14:36223312-36223334 GATAAGGAAAGAGGAAAGAAAGG + Intergenic
1116251967 14:42497801-42497823 CATGAAGAAATTGGAATAAATGG + Intergenic
1116402801 14:44529451-44529473 GATGATGCATTTGGAAAAACTGG + Intergenic
1116479456 14:45381428-45381450 GATGATGAATGAGAATAAAATGG + Intergenic
1116498707 14:45594007-45594029 GCTGATGAAAAAGGCAAGAATGG + Intergenic
1116507000 14:45695867-45695889 GCAGATGCAATATGAAAAAAAGG - Intergenic
1116735059 14:48678912-48678934 AATGATGAAATAGAAAATAATGG - Intergenic
1116754028 14:48923111-48923133 GATGATGACACAGGAATGAAAGG - Intergenic
1116920260 14:50564935-50564957 GAAGATGAGGTAGGTAAAAAGGG - Intronic
1116948959 14:50861284-50861306 GAGCAAGAAATAGGAAAAATTGG - Intronic
1117924365 14:60762092-60762114 ATTGATGTAATAGGAAAAGAAGG - Intronic
1117984022 14:61369546-61369568 GAAAATGAAATAGGAAATCAAGG - Intronic
1118160790 14:63288160-63288182 GATAATGAAATAGCAGATAAAGG - Intronic
1118459222 14:65973590-65973612 GAAGATTAAAGAGGAAGAAATGG + Intronic
1118990270 14:70791412-70791434 GGTGATGAAATAGGAAGAAGAGG + Intronic
1119409976 14:74424574-74424596 GATGATGGAAGAGGAGAAGAAGG + Intronic
1120539969 14:85739286-85739308 GATGAAGAAATTTCAAAAAATGG + Intergenic
1120826644 14:88962212-88962234 GATGATGAGAAAGGAGAAGAGGG + Intergenic
1120993016 14:90395317-90395339 GATAAGGAAATAGAAGAAAAGGG - Intergenic
1120999454 14:90440977-90440999 GATGATGAAAAAGAAAAAAATGG - Intergenic
1121178813 14:91911781-91911803 GAGGATGCAAAAGGAAAAGACGG + Intronic
1121613431 14:95296621-95296643 GATGATGAAGAAGGATCAAAGGG - Intronic
1121849156 14:97203675-97203697 GATGATTAAATAAGTAAACATGG - Intergenic
1121927650 14:97943549-97943571 GATGGAGACATAGGAAATAATGG - Intronic
1122461437 14:101898852-101898874 AATGCTGAAATAAGACAAAATGG - Intronic
1122643109 14:103173121-103173143 GCTGCTGAAACAGGAAAAACTGG + Intergenic
1122663770 14:103315217-103315239 GAAAATGAAAAAGGAAAAGAAGG + Intergenic
1123930591 15:25169734-25169756 GATGAGGAAAAAGCATAAAACGG + Intergenic
1124144312 15:27108947-27108969 CATAATAAAATAGGCAAAAAGGG + Intronic
1124643716 15:31419257-31419279 TGTGAAGAAATAGGGAAAAATGG + Intronic
1124949634 15:34305301-34305323 GAAGAAGAAAAAGGAACAAATGG - Intronic
1125297403 15:38217928-38217950 GAAGATGAGATTGGAATAAAAGG + Intergenic
1125708043 15:41759122-41759144 GTTGATGAAATAAGAAATTAAGG + Intronic
1125976435 15:43956906-43956928 GATGATAGAATTGGAAGAAATGG - Intronic
1126034359 15:44533319-44533341 AATGAGGAAACAGGAAAACAAGG - Intergenic
1126155840 15:45564997-45565019 GATAATGAAAGAGGATAAATAGG + Intergenic
1126357462 15:47811708-47811730 AATGAGGACATAGGAGAAAAAGG - Intergenic
1127020833 15:54746522-54746544 GATGATGGATTAAGAAAATATGG + Intergenic
1127668509 15:61172130-61172152 GATGAAGAAACAAAAAAAAATGG + Intronic
1127827900 15:62721722-62721744 GTTTATTAAATTGGAAAAAATGG + Intronic
1128009633 15:64280660-64280682 GAAGATAAAATATGAGAAAAGGG - Intronic
1129628620 15:77233046-77233068 GATGATGCAAAAGAGAAAAAAGG - Intronic
1130852815 15:87813866-87813888 GATGTCCATATAGGAAAAAATGG + Intergenic
1130936123 15:88472255-88472277 GTTGATGAAATAAGAAACAGAGG + Intronic
1130953988 15:88613941-88613963 CATCCTGAAATAGGAAAAAATGG + Intergenic
1133874762 16:9723296-9723318 GATGGAGAAATAGGAAGAGAAGG + Intergenic
1133954942 16:10434323-10434345 GGTAGTGAAATAGGAAAACATGG - Intronic
1134017123 16:10896585-10896607 TATGTTGAAATAGAAAAAAGTGG + Intronic
1134071556 16:11263258-11263280 AATCATCAAATAGGCAAAAATGG - Intronic
1134180222 16:12042021-12042043 AATAATGAAATAAGAAAAAAAGG - Intronic
1135306971 16:21375772-21375794 AATAATGAAATAAGAAAAAAAGG - Intergenic
1135382484 16:22006829-22006851 GATGAATAAACAGGAAAATAAGG - Intergenic
1135395275 16:22126583-22126605 CAAGATGAAATAGGAAGAAGAGG + Intronic
1135505810 16:23035121-23035143 GAAGATGAAAGAAGAGAAAAGGG + Intergenic
1136303714 16:29354912-29354934 AATAATGAAATAAGAAAAAAAGG - Intergenic
1136967480 16:34931847-34931869 TATGATTTAACAGGAAAAAAAGG + Intergenic
1137770470 16:51012370-51012392 GATGTTGAAAGAGGAGAAAGTGG - Intergenic
1137849622 16:51726971-51726993 GAGGAGAAAACAGGAAAAAATGG + Intergenic
1138078704 16:54068219-54068241 GAAAATGAGAAAGGAAAAAAAGG - Intronic
1138843830 16:60540683-60540705 GAAGATGAAGTGGGAAGAAAAGG + Intergenic
1138972470 16:62162162-62162184 GATGCTGAAATAGGGGAAAATGG - Intergenic
1139180427 16:64741471-64741493 GAGAATGCAATGGGAAAAAAAGG - Intergenic
1139596792 16:67962839-67962861 AATGAAGAAAGAGAAAAAAAAGG + Intronic
1141347729 16:83262657-83262679 TATAAAGAAATATGAAAAAATGG + Intronic
1141776629 16:86127495-86127517 GGTGAGGAAATAGAGAAAAAAGG - Intergenic
1142590366 17:1002366-1002388 GATGAGGAAGAAGGCAAAAAAGG - Exonic
1142705714 17:1692767-1692789 GATGAAGAAAAAGAAAAACACGG - Intergenic
1142765584 17:2062396-2062418 CATGATGCTGTAGGAAAAAAAGG - Intronic
1143281248 17:5756115-5756137 AATAAATAAATAGGAAAAAAAGG - Intergenic
1143433114 17:6901388-6901410 TCTGATGTAATGGGAAAAAAAGG + Intronic
1144141236 17:12350549-12350571 GAGGAGGAATTAGGAGAAAAGGG - Intergenic
1144347228 17:14360223-14360245 GAGGATGAAATAGAACAAAAAGG - Intergenic
1144372712 17:14607317-14607339 AAGGATGAAATAGAAAAAGATGG + Intergenic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1148070548 17:44906237-44906259 GATGCTGAAACAGGAGAGAAAGG - Intronic
1148559081 17:48595701-48595723 GTTGAGGAGAGAGGAAAAAATGG + Intronic
1148629350 17:49094595-49094617 CAAGATTAAATAGGAAAGAATGG - Intergenic
1149150101 17:53551480-53551502 GATGATGAATGAGTAATAAAAGG + Intergenic
1149914768 17:60599222-60599244 GATGAAGAAATGGCCAAAAACGG + Intergenic
1150378249 17:64700173-64700195 GAGAAAGAAAGAGGAAAAAAGGG - Intergenic
1150533210 17:66007937-66007959 AATTAGGAAACAGGAAAAAACGG - Intronic
1150763264 17:67981327-67981349 GATCATAAAATGGGAAAATATGG - Intronic
1150843385 17:68630634-68630656 GATGTTAAAATATGAAAAATAGG - Intergenic
1151273515 17:73015237-73015259 GATGATGAAAATGGAAAGGAAGG - Intronic
1151588508 17:75026890-75026912 GCTGCTGAAACAGGAAAAACTGG + Intergenic
1153234847 18:2976108-2976130 GAGGATGAGATGGGAAATAAGGG - Intronic
1153374131 18:4356449-4356471 ATTGTTGACATAGGAAAAAACGG - Intronic
1154133768 18:11758870-11758892 ATTTATGAAATAGGAAAAATAGG + Intronic
1154928344 18:20963638-20963660 GATGATGGATTAGGAAAACTTGG - Intronic
1155055889 18:22183478-22183500 GATGATAAAAAAAGAAAAAAAGG - Intronic
1155246701 18:23917498-23917520 GAGGTTGAAAGTGGAAAAAAGGG - Intronic
1155359585 18:24986613-24986635 AAAAATGAAACAGGAAAAAAAGG + Intergenic
1155396980 18:25396773-25396795 GATGAGGATATAGAAAAAACTGG + Intergenic
1155644935 18:28065686-28065708 GACAATGAGAGAGGAAAAAAGGG - Intronic
1155975068 18:32119835-32119857 GATTATCAAACAGGAAAAAAAGG - Intronic
1156207713 18:34904547-34904569 GATTTTTAAATAGAAAAAAAAGG + Intergenic
1156435957 18:37129939-37129961 GTTGATGAAATAAGAAATAAAGG + Intronic
1156697824 18:39788847-39788869 CATTATGAAATAAGAAAAAAAGG + Intergenic
1156731889 18:40204410-40204432 GATTATGAAATTTGAAACAACGG + Intergenic
1156791529 18:40980569-40980591 AATGATCAAATAGGGAGAAATGG + Intergenic
1157014100 18:43688779-43688801 GAGGAGGATAGAGGAAAAAAAGG - Intergenic
1157971218 18:52271320-52271342 CAAAATGAAATAGGAAAATAAGG - Intergenic
1158082640 18:53612058-53612080 GAGGAAGAAAAAGGAAAAAGAGG + Intergenic
1158140591 18:54251239-54251261 TATGAGGAAAGAGGAAAAACTGG + Intergenic
1158506315 18:58049067-58049089 GAAGTTGAAATATGAGAAAAAGG + Intronic
1158928955 18:62302197-62302219 GATGATAAAATACAACAAAATGG + Intronic
1159089685 18:63833657-63833679 GAAGATGAAACAGAAAAAAAAGG + Intergenic
1159151435 18:64528393-64528415 GATGGTGAGATAGGAAATCAAGG - Intergenic
1159202468 18:65205033-65205055 ATTAATGAAATAGAAAAAAATGG + Intergenic
1159259904 18:66001022-66001044 TATGATTGAATAGGAAAAAGAGG + Intergenic
1159310027 18:66695742-66695764 GAAGATGAAAAAAGAACAAAGGG - Intergenic
1159756037 18:72367304-72367326 AGTGATTAAATAGGAAAAAAGGG + Intergenic
1159828726 18:73247127-73247149 GATGATGGAATAGTTAAAAATGG + Intronic
1160051371 18:75437202-75437224 GATGAATAAATAAAAAAAAAGGG + Intergenic
1161377420 19:3947147-3947169 AAAGAAGAAAAAGGAAAAAAGGG + Intergenic
1161463213 19:4411578-4411600 GAAGATGAAAAAGGAAAAAATGG + Intronic
1162181198 19:8870222-8870244 GATGATGAGAAAGGACTAAATGG + Intronic
1163397731 19:17074048-17074070 CCTGATGTAATAGGAAAGAAGGG + Intronic
1163940544 19:20488892-20488914 GAAGAAAAAATAAGAAAAAAGGG - Intergenic
1164014910 19:21246403-21246425 GCTGTTGAAATGGGAAAATATGG - Intronic
1164250102 19:23468536-23468558 GAAGAAGAAAGAGGAAAGAAAGG - Intergenic
1164449607 19:28349482-28349504 GATCCTGGAATAGAAAAAAAAGG + Intergenic
1164670427 19:30069240-30069262 GATGATGCAAGAGGAAAAGCTGG + Intergenic
1165732642 19:38156259-38156281 GCTGAGGAAAAAGGAAAAAAGGG - Intronic
1166477518 19:43141433-43141455 GATGCTGAAATGAAAAAAAAAGG - Intronic
925252038 2:2447480-2447502 GATGAATCAATAGAAAAAAATGG + Intergenic
925437321 2:3850952-3850974 GAAGATGAAAGAGGAAGCAAAGG - Intergenic
925689516 2:6506721-6506743 GATGATGAGCTAAGAAGAAAAGG + Intergenic
926800474 2:16655698-16655720 GATTATGAAAGAGAAAAGAAAGG - Intronic
926926960 2:17996607-17996629 GAGGAGGAAAAAGGAAAAAGAGG - Intronic
927004998 2:18839366-18839388 CATGATGAAATAGCAATCAATGG - Intergenic
928071847 2:28224971-28224993 AATGATGAAGTTGCAAAAAAAGG + Intronic
928379829 2:30808170-30808192 AATGATAAAATAGGTAAAACAGG + Intronic
928798661 2:35058362-35058384 GCAGATAAAATAGGAAAAGAGGG - Intergenic
928914057 2:36452947-36452969 GATGATGACATAGCAAAAGAGGG - Intronic
929249177 2:39733944-39733966 GATGATGAAATAGGAAAAAAGGG - Intergenic
929422181 2:41803568-41803590 GAGGGTGAAATTGGAAAAACTGG + Intergenic
930115900 2:47718009-47718031 GTTGAAGATATAGGAGAAAAGGG + Intronic
930161742 2:48165558-48165580 AATGATGACATAGAAAGAAAAGG + Intergenic
930392763 2:50783008-50783030 GGTGGTGAAAGGGGAAAAAATGG - Intronic
930692520 2:54379279-54379301 GATCATAAAACAGGCAAAAAAGG + Intronic
930883291 2:56296222-56296244 GCTGTTAAAATAGCAAAAAAGGG - Intronic
931241647 2:60459505-60459527 GATGATTAACTAGGACATAATGG + Exonic
931537364 2:63293489-63293511 TATAATGAAATAGGAAAGTATGG + Intronic
931653682 2:64490851-64490873 GATGAGGAAACAGGCAATAAAGG - Intergenic
932207735 2:69898331-69898353 GATGAGGGAAGAGGAAAAAGAGG + Intronic
932546051 2:72711275-72711297 GAAAATGGAATAGGATAAAATGG + Intronic
932754083 2:74393000-74393022 GAAGGTGAAATAGGGAAAAGGGG - Intergenic
932969288 2:76519837-76519859 GAGGATGAAAAAGGCAAAACCGG + Intergenic
933144484 2:78834734-78834756 GACGATGGAATAGAAAATAATGG - Intergenic
933144562 2:78835808-78835830 GGTGATGAATTAGGTAAGAAAGG - Intergenic
933293506 2:80463955-80463977 GAAGATGAAAAAGGAGAATAGGG - Intronic
933356269 2:81212833-81212855 TATGATGAAATATTATAAAAGGG - Intergenic
933408723 2:81897244-81897266 GTTTCTGATATAGGAAAAAATGG - Intergenic
933561647 2:83894673-83894695 AATGATCAAATAAGAAATAAGGG - Intergenic
933680584 2:85096419-85096441 AAAGAAGAAAAAGGAAAAAAGGG - Intergenic
934063611 2:88319859-88319881 AATGTTCAAATAGTAAAAAAGGG - Intergenic
934167598 2:89308943-89308965 GATGATGTAATATGTAAACAAGG + Intergenic
934199686 2:89873640-89873662 GATGATGTAATATGTAAACAAGG - Intergenic
934934673 2:98456219-98456241 AATGATTAAAAAGAAAAAAAGGG + Intronic
934995895 2:98959725-98959747 GAGGATGAATTAGTGAAAAATGG + Intergenic
935059810 2:99597567-99597589 GATGATAATAAAGGAATAAATGG - Intronic
935434544 2:103014989-103015011 GAGAAGGAAATAGGAACAAAAGG - Intergenic
936741203 2:115511688-115511710 GAAGAAGAAAGAAGAAAAAAGGG - Intronic
937723860 2:125135812-125135834 GATGATGAGATAGAAAACACTGG - Intergenic
938213865 2:129491646-129491668 GGTAAAGAAAAAGGAAAAAAGGG + Intergenic
938370512 2:130765321-130765343 CATGAAGAAATAGGTCAAAATGG + Exonic
938758801 2:134405135-134405157 GATTAGGAAATAGGCCAAAACGG + Intronic
939715234 2:145575642-145575664 CATGAGGATTTAGGAAAAAATGG + Intergenic
940037126 2:149322710-149322732 GCTGCTGAAACAGGAAAAACTGG + Intergenic
940687547 2:156872700-156872722 GACACTGAAATAGGAAAAATAGG + Intergenic
940880960 2:158946272-158946294 AAAGAAGGAATAGGAAAAAATGG + Intergenic
941116452 2:161478134-161478156 GAATTTGAAATAGGAAAAGAGGG - Intronic
941622391 2:167792909-167792931 GATGAAGAAGGAGGAAATAAAGG + Intergenic
941722396 2:168825796-168825818 GATGATGAAAGAGATAAGAAGGG + Intronic
942032871 2:171980447-171980469 GACGACGAAGTGGGAAAAAAGGG - Intronic
942403972 2:175633466-175633488 GATGAGGGAAGAGGAATAAAAGG - Intergenic
943018520 2:182544806-182544828 AAAGATGAGACAGGAAAAAAGGG - Intergenic
943260085 2:185648409-185648431 GGTTATGAAACAGAAAAAAATGG - Intergenic
943389661 2:187248920-187248942 CAAGATGAAATTGGAAAAATTGG - Intergenic
943587107 2:189754144-189754166 AATAATGAAAAAGGAAAAAGAGG - Exonic
944072221 2:195684630-195684652 GATTATAGAATGGGAAAAAAAGG - Intronic
944433503 2:199661206-199661228 GTTAATGTAACAGGAAAAAAAGG - Intergenic
944529351 2:200652062-200652084 GATCACAAAATAGGAACAAATGG + Intronic
944679539 2:202064570-202064592 GATGAGGAAAAAGAAAGAAATGG - Intergenic
945051971 2:205832612-205832634 GAAAATGAAAAAGGAAGAAAAGG + Intergenic
945129427 2:206553075-206553097 GATGTTTAAAAAGGAAAAAAAGG + Intronic
945425924 2:209701912-209701934 AATTAAGAAATAGGAAGAAAAGG - Intronic
945560480 2:211333390-211333412 GATGAGGAAATAGTAATAACAGG + Intergenic
945780147 2:214160484-214160506 CCTGATGAAAAAGAAAAAAAAGG - Intronic
945859123 2:215100434-215100456 GATGTTTAAAAAGGAAAAGATGG - Intronic
946036044 2:216743120-216743142 GTTGAAGAATTAGGAAAAACTGG - Intergenic
946750627 2:222892531-222892553 TATTATGAAATAGGAAACCAGGG - Intronic
947044547 2:225966434-225966456 GATAGGGAAATAGGAACAAAAGG - Intergenic
947106465 2:226673073-226673095 GAAGAAGAAATAGGAGAAGAGGG - Intergenic
947353141 2:229267285-229267307 GAGGATGAAAAAGGAAGTAATGG + Intronic
947896941 2:233683552-233683574 GAAGATGTAATAGCAAAAGAAGG - Intronic
947967503 2:234293952-234293974 GATGATGAAATTCTAAACAAGGG - Intergenic
948499951 2:238384760-238384782 GATGAAGAAATTTGAACAAAAGG + Intronic
1168880879 20:1205003-1205025 TCTGAGGAATTAGGAAAAAATGG + Intronic
1169478533 20:5955099-5955121 TAGGATGAAATAGAAAGAAAGGG + Exonic
1169761590 20:9101011-9101033 TATCATGAAATATGAAGAAATGG - Intronic
1169858430 20:10127815-10127837 GATGAAGAAATAATAAAGAAAGG - Intergenic
1170127845 20:12985721-12985743 GATGATGAAAGTGGTATAAATGG + Intergenic
1170452172 20:16494848-16494870 GTTGATAAAAAAAGAAAAAAAGG + Intronic
1171226649 20:23447071-23447093 GATGATCAAATAGGATAATGTGG - Intergenic
1171274975 20:23848888-23848910 GATTATGAAAGAGGATGAAATGG + Intergenic
1171879034 20:30603077-30603099 GAGGATGAAACAGCAAGAAAGGG + Intergenic
1172732587 20:37100388-37100410 AATTATGAAAATGGAAAAAAGGG + Intergenic
1173205104 20:40986634-40986656 GATGAAGAAACAGGGACAAAGGG - Intergenic
1173368977 20:42417594-42417616 AATAATGAAATAAAAAAAAATGG + Intronic
1173411453 20:42813994-42814016 GATTAAGTAATAAGAAAAAATGG - Intronic
1173992088 20:47311282-47311304 GATGCTGAAAGATGAAAAGAAGG - Intronic
1174142071 20:48422275-48422297 GAAGATGAAACAAGAAAAAGTGG - Intergenic
1174620298 20:51869138-51869160 GATAAGGATATAGGACAAAAAGG - Intergenic
1174754557 20:53144969-53144991 GAAGATGAGAGAGGAAACAACGG + Intronic
1175112496 20:56658373-56658395 GTTCATGAAATAGGAACAATTGG - Intergenic
1176901731 21:14450472-14450494 AATGATGAAATAGAGAAAACTGG + Intergenic
1177303051 21:19275071-19275093 GATTATGTAATATGAGAAAAAGG - Intergenic
1177326121 21:19591176-19591198 GTTGATCAAAGAGAAAAAAAAGG - Intergenic
1177358696 21:20041058-20041080 GATGGGCAAAAAGGAAAAAAAGG + Intergenic
1177397695 21:20558885-20558907 ACTGATAAAACAGGAAAAAATGG + Intergenic
1177471757 21:21568683-21568705 TATGCTGAAACAGGAGAAAATGG + Intergenic
1178049056 21:28728794-28728816 GATTCTGAAATAGGACACAAGGG + Intergenic
1178243102 21:30925314-30925336 GAGGAAGAGAAAGGAAAAAAGGG - Intergenic
1178245385 21:30945714-30945736 GAAGATGTAGGAGGAAAAAAAGG + Intergenic
1178343722 21:31807513-31807535 GAAGATGGAAGAGGAAAAAGTGG - Intergenic
1178519508 21:33276772-33276794 GATGATGACATTACAAAAAAAGG - Intronic
1178929676 21:36806567-36806589 GATGAAGAAATGGGCAGAAAAGG + Intronic
1179102969 21:38372446-38372468 TATATTGAAATAGAAAAAAAAGG - Intergenic
1180025518 21:45159195-45159217 GAAGATGAAGGAGGAACAAAGGG + Intronic
1180367260 22:11952298-11952320 GATGAAAATATAGGAAAATACGG + Intergenic
1181460101 22:23080831-23080853 GCTGATGACAGAGGTAAAAAGGG - Intronic
1181569663 22:23761430-23761452 GAGGAAGAGAAAGGAAAAAAGGG + Intergenic
1182068194 22:27444975-27444997 GATGGAGAAAGAGGAATAAAGGG - Intergenic
1182917369 22:34047396-34047418 GATGCTGACATATGAAATAATGG + Intergenic
1183239746 22:36648837-36648859 GATGATGGAGTTGGAGAAAAGGG - Intronic
1183609851 22:38892685-38892707 GCTTATGATATAGGAGAAAAAGG + Intergenic
1183755681 22:39761950-39761972 TTTGAAGAAATAGGAAAATATGG - Intronic
1183805526 22:40207240-40207262 GATGATTAAACAGGATAACATGG + Intronic
1183991284 22:41598628-41598650 GAAGAGGAGAAAGGAAAAAAAGG + Exonic
1184424490 22:44401464-44401486 GTTGTGGAAAGAGGAAAAAAAGG - Intergenic
949153277 3:796810-796832 AATATTGAAATAGAAAAAAAAGG + Intergenic
949515412 3:4802875-4802897 GATGAGGAAATAGTAACACATGG + Intronic
949674465 3:6437343-6437365 GAAGATGAGATAGAGAAAAAGGG - Intergenic
950242800 3:11386956-11386978 GATGAGGAAATAGAAGCAAAGGG - Intronic
951070667 3:18325549-18325571 CAGGATGACAAAGGAAAAAAAGG - Intronic
951108135 3:18769555-18769577 AGTGATGCGATAGGAAAAAAAGG + Intergenic
951650817 3:24949427-24949449 GAAGATCAAATAGGAGGAAAGGG + Intergenic
951736084 3:25866309-25866331 AAAGAAGAAATAAGAAAAAATGG - Intronic
952163067 3:30715159-30715181 AATAAAGAAATAGGAAATAACGG + Intergenic
952191104 3:31024426-31024448 TATGATGAAAAATGACAAAATGG - Intergenic
952197135 3:31087778-31087800 AATGATGAAAATGGAAAGAATGG + Intergenic
952208050 3:31200086-31200108 GGTGAAGAGATAGGAAAAAAAGG - Intergenic
952216240 3:31280476-31280498 GATGTTGAGACAGGAAATAAGGG - Intergenic
953123022 3:40064408-40064430 GATGATGCTATATGAGAAAATGG + Intronic
953127608 3:40106886-40106908 GAAGATTAAAAATGAAAAAAAGG - Intronic
953190818 3:40686054-40686076 AATGAAGAAAAAGGAAAACATGG - Intergenic
954468245 3:50670446-50670468 GTTGATAAAATAGGAACAGATGG + Intergenic
954759383 3:52862975-52862997 GAAGCTGAAAGAGGCAAAAAAGG + Intronic
955366042 3:58311045-58311067 GAGGATGAAGGAGGAAAAAAAGG - Intronic
955440729 3:58952107-58952129 GATGATGAATTTGTAATAAATGG - Intronic
955475347 3:59330438-59330460 GAGGAGGAAAAAGGAAGAAAGGG + Intergenic
955830492 3:62996451-62996473 GATGATAAAATCAGAAAAATTGG + Intergenic
955836884 3:63065592-63065614 TATGATGAAATATGATGAAATGG + Intergenic
955853155 3:63242810-63242832 GATGTTTAAATAGGTAAAAAAGG + Intronic
955892036 3:63660446-63660468 GGGGGTGGAATAGGAAAAAAGGG + Intronic
956008571 3:64806282-64806304 AATGATGAATTAGGCAAATACGG - Intergenic
956242411 3:67145277-67145299 GATGATGGAATAGCCAAAAAAGG + Intergenic
956641709 3:71421949-71421971 AATGATAAAATAGGAAACCAAGG - Intronic
957200228 3:77124904-77124926 GAAGAGGAAAAAGGAAAGAAAGG - Intronic
957289883 3:78266476-78266498 AATGATGAAAGAAAAAAAAAAGG - Intergenic
957612146 3:82481971-82481993 GTTGATTTGATAGGAAAAAAAGG - Intergenic
957613127 3:82494633-82494655 GAAGATAAAATAATAAAAAAGGG + Intergenic
957892816 3:86381952-86381974 TAGGATGGAATAAGAAAAAATGG + Intergenic
958186038 3:90120245-90120267 AATGTTAAAATATGAAAAAAGGG - Intergenic
958425051 3:93970267-93970289 GGTGAGGAAATAGGAGAAAGAGG - Intronic
958638237 3:96773361-96773383 TATAATGAAAAAGGAAACAATGG + Intergenic
958995986 3:100905491-100905513 GAAAATGATAAAGGAAAAAAGGG + Intronic
959245940 3:103868128-103868150 GATGAAGAAACAGGAAGAATAGG - Intergenic
959261922 3:104093057-104093079 GATGATGAAAAAGGATTAAAAGG + Intergenic
959265357 3:104130755-104130777 GATGATAACATAGAATAAAAAGG + Intergenic
959307312 3:104684632-104684654 GTTGACCAAATATGAAAAAAAGG - Intergenic
959643661 3:108671835-108671857 AATGAGGAAAATGGAAAAAACGG - Intronic
959870724 3:111324390-111324412 GAGGAGGAAATGGAAAAAAAAGG - Intronic
960223876 3:115147459-115147481 GATGAGGGAAGAGGAAGAAAGGG - Intergenic
960246185 3:115402995-115403017 GATCACCAAAAAGGAAAAAATGG - Intergenic
960328476 3:116326655-116326677 GATGAAGAAATTGAGAAAAATGG - Intronic
960412085 3:117339791-117339813 GAAGAAAAAAGAGGAAAAAAAGG + Intergenic
960522922 3:118676762-118676784 CAAGATGAAGTAGAAAAAAATGG - Intergenic
961849603 3:129802384-129802406 GATGGTGAACTAGGAAACATAGG + Intronic
962071884 3:132042220-132042242 CATGGTAAAATAGGAAAAACAGG + Intronic
962391424 3:134975920-134975942 GATGAGGATATAGGATGAAAGGG + Intronic
962904778 3:139791695-139791717 GATCATGAAATAGGAAGAATGGG + Intergenic
963215268 3:142739302-142739324 GAGGAGGAAACAGGTAAAAAAGG + Intronic
963563483 3:146897783-146897805 AAGCATTAAATAGGAAAAAATGG + Intergenic
963621414 3:147611684-147611706 GAGGAGGAAATAGGAGAAGAAGG + Intergenic
963987817 3:151617372-151617394 GATGAAGAAAGAGAAGAAAAGGG - Intergenic
964812851 3:160684266-160684288 GAAGAGAAAATTGGAAAAAAGGG - Intergenic
964900019 3:161647356-161647378 TAAGATGACAAAGGAAAAAAGGG + Intergenic
965082264 3:164049689-164049711 ACTGATAAAATAGGAACAAAAGG - Intergenic
965135502 3:164761662-164761684 GATGATGAAATAGGAAAATGTGG + Intergenic
965222107 3:165939362-165939384 GATGATGAAATAGCAGTAATTGG + Intergenic
965305244 3:167056486-167056508 AAGAATGTAATAGGAAAAAAAGG + Intergenic
965568626 3:170148781-170148803 GATATTAAAATATGAAAAAAAGG + Intronic
966222712 3:177566532-177566554 GATTATGAAAAAGGAAACAGTGG - Intergenic
966461703 3:180183655-180183677 GTTGGTCAAATAGGAAAAGATGG + Intergenic
966574575 3:181485405-181485427 AACTATCAAATAGGAAAAAAAGG - Intergenic
966599391 3:181760448-181760470 CATGATCAAATAAGTAAAAATGG - Intergenic
966740930 3:183232655-183232677 AATGATCCAATAGAAAAAAATGG + Intronic
967071216 3:185963841-185963863 GACTTTGAAATGGGAAAAAAAGG + Intergenic
967249617 3:187523339-187523361 TATGATAAAATAGAAAAAAATGG - Intergenic
967470505 3:189855834-189855856 AATGATGAAATATTAATAAAAGG + Intronic
967517986 3:190393046-190393068 CATGAAGAAATATGAAATAAGGG + Intronic
967892206 3:194371479-194371501 GAGGATGGAAGAGGAAAAAGAGG - Intergenic
968250612 3:197208264-197208286 GATGAGGACATAGGAAAAACAGG + Intronic
968396755 4:245797-245819 GCTGAAGAAAAAGAAAAAAAGGG - Intergenic
968415468 4:429231-429253 GCTAAAGAAAAAGGAAAAAAGGG - Intronic
968417853 4:455720-455742 GCTGAAGAAAAAGAAAAAAATGG + Intronic
969554525 4:7897235-7897257 GATGATGAATTTTGAAAAACAGG + Intronic
970104440 4:12564849-12564871 CTTCATGAAATAGGAAATAATGG + Intergenic
970122876 4:12776869-12776891 GATGATGAAGTATGAAGAATAGG - Intergenic
970813846 4:20129177-20129199 TATGAAGAAGTAGGAAAATATGG + Intergenic
970973496 4:22014388-22014410 GATGATGAAGCAGAAAATAATGG - Intergenic
971063639 4:23001983-23002005 CATAATGAAATAGGAATTAAGGG - Intergenic
971644518 4:29181386-29181408 TATGGTGAAAGAGAAAAAAAGGG - Intergenic
971696653 4:29912929-29912951 AATGATGAAATTGGTATAAAAGG + Intergenic
971787762 4:31126569-31126591 GAAGAAGAAATAAGAAGAAATGG - Intronic
971864046 4:32145682-32145704 GATTATAGAATGGGAAAAAAAGG + Intergenic
972148957 4:36064896-36064918 GATGATGAGAAAGGAGACAAGGG + Intronic
972243258 4:37217258-37217280 GATGAAGAAAGAGGAGAAACTGG - Intergenic
972645317 4:40962638-40962660 CAGAATGAGATAGGAAAAAAAGG - Intronic
972881253 4:43426020-43426042 GATGATAAAAGAGGAAAAGGAGG + Intergenic
973178624 4:47240896-47240918 GAGGCTGAAAGAGGAAAAATGGG - Intronic
973622390 4:52740698-52740720 GAAGAGGAAATATGAAATAAAGG - Intronic
973909281 4:55563325-55563347 GATGAGAAAACAGGAAAAGAGGG - Intronic
973998844 4:56489293-56489315 GCTGAAGAAATAGCAAATAAAGG - Intronic
974088641 4:57287452-57287474 AATGATTAAATAAGAAAATATGG - Intergenic
974289945 4:59916344-59916366 GATTTTTAAATAGAAAAAAAAGG - Intergenic
974449104 4:62027941-62027963 AATGATGAAATAATAAAGAATGG - Intronic
974514198 4:62887131-62887153 GATGATGAAGTAGAAAGAGAAGG + Intergenic
974554154 4:63421823-63421845 TATTATGAAAGAGGAAAGAAGGG - Intergenic
974897961 4:67961992-67962014 GAATATGAAATATGAAAAACTGG + Intronic
975228168 4:71899164-71899186 AATGAAGAAATGAGAAAAAATGG + Intergenic
975269033 4:72407259-72407281 TATGATGAAATTAAAAAAAATGG + Intronic
975333750 4:73151174-73151196 GGATATGAAATAGGAAAATATGG - Intronic
976168023 4:82275857-82275879 GATGAGGAAATAGGGAAGGAAGG + Intergenic
976566361 4:86554582-86554604 GCTGAGGAAATAGGGAAGAATGG - Intronic
976648012 4:87405697-87405719 GCTGCTGAAACAGGAAAAACTGG - Intergenic
976769083 4:88632011-88632033 GATGATAAGAGGGGAAAAAATGG - Intronic
976953107 4:90858190-90858212 CATCCTGAAATGGGAAAAAATGG + Intronic
977266139 4:94857176-94857198 TCTGATAAAATATGAAAAAAAGG + Intronic
977947915 4:102934962-102934984 GAAAATGAAAAAGAAAAAAAGGG - Intronic
978337047 4:107680701-107680723 GATGATGGAAGATGAAAGAATGG + Intronic
978728254 4:111996158-111996180 GAAGATGGAATAGGAGGAAAAGG + Intergenic
978977050 4:114890474-114890496 GATAATGACATGAGAAAAAAAGG - Intronic
979233501 4:118372666-118372688 GAAGATTAAATAACAAAAAAAGG - Intergenic
979758484 4:124371703-124371725 GGTGATTAAAAAGGACAAAAGGG - Intergenic
979838916 4:125412117-125412139 GTTGAAAAAATAGAAAAAAATGG + Intronic
979855772 4:125632108-125632130 TAGTTTGAAATAGGAAAAAATGG + Intergenic
979908015 4:126321908-126321930 AATTATGAAAAAGGAAAAAATGG - Intergenic
979952326 4:126908304-126908326 TATTATGAAAAAGGAAAACATGG + Intergenic
980104092 4:128570609-128570631 GCTGCAGAAAAAGGAAAAAAGGG - Intergenic
980332569 4:131428344-131428366 GCTAATGAGATAGAAAAAAATGG - Intergenic
980435483 4:132766552-132766574 CATAATGAAACAGGCAAAAAGGG + Intergenic
980603712 4:135061152-135061174 GATGAGAAAAGAGGAAAAATAGG - Intergenic
980752269 4:137107325-137107347 TAGGAAGAAATAGAAAAAAAGGG + Intergenic
980945545 4:139316902-139316924 GTTGATGATAAAGGAAAAAAAGG - Intronic
980948884 4:139351759-139351781 GAGGATGAAATGGAAAAAAGAGG - Intronic
981010048 4:139916221-139916243 GCTCCTGAGATAGGAAAAAAAGG + Intronic
981197352 4:141937141-141937163 GATAATGACATAGGATAAAAAGG + Intergenic
981236691 4:142424793-142424815 GATGGTGAAACAGGAAAAAGAGG + Intronic
981594386 4:146402609-146402631 GAAGAGGAAAGGGGAAAAAAGGG + Intronic
981703941 4:147639911-147639933 GATGTAAAAATAGGAACAAAAGG - Intronic
981807858 4:148737879-148737901 TATGAGGAAATTGGAAACAAAGG + Intergenic
982063609 4:151629791-151629813 GCTGGTGCAATAGGATAAAACGG - Exonic
982524723 4:156463893-156463915 AATGAGGAAATAGAAAGAAAAGG - Intergenic
983294678 4:165851266-165851288 AATGATTTAAGAGGAAAAAAGGG - Intergenic
983672091 4:170249138-170249160 GGTGAGAAAATAGGAAAAAATGG - Intergenic
983812758 4:172083681-172083703 GAGGATGAAAAAGGAGAAAAGGG - Intronic
983836859 4:172398212-172398234 GATAATGGAACAGGAACAAAAGG + Intronic
984107901 4:175573152-175573174 GATGATTAAATAAGAAAATGTGG - Intergenic
984832425 4:183987997-183988019 AATCATGAAAAAGGTAAAAAGGG - Intronic
985313422 4:188629089-188629111 GATGATCAAATTAGTAAAAAAGG + Intergenic
986198483 5:5559708-5559730 GAAGTTCAAATAGGAAAATAAGG + Intergenic
986229067 5:5844811-5844833 GCTGATGATATAGGAAAGAGTGG - Intergenic
986859419 5:11908768-11908790 CATGATGAAATATGACAAAAAGG - Intergenic
986923134 5:12712608-12712630 GATGATGAAATATATAAAATAGG + Intergenic
987351584 5:17026843-17026865 GAGAAAGAAAAAGGAAAAAAAGG + Intergenic
987386562 5:17335401-17335423 GATAATGAAAAACGAAAGAAGGG + Intergenic
987591258 5:19930153-19930175 GATGAAGAAAACGGAACAAAGGG + Intronic
988007153 5:25430585-25430607 GATGATGATGTAGTAAAAATTGG + Intergenic
988496461 5:31750085-31750107 GATGATGAAGTTGGACAAGAAGG - Intronic
988669113 5:33361999-33362021 GGTGATGAAATACCATAAAAAGG + Intergenic
988709900 5:33762738-33762760 GAAGATGTCATAGGTAAAAATGG - Intronic
988893505 5:35646780-35646802 AATGATGAAAAAGAAAAAAGAGG + Exonic
988948278 5:36229927-36229949 GATGTGGAAATAAGCAAAAAAGG - Intronic
988991274 5:36673161-36673183 GATGATCTAGTAGGAAGAAAGGG + Intronic
989189106 5:38652777-38652799 GATTAAAAAATAAGAAAAAAAGG - Intergenic
989195801 5:38714869-38714891 GATTGAGAAACAGGAAAAAAGGG - Intergenic
989671838 5:43926704-43926726 GACAATGAAAGAGGAAAAGAGGG - Intergenic
990159967 5:52926931-52926953 AATGTTGAAACATGAAAAAAAGG - Intronic
990672715 5:58150645-58150667 GATGGGGATATAGGAAAGAATGG - Intergenic
991049750 5:62260009-62260031 GATGTTGAAATAGGATACACAGG - Intergenic
991163852 5:63538698-63538720 GATGTTTAATTAGGAAAAATTGG + Intergenic
991562773 5:67972146-67972168 CATGAGGAAAAAGGGAAAAATGG - Intergenic
991977226 5:72195263-72195285 GACGGTGAAAAAGGAAACAAAGG + Exonic
992123439 5:73617326-73617348 TATGAAGAAATAGGTAGAAAAGG - Intergenic
992391833 5:76336768-76336790 GATCATGAAGCAGGAAAGAAAGG - Intronic
992642634 5:78781370-78781392 AATGAGGAGATAGGAAGAAATGG - Intronic
992818819 5:80472901-80472923 GCTGAAGAAAAAGGAAACAAAGG + Exonic
993078837 5:83270513-83270535 GAAGTGGAAATGGGAAAAAAAGG - Intronic
993111434 5:83661844-83661866 CATGATGCAATAGGTAAAAATGG - Intronic
993181411 5:84558335-84558357 AAAGATGAAATAAGAATAAAAGG - Intergenic
993291010 5:86070260-86070282 ACTGATCAAATAGGAAGAAAAGG - Intergenic
993424443 5:87745636-87745658 GAGGATGAACGAGGAACAAATGG + Intergenic
993431925 5:87842383-87842405 AATTGTAAAATAGGAAAAAATGG + Intergenic
993642451 5:90421778-90421800 GAAAATGAAATATGAAGAAATGG - Intergenic
993702022 5:91130133-91130155 AAAAATTAAATAGGAAAAAAGGG + Intronic
993723689 5:91345751-91345773 GAAAAAGAAAAAGGAAAAAAGGG - Intergenic
993895700 5:93531017-93531039 GATGTTGAAAAACAAAAAAATGG - Intergenic
993936728 5:94013667-94013689 CATGCCAAAATAGGAAAAAAGGG + Intronic
994455372 5:99999615-99999637 ATTGATAAAGTAGGAAAAAATGG + Intergenic
994596238 5:101840273-101840295 GAGAATGCAATAGGAGAAAATGG - Intergenic
994644583 5:102452206-102452228 GATGAAGAAAAAGGATAAGAGGG + Intronic
994825052 5:104702646-104702668 GGTGATGAAATGGAAAAAAGTGG + Intergenic
995381688 5:111542406-111542428 ACTAAAGAAATAGGAAAAAATGG - Intergenic
995406391 5:111801469-111801491 GATGGTGACATAGAAAAAAGAGG + Intronic
995659858 5:114469271-114469293 GATGGTGAAAGAGAGAAAAAGGG - Intronic
995910489 5:117181116-117181138 TATGAAGAAATAGAAAAACATGG + Intergenic
996199883 5:120658885-120658907 GATGAAGAAATAAAAAAAGAAGG - Intronic
996215300 5:120858681-120858703 GATGGTGAAATAGGAAATAAAGG + Intergenic
996900983 5:128540946-128540968 GATGATGAAAAAGTTAGAAATGG + Intronic
997222183 5:132178621-132178643 GCTGAGGAAAAAGGAAAAAAGGG - Intergenic
997641807 5:135453859-135453881 TAAGATTAAAAAGGAAAAAAAGG - Intergenic
997767582 5:136520328-136520350 ATTGATGAAATAAGATAAAAGGG + Intergenic
998160843 5:139812226-139812248 GAAGAAAAAGTAGGAAAAAAGGG + Intronic
998267668 5:140678218-140678240 GATGATGAAGTAGAAAATGAAGG - Intronic
998410745 5:141909409-141909431 GATGATGAAGAAGGAAGATATGG - Intergenic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
998990868 5:147814778-147814800 TATGATGACATGGGAAAAAATGG + Intergenic
999145942 5:149394205-149394227 CATGAAGAAATAGGTCAAAAAGG + Intronic
999429835 5:151516565-151516587 TATGAGCAAAAAGGAAAAAATGG - Intronic
999899854 5:156074874-156074896 CATGAAGAAATAGGTCAAAAAGG + Intronic
1000223909 5:159239597-159239619 GAAGAAAGAATAGGAAAAAAGGG - Intergenic
1000387921 5:160693199-160693221 GAAGATAAAATAGGTATAAAGGG + Intronic
1000390340 5:160716762-160716784 GATGATGGAACAGAAAAAACGGG - Intronic
1000682419 5:164202128-164202150 TAAGATGAGATATGAAAAAAGGG - Intergenic
1000697578 5:164406801-164406823 GATAATGAAAAAAGAAATAACGG + Intergenic
1000909309 5:167002089-167002111 GAAAAAGAACTAGGAAAAAAGGG + Intergenic
1000975797 5:167762960-167762982 GATAATGGAAAAGGAATAAAGGG - Intronic
1001337485 5:170811516-170811538 GAAGATTAAATGGTAAAAAATGG - Intronic
1001461235 5:171916536-171916558 GATGAAGAACAAGGAAACAAAGG + Intronic
1001681416 5:173559966-173559988 GAAGATGAAAGAGGCAAGAAAGG + Intergenic
1001723591 5:173877279-173877301 GATGATGACTTAGGAAAAACTGG + Intergenic
1001877430 5:175213501-175213523 GATGGTGAAGAAGGAAAGAAGGG - Intergenic
1002063350 5:176639599-176639621 GATGAAGAAAAAGGAAGGAAGGG - Intronic
1002982235 6:2149745-2149767 GACGAGCAAATAGGAAAAGAAGG - Intronic
1003024312 6:2540226-2540248 AACAATGAAATAGGAAAAACTGG - Intergenic
1003577214 6:7308398-7308420 GATACTGAAATAAGAAAATAGGG + Intronic
1004108963 6:12695753-12695775 TTTCATGAAATAGGAAAAAGAGG + Intergenic
1004413532 6:15403571-15403593 GTTTCTGAAATAGGAAAAAAAGG + Intronic
1004787514 6:18985544-18985566 GGTGATGAAATCACAAAAAATGG - Intergenic
1005020108 6:21409585-21409607 GATGATTAAATGAGATAAAATGG + Intergenic
1005025314 6:21457721-21457743 ATTGATGAAAAAGGAAGAAAAGG + Intergenic
1005082120 6:21966563-21966585 GTGGAAGAAAAAGGAAAAAAGGG - Intergenic
1005178319 6:23073592-23073614 AATGATGAAGTAGGAATGAAAGG + Intergenic
1005833806 6:29692354-29692376 GGTGATGAAATTTGAAAGAAGGG - Intergenic
1007643202 6:43359867-43359889 CAGTATGAAATAGGAATAAATGG + Intronic
1007989092 6:46236349-46236371 GGTTAGGAAAGAGGAAAAAAAGG - Intronic
1008240916 6:49110611-49110633 GGGGAAGAAATAGGACAAAAGGG + Intergenic
1008402988 6:51085657-51085679 GAAAATAAAATAAGAAAAAAAGG - Intergenic
1009291994 6:61893956-61893978 GATTGTGAAATATGTAAAAAGGG - Intronic
1009337122 6:62505004-62505026 GAAGAAGAAAAAGGAAAAGAAGG + Intergenic
1009640979 6:66335962-66335984 GAGGCTGCAAAAGGAAAAAAGGG - Intergenic
1009821285 6:68804856-68804878 TACCATGAAATATGAAAAAATGG - Intronic
1009828119 6:68894120-68894142 GATGATGAAGTAATTAAAAAAGG - Intronic
1010386544 6:75286637-75286659 CATGATGATATAGGCAGAAATGG - Intergenic
1010698225 6:79005242-79005264 GATGATAAGATAGGAGAAGAAGG + Intronic
1010812539 6:80316395-80316417 GTCGATGCAAAAGGAAAAAAAGG - Intronic
1010976664 6:82323475-82323497 AATGATGAGAGAGGAAGAAAAGG - Intergenic
1011023558 6:82841129-82841151 GATGTTAAAATAGGAAAAACTGG + Intergenic
1011319256 6:86072018-86072040 AATGAAGTAATAGGAAAACAAGG + Intergenic
1011415888 6:87119884-87119906 GTTGAAGAAAAAGAAAAAAAAGG - Intergenic
1011626699 6:89289007-89289029 AATGATGTCAAAGGAAAAAAAGG + Intronic
1011657774 6:89566960-89566982 GCTCATGAATTAGGAAAGAAAGG - Exonic
1011787919 6:90867154-90867176 GATGTTGATATAGGAGAAAGTGG + Intergenic
1011958704 6:93058043-93058065 GAAGATAAAAGAGGAAACAAGGG - Intergenic
1012728384 6:102846282-102846304 GTTGATGAAATAAGAAATATGGG + Intergenic
1012915596 6:105167102-105167124 GATGTTGAATTAAAAAAAAAAGG + Intronic
1013032963 6:106353981-106354003 TAAGATGAAGTAGAAAAAAAAGG - Intergenic
1013848601 6:114485742-114485764 GATGATGGGAAAGGAGAAAAAGG + Intergenic
1014060362 6:117064548-117064570 GATGATGGAAAAGGGATAAAAGG - Intergenic
1014104327 6:117545951-117545973 GAAGGTGAGATAGGAAATAAAGG + Intronic
1014385435 6:120795274-120795296 GCTGAGGAAAAAGGAAAACAGGG - Intergenic
1015360530 6:132334063-132334085 GATGATGAGATTAGGAAAAACGG - Intronic
1015432606 6:133148811-133148833 GAGGATGGAAGAGAAAAAAATGG - Intergenic
1015568942 6:134602289-134602311 GCTGCTGAAACAGGAAAAACTGG - Intergenic
1015688607 6:135895120-135895142 TGTGATGAAATAAAAAAAAAAGG + Intronic
1016121191 6:140343179-140343201 GGAGTTGAAATAGGAAAAACAGG + Intergenic
1016347374 6:143128989-143129011 GTTTAGAAAATAGGAAAAAATGG + Intronic
1016615700 6:146045827-146045849 AATGATTAAAAAGGGAAAAAGGG - Intronic
1016627752 6:146192248-146192270 TATGTTGAAATAGGATAAATGGG + Intronic
1016831801 6:148441532-148441554 GAGGCTGAAATAGACAAAAAAGG + Intronic
1017581868 6:155873679-155873701 AATTATGAAAAAGAAAAAAATGG + Intergenic
1018210876 6:161480383-161480405 GATGGTGGAATAGGAAAATAGGG - Intronic
1019108236 6:169687398-169687420 GATAATCCAATAGAAAAAAATGG + Intronic
1020512150 7:9070520-9070542 GATCTTGTAAGAGGAAAAAAAGG - Intergenic
1020762004 7:12279363-12279385 TTTGAAGAAATAGGAAAAAAAGG + Intergenic
1020983014 7:15095618-15095640 TATGATGAAATAAGAAATAATGG + Intergenic
1021247725 7:18284449-18284471 GAAGATGAAATAGGAGATAATGG - Intronic
1021391360 7:20096751-20096773 GAGGAAGAAAAAGAAAAAAATGG + Intergenic
1021920285 7:25477971-25477993 GATAATGAAATGGGAACTAAAGG + Intergenic
1022382337 7:29872216-29872238 GATGCAGAAACAGGAAAGAAAGG - Intronic
1022633841 7:32112252-32112274 GATGAAGGAAGAGGAAAATAAGG - Intronic
1023199453 7:37679816-37679838 CAAGATAAAACAGGAAAAAATGG - Intergenic
1024172739 7:46807189-46807211 GATGATGAAATTGGGAATAATGG - Intergenic
1024672601 7:51609665-51609687 GATGAAGAAATAGCACAAAAGGG - Intergenic
1024680837 7:51685669-51685691 GATGATGAAAGAGAAAGAAATGG - Intergenic
1025847204 7:65210940-65210962 GATGAAGAAATAGGAGTCAAGGG + Intergenic
1025897449 7:65716830-65716852 GATGAAGAAATAGGAGTCAAGGG + Intergenic
1026444585 7:70473116-70473138 GATGCTGAAATAGGGAAGACGGG + Intronic
1026455759 7:70571315-70571337 GAGGATCAAAGAAGAAAAAAGGG + Intronic
1027477065 7:78646104-78646126 GAGGATGAAAGAGGAAAATAGGG + Intronic
1027530190 7:79321515-79321537 AAAGATAAAATAGGACAAAAAGG + Intronic
1027824879 7:83099306-83099328 GATTATGAAAGAAAAAAAAATGG + Intronic
1028232943 7:88327322-88327344 AATGATGAAATAGCCAACAAGGG - Intergenic
1028275171 7:88846688-88846710 GAAGATGAAAAACAAAAAAAGGG + Intronic
1028328952 7:89564223-89564245 TTTAATGAAATAGGAAATAACGG + Intergenic
1028407679 7:90493917-90493939 GATTGTGGAATAGGAAAATATGG + Intronic
1028688759 7:93625141-93625163 GATGAAGAAGTAGGAGAAGAGGG - Intronic
1029064218 7:97832402-97832424 CATGATGAAATGGGAAAGAGAGG + Intergenic
1029681592 7:102115034-102115056 GATGATGAAAATACAAAAAATGG - Intronic
1029690979 7:102181258-102181280 GCTGATGAGAGAGGAAGAAACGG - Intronic
1029692017 7:102188835-102188857 AAGGATTAAAAAGGAAAAAAAGG + Intronic
1029929309 7:104353953-104353975 AATGAGGAAATAAGAATAAAAGG - Intronic
1030046979 7:105506235-105506257 GTTCATGAAATAGGAAAAGATGG - Exonic
1030327373 7:108234747-108234769 GATTTTGATACAGGAAAAAATGG - Intronic
1030467225 7:109918478-109918500 GGTGAAGAAATAGGAAAACTGGG + Intergenic
1030513831 7:110517710-110517732 GATGATGAAATTGACATAAAAGG - Intergenic
1030940147 7:115636658-115636680 GATAATGAAACAGGCACAAAGGG + Intergenic
1030956078 7:115854559-115854581 AAGGATGAAGTAGGAAAACATGG + Intergenic
1031105437 7:117535948-117535970 GATTATAAAACAGGTAAAAAAGG + Intronic
1031490872 7:122386339-122386361 GATGATGAAAGAGAACAGAAGGG + Intronic
1031491212 7:122391470-122391492 GATGAGAAATTAGGAAGAAAAGG + Intronic
1031661434 7:124429802-124429824 TATCAGGAAATAAGAAAAAATGG + Intergenic
1031666716 7:124493337-124493359 GATAATGAGAGAGGAAAATAAGG - Intergenic
1031714195 7:125086825-125086847 TTTGAAGAAATAGGAAAGAAGGG + Intergenic
1031866731 7:127045284-127045306 GATAATGAAATAGAAAACAGGGG - Intronic
1031940218 7:127780777-127780799 AATGACCAAATAGGATAAAAAGG - Intronic
1032337104 7:131035369-131035391 GAAGAAGAAAAAGGAAAAGAAGG + Intergenic
1032644846 7:133812110-133812132 GATGATTAGATATGAAAATAAGG + Intronic
1032849127 7:135778038-135778060 AATGATGAAATAGAAAAAACAGG + Intergenic
1032860978 7:135878985-135879007 GAGGAAGAAATAGGAACAATGGG + Intergenic
1032977485 7:137242148-137242170 GATTATTAAATGGGAAAAAAGGG - Intronic
1033190404 7:139273307-139273329 GATGAAGAACGAGAAAAAAATGG + Exonic
1033388591 7:140903919-140903941 CATGATGAAATTTGAACAAATGG + Intronic
1033554370 7:142475758-142475780 GATGACGACACAAGAAAAAATGG - Intergenic
1033556644 7:142493860-142493882 GATGATGACACAAGAAAAAATGG - Intergenic
1033559003 7:142513319-142513341 GATGACGACACAAGAAAAAATGG - Intergenic
1034046670 7:147936642-147936664 GTTGAAGAAAGAGGAGAAAAAGG - Intronic
1034196880 7:149254818-149254840 GATTATAAAACAAGAAAAAATGG - Exonic
1034309896 7:150078212-150078234 GAGGAAGAAATAGAAAAAAAAGG - Intergenic
1034796952 7:154022409-154022431 GAGGAAGAAATAGAAAAAAAAGG + Intronic
1035176131 7:157052476-157052498 GATGATGTATTAGGGAGAAATGG + Intergenic
1035794964 8:2347383-2347405 GATTTTGAAAAAGGCAAAAATGG + Intergenic
1035922081 8:3687944-3687966 GATGATGGAAAAGGAAACAAAGG - Intronic
1036018710 8:4816775-4816797 GATGAAGGAACAGGAAAAGATGG + Intronic
1037159024 8:15744655-15744677 GATGATACCATAGGAAAAGAGGG - Intronic
1037393937 8:18422555-18422577 GATGATGCTATGGGTAAAAAAGG - Intergenic
1038137198 8:24799816-24799838 GATGATGGAATAGGCAGAAGTGG + Intergenic
1038574197 8:28690061-28690083 GTGGCTGAAATAGGATAAAAGGG + Intronic
1038839290 8:31165818-31165840 AATGATGAAATAGTAAAATTGGG + Intronic
1039042201 8:33418384-33418406 GGTGATGATGTGGGAAAAAAGGG + Intronic
1039187403 8:34932639-34932661 AAGGAAGAAAAAGGAAAAAAAGG - Intergenic
1039806383 8:41003453-41003475 GAAGAAGACATAGGAAAAAGAGG - Intergenic
1041248919 8:55915867-55915889 GATGATGATTTCTGAAAAAAAGG + Intronic
1041943645 8:63417537-63417559 GATGATAAAAGAGGACAGAAAGG - Intergenic
1042129498 8:65573466-65573488 AATAATGAAATAGCCAAAAAAGG - Intergenic
1042215189 8:66424113-66424135 TTTGATAAAATAGGAGAAAAGGG - Intergenic
1042305405 8:67325880-67325902 GAATATGAAATATGAGAAAAAGG + Intronic
1042738366 8:72014456-72014478 TATGATGAAAAATGAAACAAAGG + Intronic
1043019043 8:74977704-74977726 AATGATGAAATAAAAAATAAAGG - Intergenic
1043262739 8:78222245-78222267 GATCATTAAATATGAAAGAAGGG + Intergenic
1043494511 8:80785505-80785527 GATAAATAAAGAGGAAAAAATGG - Intronic
1044317947 8:90771519-90771541 GATGATGGAATAGTAAAACTTGG - Intronic
1044375379 8:91464147-91464169 GAAAATGAAAAAGCAAAAAATGG - Intergenic
1044449559 8:92318691-92318713 GCAGACTAAATAGGAAAAAAGGG + Intergenic
1044815850 8:96111474-96111496 TATGATGAAAAGGGAAAAAAAGG + Intergenic
1044935441 8:97289358-97289380 AATGCTGAAATAAGAGAAAAGGG + Intergenic
1045015469 8:97997736-97997758 CATGAGGAAATATGACAAAAGGG + Intronic
1045194531 8:99916914-99916936 GGTGATGAAAGACAAAAAAAGGG - Intergenic
1045220466 8:100194214-100194236 GAAGATGAAGAAGGAAAAAGCGG + Exonic
1045796505 8:106051644-106051666 GATAATGGAAAAGGAAAAGAGGG + Intergenic
1045977406 8:108145348-108145370 GATGAAGAAATATGAAAAGATGG + Intergenic
1046029263 8:108764002-108764024 GTTGATACAAAAGGAAAAAAAGG - Intronic
1046068459 8:109222948-109222970 GAGGAGGAGAAAGGAAAAAAAGG - Intergenic
1046152158 8:110241585-110241607 GTTGATGAACTAAGAAAAATAGG + Intergenic
1046336794 8:112801039-112801061 GAATAGGAAAGAGGAAAAAATGG + Intronic
1046357359 8:113105973-113105995 GATGATGGAATTAGAAAATAAGG + Intronic
1046478755 8:114785320-114785342 ATTGATTAAATAGGAATAAATGG - Intergenic
1046583405 8:116121686-116121708 AATGAAGAAAGAGGAAGAAAGGG - Intergenic
1046736676 8:117783480-117783502 GATGATGGGCGAGGAAAAAAGGG + Intergenic
1046950795 8:120018010-120018032 AATTTTGAAAGAGGAAAAAAAGG - Intronic
1047433182 8:124810442-124810464 GAAGATGAAATAGGTGAAATGGG + Intergenic
1047562706 8:126007118-126007140 GAGGAGGAAGTAGGAAAGAAAGG + Intergenic
1048511108 8:135063704-135063726 GAAGCTGAAAGAGGTAAAAAAGG + Intergenic
1049334232 8:142074144-142074166 AATGATTAAATAGAAAACAAGGG + Intergenic
1049960320 9:732027-732049 TAGGATGAAATAGGAAGACATGG + Intronic
1050085416 9:1959958-1959980 TATGAAGAAATTGGAAAGAATGG + Intergenic
1050158186 9:2690160-2690182 AATGGTGAAAAAGGAAAACAAGG - Intergenic
1050720404 9:8582554-8582576 AATGATATAATAGGGAAAAAAGG + Intronic
1051097392 9:13482284-13482306 GAAGAAGAAAAAGGAAGAAAAGG - Intergenic
1051698153 9:19790362-19790384 AATGATGACATAGGAAAAAGGGG - Intergenic
1052062643 9:23979623-23979645 GATAATAAAATGGGAAAATAAGG + Intergenic
1052392383 9:27895469-27895491 GATGAAGACATAGAAGAAAAAGG + Intergenic
1052695567 9:31872964-31872986 GAAGAAGAAAAAGGAAGAAAAGG - Intergenic
1053479834 9:38408057-38408079 GACGATCAAATTGTAAAAAAAGG - Intergenic
1054509614 9:65960390-65960412 GAAGATGAAAAAAAAAAAAAAGG - Intergenic
1054726473 9:68656898-68656920 GAAGAAGAAAGAGGAGAAAATGG + Intergenic
1055166939 9:73208278-73208300 GAAGATGAGTTAGAAAAAAAGGG + Intergenic
1055258616 9:74405123-74405145 TATAAAGAAATAAGAAAAAATGG - Intergenic
1055710029 9:79050556-79050578 AATGATGAAATAAGAAAGAAGGG + Intergenic
1056162249 9:83908451-83908473 GAAGATGAAAAAGGAAACACAGG - Exonic
1056282724 9:85057667-85057689 AATGAAGAAATAGGAAAAAACGG - Intergenic
1056976511 9:91261080-91261102 GATGATGGAATTGGCAGAAAAGG - Intronic
1057610220 9:96536091-96536113 GGAGCTGAAATAGGAAAAAATGG + Intronic
1057923799 9:99123940-99123962 GATGATGAAATAGGTCAGAGAGG + Intronic
1058293198 9:103271183-103271205 ATTGATGAAATAGGAAACCACGG - Intergenic
1058312890 9:103528047-103528069 GAAGATTAAATAGGATTAAAAGG - Intergenic
1058344566 9:103945704-103945726 GATGAAAAAAGAGGAGAAAAAGG - Intergenic
1058696594 9:107564271-107564293 GCTCATGAAAAAGGAAAAGAGGG + Intergenic
1059142143 9:111863840-111863862 GATGCAGAAATAGGAAGAGAAGG - Intergenic
1059871080 9:118578086-118578108 TGTGAAGAAATAGGAAAATATGG - Intergenic
1059919109 9:119137861-119137883 GATCATGAAATAAGAAAATCAGG - Intergenic
1060085225 9:120693307-120693329 GAAGAAGAAAAAGGAAAAAGAGG + Intronic
1060218779 9:121753677-121753699 GCTGTTGAAATATGAAAAAAGGG + Intronic
1061269706 9:129531597-129531619 GAGGGGGAAATAGGAAAAAAGGG - Intergenic
1061736525 9:132664326-132664348 GATGTTGACATAGGAATAAAGGG - Intronic
1185431064 X:12347-12369 GTTTATGAAACAGGGAAAAAGGG + Intergenic
1185440330 X:224744-224766 GTTTATGAAACAGGGAAAAAGGG + Intergenic
1185984741 X:4819161-4819183 GAAAAAGAAAAAGGAAAAAAGGG + Intergenic
1187119914 X:16394926-16394948 TTTGAAGAAATAGGAACAAAAGG + Intergenic
1187329313 X:18321740-18321762 CATGATGGAATAGGATAATATGG - Intronic
1187548852 X:20281221-20281243 GCTGAGGATAGAGGAAAAAATGG - Intergenic
1187575680 X:20551964-20551986 GATGATGTAATAGGCCACAAAGG + Intergenic
1188417128 X:29949192-29949214 CTTGATGAAGAAGGAAAAAATGG - Intronic
1188916145 X:35913316-35913338 CATGAAAAAATAGGAAAAAATGG + Intergenic
1189062146 X:37765988-37766010 GATGATGATCATGGAAAAAAGGG - Intronic
1189183782 X:39032630-39032652 GAGTCTGAAATAGCAAAAAATGG + Intergenic
1189529885 X:41869083-41869105 GTTGATGATCTAGGAGAAAAAGG + Intronic
1189636394 X:43015079-43015101 AATGATGAAATAGGAGAGAGTGG + Intergenic
1191084813 X:56553935-56553957 GATGATGACATAGGCAGAAAAGG - Intergenic
1191220965 X:57987797-57987819 GATGATAAGAGAGGAAGAAAGGG - Intergenic
1191665914 X:63702489-63702511 AATGAAGAAGTAGGAAATAAAGG - Intronic
1191994965 X:67083791-67083813 GGTGAAGATGTAGGAAAAAAAGG - Intergenic
1192043469 X:67647014-67647036 GATGAGAAAATAGAAAAGAAAGG - Intronic
1192085666 X:68094769-68094791 AAAGATGAAATAGAAAAAGATGG - Intronic
1192353083 X:70372815-70372837 GAAGATCAAATAAGATAAAAAGG - Intronic
1192353602 X:70378760-70378782 AAATATGAAATAGAAAAAAACGG + Intronic
1192486312 X:71530034-71530056 AAAGATGAAAAAGGTAAAAAAGG - Intronic
1192727861 X:73770585-73770607 GTTAATGTAACAGGAAAAAAAGG - Intergenic
1192819834 X:74633261-74633283 GATGATAAAATTGAAGAAAATGG - Intergenic
1193279633 X:79631121-79631143 CATGATGAAATATGAAACAGTGG - Intergenic
1193342955 X:80372999-80373021 GATTAAGATATAGGCAAAAAGGG - Intronic
1193528941 X:82630184-82630206 TATGATAAAATATCAAAAAATGG + Intergenic
1193872391 X:86816048-86816070 GATATTGAAATAGAAAACAATGG + Exonic
1193924989 X:87473872-87473894 GATGAAGAAATAACAAAAATTGG - Intergenic
1194100707 X:89700220-89700242 GAAAATGAAAGAGGAAAGAAGGG - Intergenic
1194192718 X:90857483-90857505 GATTATGTGGTAGGAAAAAAAGG + Intergenic
1194319513 X:92426686-92426708 TATGATGAAATGGCAAAAACAGG + Intronic
1194414481 X:93593482-93593504 ACTGAGGAAATAAGAAAAAATGG + Intergenic
1194615704 X:96100874-96100896 GATGAAAAAATAGAAAAAGAAGG - Intergenic
1194770983 X:97904456-97904478 GATACTGAAATAGGAAAGCAGGG + Intergenic
1194904175 X:99553392-99553414 AATGATGTAATATTAAAAAATGG - Intergenic
1195081110 X:101371703-101371725 TGTAATGAAATAAGAAAAAATGG + Intronic
1195304910 X:103572182-103572204 TATGATGTTAAAGGAAAAAAGGG + Intergenic
1195336033 X:103855388-103855410 GATGTTAAAATAGGGAAAACTGG - Intergenic
1195768343 X:108320407-108320429 GAGGATGATAAAGGAAAAGAGGG + Intronic
1196326843 X:114415442-114415464 TATGAAGAAACAGGAAAACATGG + Intergenic
1196816016 X:119666178-119666200 GATGATGATAGCGGAATAAATGG - Intronic
1196921637 X:120591426-120591448 AATGATGACAGAGGAAAACAGGG + Intergenic
1197192719 X:123666230-123666252 GAAGATGAAACAGAAAAATATGG + Intronic
1197374568 X:125665973-125665995 AATGATCAAAAAAGAAAAAAAGG + Intergenic
1197481383 X:126990992-126991014 GATTATCAATTAGGAAAAATGGG - Intergenic
1197754901 X:129986515-129986537 GTTCATGAAATAGAAAAAAATGG + Intronic
1198236115 X:134737278-134737300 GATGATGAAATAGGTGATTAAGG - Intronic
1198301565 X:135338875-135338897 GATGAAGAAAGAGGAAAAGGGGG - Intronic
1198317929 X:135488090-135488112 GATGATGACATAGAAAAAAAGGG + Intergenic
1198429824 X:136554189-136554211 GGTGTTGAAATAGGGAAAAATGG + Intronic
1198567300 X:137917366-137917388 GATGAAGGAATAGAAGAAAAAGG - Intergenic
1198779883 X:140222638-140222660 GGTCATGAAATAGCATAAAAGGG + Intergenic
1198927664 X:141816696-141816718 GATGATGAAATGTCAAAAACAGG - Intergenic
1198993806 X:142548915-142548937 CATGATTAAATATGAGAAAAAGG - Intergenic
1199454315 X:148010765-148010787 AATGATGAAAGAGCAAAAAAAGG - Intronic
1200492779 Y:3849038-3849060 CATGTTGTAAAAGGAAAAAAAGG - Intergenic
1200627640 Y:5539762-5539784 TATGATGAAATGGCAAAAACAGG + Intronic