ID: 929250909

View in Genome Browser
Species Human (GRCh38)
Location 2:39754023-39754045
Sequence TTTTATGTATTTTCACTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1155
Summary {0: 1, 1: 1, 2: 6, 3: 109, 4: 1038}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929250909_929250914 9 Left 929250909 2:39754023-39754045 CCCTAAAGTGAAAATACATAAAA 0: 1
1: 1
2: 6
3: 109
4: 1038
Right 929250914 2:39754055-39754077 GGAGTGCAACAGAGGTCCAATGG 0: 1
1: 0
2: 1
3: 4
4: 114
929250909_929250913 1 Left 929250909 2:39754023-39754045 CCCTAAAGTGAAAATACATAAAA 0: 1
1: 1
2: 6
3: 109
4: 1038
Right 929250913 2:39754047-39754069 TGAAGCTGGGAGTGCAACAGAGG 0: 1
1: 0
2: 0
3: 17
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929250909 Original CRISPR TTTTATGTATTTTCACTTTA GGG (reversed) Intronic
901358650 1:8675836-8675858 TTTTAGGTATTTTCAGATTTTGG + Intronic
901950302 1:12739975-12739997 TTTGATGTGTTTTCACCTTCTGG - Intergenic
903021451 1:20398104-20398126 TTTTGTGTGTTTTCATTTTGGGG + Intergenic
903795321 1:25924379-25924401 TTTTTTTTTTTTTCACTTAAAGG - Intergenic
904072814 1:27814905-27814927 TTTTAAATATTTTCACTCCACGG - Intronic
904081867 1:27877322-27877344 TTTTTTTTATTTTTACTTTTTGG + Intronic
904482462 1:30802536-30802558 TTTTTTGTATTTTTAGTTTGAGG - Intergenic
904553498 1:31341426-31341448 TTTTATATTTTATCACTGTAAGG - Intronic
905605803 1:39298641-39298663 TTTTATTTTTTTACACTTTCAGG + Intronic
906338592 1:44957284-44957306 TTTGATGTCTTTTGACTTTGTGG - Intronic
906339886 1:44970153-44970175 AGTTATGTTTTTTCACTTAAAGG - Intronic
907826214 1:58019222-58019244 TTTTATTTATTTTTAAATTATGG + Intronic
908227552 1:62071413-62071435 TTTTATTTTTTTCCATTTTATGG + Intronic
908368726 1:63457407-63457429 TTTTCTGTATTTTCAATGCATGG + Intronic
908662829 1:66455444-66455466 GTTTATATATTTTTTCTTTAGGG - Intergenic
909044093 1:70688187-70688209 TTTTATTTAATTCCACTTAATGG - Intergenic
909251888 1:73368396-73368418 ATTTATTTTTTTTCATTTTAAGG + Intergenic
909954716 1:81764835-81764857 TGCTATGTATATTCAATTTAAGG - Intronic
910198422 1:84670945-84670967 TTTAAGGTATTTTCAAATTAGGG + Intronic
910315116 1:85873810-85873832 TTTTATGTATTTTAAGTTCTAGG - Intronic
910479122 1:87639400-87639422 TTTTTTGTATTTTCTTTTTTAGG - Intergenic
911245129 1:95508520-95508542 TTTTACGTTCTTTCACATTAGGG + Intergenic
911250181 1:95567655-95567677 TTGTATTTATTTTGACTTCATGG + Intergenic
911457719 1:98147888-98147910 TTTCATGTATATTTATTTTAAGG + Intergenic
911586737 1:99699786-99699808 AATTATGGATTTTCAGTTTATGG + Intergenic
911648375 1:100359584-100359606 TTCTTTGTAATTTCACTTTTGGG + Intronic
911705984 1:101013633-101013655 TTAAATGTATTTTCAATTTGTGG + Intronic
911798308 1:102101745-102101767 CATTATGTAATTTCACTTTAAGG - Intergenic
911863364 1:102984190-102984212 TATTATATATTTTAACTGTAGGG - Exonic
911863688 1:102989093-102989115 TTTCATGAATTTTCATTATATGG - Intronic
912136754 1:106669451-106669473 TTATGTTTATTTTCATTTTATGG - Intergenic
913036095 1:114967917-114967939 TTTTATTTTCCTTCACTTTAAGG + Intronic
913306637 1:117435072-117435094 TTTTAGGTATTTTGAGTTTGAGG + Intronic
913355397 1:117915843-117915865 TTTTATGTATTTTCCTATCAAGG + Intronic
913500044 1:119464054-119464076 TTTGATGTGTTTCCACTTTATGG - Intergenic
913504494 1:119504047-119504069 TTTGATGTGTTTCCACTTTATGG - Intergenic
913507949 1:119535786-119535808 TTTGATGTGTTTCTACTTTATGG - Intergenic
914905430 1:151739829-151739851 TTGAATGAATTTTCACTTAAGGG - Intergenic
915029833 1:152868841-152868863 TTTTCTGTATTTTTTCTTTCTGG - Intergenic
915453523 1:156023514-156023536 TTTTTTTTTTTTTTACTTTAGGG + Intergenic
915720371 1:157980074-157980096 TTTTATCTTTTTTTCCTTTATGG - Intergenic
916173822 1:162021876-162021898 TTTTATGTCTTTTCGATTTAGGG + Intronic
916314331 1:163431860-163431882 TTTTATTTTTGGTCACTTTAAGG + Intergenic
916981315 1:170140297-170140319 TTTTTTTTTTTTTAACTTTAAGG - Intergenic
917337095 1:173935960-173935982 TTTCATGTATTTTCATTTGGGGG - Exonic
917544173 1:175945398-175945420 TTTTATGTAGTTTACCTTGAAGG - Intronic
918381055 1:183955738-183955760 TTCTTTGTATTATCCCTTTAAGG - Intronic
918454775 1:184698086-184698108 TTTTTTGTTTTTTCTCTTTATGG - Intronic
918734495 1:188041789-188041811 TTTTAGGTACTTTTACTATAAGG - Intergenic
918806332 1:189050905-189050927 TTTTATTTATTTTCTTTTTTTGG + Intergenic
918921090 1:190711289-190711311 TTTTTCATATTTTCAATTTATGG + Intergenic
919150042 1:193684812-193684834 TTTTATTCATTATCACTGTAGGG - Intergenic
919731382 1:200915760-200915782 TTTTATTTATTTTTATTTTTTGG + Intergenic
921197195 1:212769652-212769674 TTTTATGTGTTTTCACATGATGG - Intronic
921376830 1:214483302-214483324 TGTTGTGTATCTTCACTGTAGGG + Intronic
921461994 1:215439155-215439177 TTTTATGTTTTTTGACTTACAGG + Intergenic
921688139 1:218114874-218114896 TTTTATTTCTCTTCACTTTCTGG + Intergenic
921759231 1:218893260-218893282 TTAAATGTATTTTCAACTTATGG - Intergenic
922148387 1:222973033-222973055 TTAAATGTATTTTAAGTTTATGG + Intronic
922772738 1:228196409-228196431 TTTTATGGATTTACATTTTCTGG + Intergenic
923113091 1:230908870-230908892 ATTTATGGATTTTTATTTTAAGG - Intronic
923254888 1:232213280-232213302 TTTTAGGTATTTTCACTAGGAGG + Intergenic
923667270 1:236009708-236009730 TTTTATGTCATTTCATTGTATGG + Intronic
923681278 1:236120794-236120816 TTTTCACTATTTTCACGTTACGG + Intergenic
923829991 1:237544508-237544530 TTTTATTTACTTTAACTTTTTGG + Intronic
924111990 1:240709177-240709199 CTTCATGTATTTTCAGTTGATGG + Intergenic
924118614 1:240773280-240773302 TTTAATTTATTTGCATTTTATGG + Intergenic
924119153 1:240778866-240778888 GCTTATGTTTATTCACTTTATGG + Intronic
924273209 1:242356698-242356720 TTGAATGTTTTTTCACTTTTTGG + Intronic
924889764 1:248262083-248262105 TTTAATGTATTTTAAGTTCAGGG - Intergenic
1063769904 10:9184791-9184813 TTGTATGTCTTTCCTCTTTAGGG - Intergenic
1064061643 10:12142753-12142775 TTATTTTTATTTTCACTTTCTGG + Intronic
1064499127 10:15949748-15949770 TTGAATGTATTATCACATTAAGG - Intergenic
1065062026 10:21911984-21912006 TTTAATGTATTTGCAACTTAGGG + Intronic
1065142337 10:22730275-22730297 TTATATGTTTTTTCTCTTTGTGG + Intergenic
1065421805 10:25553079-25553101 TTTTAGTTATTTTCTATTTATGG + Intronic
1065657268 10:27964600-27964622 TTTGATCTGTTTTCATTTTAGGG + Intronic
1065715504 10:28563288-28563310 TTTTCTTAATTTTCACTTAATGG + Intronic
1065843241 10:29723228-29723250 TTTTTTGTTTTTTAACTTTTTGG - Intronic
1066013254 10:31213614-31213636 TATTATGTATTTTTAAATTATGG + Intergenic
1066071042 10:31813187-31813209 TTTTATGTATTTTTACTTTTTGG - Intronic
1066093211 10:32046875-32046897 TTTGATGCATTTTCAGCTTAGGG - Intronic
1066119611 10:32272166-32272188 TCTTTTGTATTTTCTTTTTAGGG - Exonic
1066318561 10:34275640-34275662 TGTTATGTATTTCCACTCTGTGG + Intronic
1066354740 10:34671681-34671703 TTATATGTATTTCCACATCAGGG + Intronic
1066711512 10:38239950-38239972 TTGAATGTTTTTTCACTTTTTGG - Intergenic
1067678563 10:48409714-48409736 TTTTATATATTGCAACTTTATGG - Intronic
1067860671 10:49844280-49844302 TTTTATGGTTTTTGACATTATGG - Intronic
1067970064 10:50959592-50959614 TTTTTTTTTTTTTTACTTTAGGG + Intergenic
1068110726 10:52677470-52677492 TTTAATTTTTTTTCACTTTGGGG + Intergenic
1068328305 10:55525750-55525772 TTTAAAGTATTTTCATTTTATGG + Intronic
1068330887 10:55566908-55566930 TTTTTTGTATTTCTGCTTTAAGG - Intronic
1068360186 10:55967533-55967555 TTTCATGTATTTTAACTTCCTGG + Intergenic
1068425570 10:56859107-56859129 ATTTATGTATTTTTTATTTAAGG + Intergenic
1068526197 10:58133244-58133266 TTATATATATCTTCACTTGATGG + Intergenic
1068631668 10:59304737-59304759 TTTTATTTATTTTAAGTTCAGGG - Intronic
1068923466 10:62510739-62510761 TTTTATTTATTTCCATTTCATGG + Intronic
1069079941 10:64077625-64077647 TTTTATTTATTTTTAATTTTGGG - Intergenic
1069216662 10:65829923-65829945 TAGTATGTATTTTCAAATTAGGG + Intergenic
1069277781 10:66613759-66613781 ATTTATTTCTTTTCACTTCAGGG - Intronic
1069917230 10:71795083-71795105 TTGTATGTATTTTACATTTATGG - Intronic
1070106619 10:73438651-73438673 TTTTTTGTATTTTTATTTTTTGG - Intronic
1070106885 10:73441778-73441800 TTTTATGTATGTTTTCTTTCTGG - Intronic
1071663682 10:87531623-87531645 TATTTTGAATTTTCACATTAGGG - Intronic
1071764492 10:88647312-88647334 CTTCCTTTATTTTCACTTTATGG - Intergenic
1071889928 10:89993207-89993229 TTTTTTGTTTTTTTACTTTAAGG + Intergenic
1072026233 10:91461233-91461255 GTTAATGTGTTTTCATTTTAGGG + Exonic
1072325412 10:94293479-94293501 GCTTATTTATTTTCATTTTATGG + Intronic
1073173475 10:101533814-101533836 TTTTTTGTCTTTTGACTTAAAGG + Intronic
1073673934 10:105623747-105623769 TTTGATTTATTTTCACTTTTTGG + Intergenic
1073726771 10:106241131-106241153 TTTTTAGTATTTTCACACTAAGG + Intergenic
1073778270 10:106809809-106809831 TGTTTTGTTATTTCACTTTAAGG + Intronic
1073862172 10:107759034-107759056 TTTTTCGTATTTTCCATTTAAGG + Intergenic
1073917308 10:108420528-108420550 TTTCATTTATGTTCACTTTTTGG + Intergenic
1074094126 10:110293455-110293477 TTTTTTGTTTTTTCCATTTACGG - Exonic
1074260644 10:111849973-111849995 TTACATGTATTTTCTCATTAAGG - Intergenic
1074602054 10:114924720-114924742 TTTTATGTATTTATTTTTTAAGG + Intergenic
1074792668 10:116906746-116906768 TTTGTTTTGTTTTCACTTTAGGG - Exonic
1074921477 10:118018715-118018737 TATTATTTATTTTAACTTTGAGG - Intronic
1074923091 10:118038042-118038064 TTTTAAATATTTTCACTCCATGG + Intronic
1075497381 10:122935920-122935942 TTTTGTGTATTTTAATTTTGGGG + Intronic
1076906158 10:133362401-133362423 TTTTTTGTTTTTTCACTGTAAGG - Intergenic
1077487261 11:2844777-2844799 TTTCATAAATTTTCACATTATGG - Intronic
1077622934 11:3743679-3743701 TATTATGTATTTTGAACTTAAGG - Intronic
1077764811 11:5146611-5146633 TCTTATGTTTTTACACTTTATGG + Intergenic
1077861234 11:6182012-6182034 GTCTATGTAATTTCACTTTTTGG - Intergenic
1077978011 11:7269907-7269929 TTTTATGGTTTTTGGCTTTAGGG - Intronic
1078033484 11:7778637-7778659 TTTGATTTATTTTGACTTTGAGG + Intergenic
1078397159 11:10991447-10991469 TCTTATGTCATTTTACTTTATGG + Intergenic
1078535376 11:12169332-12169354 TTTTATGGTTTCTCATTTTATGG + Intronic
1078970044 11:16398705-16398727 TTTTATGTATTTCTTCTATAAGG + Intronic
1079778684 11:24568951-24568973 TTTTATTTATTTTTCCCTTAAGG - Intronic
1079892521 11:26074666-26074688 ATTTGTGAATTTTCATTTTAGGG - Intergenic
1079928054 11:26521217-26521239 TTTTATATAATTTAATTTTAAGG - Intronic
1080004239 11:27388920-27388942 TTTTAGTTATTTTAACTTTATGG + Intronic
1080241833 11:30135695-30135717 CTTTAAGTATATTCACATTAAGG + Intergenic
1080362867 11:31536173-31536195 TTTTATTTGTTTTCAGTTTTTGG + Intronic
1082248828 11:49957366-49957388 TTTAATGAATTTTAACTTAAAGG + Intergenic
1082702482 11:56450115-56450137 TTTTATGTTTTTTAACTTTTTGG + Intergenic
1082973306 11:59046432-59046454 TTTTATATTTATTCACCTTATGG + Intergenic
1084343220 11:68523369-68523391 TTTTATGTATTGTCATGTTTTGG + Intronic
1084843705 11:71881963-71881985 TTTTGTTTATTTTCAATTTTGGG - Intronic
1085367782 11:75967499-75967521 TGTTATTTATTTTCAATTTGGGG + Intronic
1085376378 11:76066025-76066047 TTTTTTGTATTTTTACTTGCTGG + Intronic
1086107965 11:83168021-83168043 TGTTATGTTTTTTCCCTTTAAGG + Intronic
1086250648 11:84809427-84809449 TTTTATTTTTTTTTTCTTTATGG - Intronic
1086724188 11:90161916-90161938 TTTTTTTTTTTTTCATTTTAAGG - Intronic
1086751766 11:90504810-90504832 TTTTATGTATTCTCTCATTTTGG + Intergenic
1086754829 11:90547348-90547370 TTTTATTTATTTTTACTTCCTGG + Intergenic
1086795617 11:91097905-91097927 ATTTCTGTCTATTCACTTTAAGG + Intergenic
1086890340 11:92250800-92250822 TTTTTTGTATTTTCTCTATAAGG + Intergenic
1087104969 11:94399761-94399783 TGTTATATTTTTTCATTTTATGG - Intronic
1087797419 11:102469288-102469310 TTTTATGCATTTTCACTGTGGGG - Intronic
1087861548 11:103163976-103163998 TTGTATCTTTTTTCATTTTAAGG + Intronic
1087962611 11:104370779-104370801 TTTTATGAATTCTCACTCTTGGG + Intergenic
1088007893 11:104964474-104964496 TTGTAAGTATTCTCAATTTATGG + Intronic
1088405526 11:109472366-109472388 TTTTATATAATTTCATTTTGAGG - Intergenic
1088549516 11:110997414-110997436 ACTTATGTATTTTTCCTTTATGG - Intergenic
1089409319 11:118226097-118226119 TCTTTTGTATTTTCAGATTAGGG + Intergenic
1089486789 11:118852741-118852763 TTTTGTGGACTTTCACTTTGTGG - Intergenic
1089956172 11:122573493-122573515 TTTTATGAATTTTAATTTTTAGG + Intergenic
1090148511 11:124355991-124356013 CATTAGGTATTTTCATTTTAAGG - Intergenic
1090341692 11:126027975-126027997 TTTTTTTTTTTTTTACTTTAGGG + Intronic
1090598630 11:128346522-128346544 GTTTCTGTATTTTTAATTTAAGG + Intergenic
1091162182 11:133434120-133434142 TTTTTTGTATTTTTACATTGAGG + Intronic
1091256617 11:134193017-134193039 TTTTTTCTTTTTTCACTCTATGG - Intronic
1091498001 12:989408-989430 TTTTATTTATCATCATTTTATGG + Intronic
1091734590 12:2909444-2909466 TTTTATGTATGTACTCTTTTGGG - Intronic
1091939036 12:4458926-4458948 ATCTAAGTATTTCCACTTTAGGG - Intergenic
1092253000 12:6911703-6911725 TTTTATTTATTTTCATGTTCTGG - Intronic
1092339492 12:7663245-7663267 TTTTATGCATTTGCACTGGATGG + Intronic
1092616788 12:10222919-10222941 ATTGATTTATTTTCACTTTTGGG + Exonic
1092653131 12:10655901-10655923 TTTTATGTTTTTTCTCTTCTTGG + Intronic
1092659084 12:10720115-10720137 TTTTCTTTATTTTTTCTTTAAGG - Intronic
1092675305 12:10911132-10911154 TTTTATACTTTTTCATTTTAGGG + Intronic
1093014519 12:14142962-14142984 TTTTATTTATTTTTTTTTTATGG + Intergenic
1093101206 12:15031293-15031315 TTGTAAGTATTCTCAATTTATGG - Intergenic
1093236812 12:16619458-16619480 TTTTACTTTTTTTAACTTTATGG - Intergenic
1093409538 12:18847881-18847903 TTTTCTGTCTTTTGACTTTGGGG - Intergenic
1093506562 12:19873511-19873533 TTTTATTTATTTTTAATTTAAGG + Intergenic
1093519368 12:20030218-20030240 TTTTATTTTTTTTCAATTTTTGG + Intergenic
1093680245 12:21994032-21994054 TTCTAAATATTATCACTTTAGGG - Intergenic
1093771024 12:23018762-23018784 TTTTTTCTATTTTCTCTATATGG + Intergenic
1093922580 12:24875918-24875940 TTAAATGCATTTTCACCTTAAGG - Intronic
1093934618 12:24987591-24987613 TTTTATGTCTTTTAACTGCATGG - Intergenic
1093936567 12:25007946-25007968 TTTTATTTTTTTTTATTTTATGG + Intergenic
1094087531 12:26610046-26610068 TTTTCTGAATTTTCCTTTTATGG - Intronic
1094393972 12:29984769-29984791 TTGTTTCTATTTTCTCTTTAAGG - Intergenic
1095148948 12:38767601-38767623 TTTTATGCATTTCAACTATATGG - Intronic
1095195819 12:39315373-39315395 TGTTATTTTTTTTCATTTTATGG - Intronic
1095326065 12:40894717-40894739 TATTATCTATTTTCACTTGTGGG - Intronic
1095374425 12:41509082-41509104 TTTTATGTATTTCAACTTTTAGG - Intronic
1095486539 12:42690473-42690495 TTTTTGGTAATTTCACTTTTTGG + Intergenic
1095687979 12:45057051-45057073 TTTTTTTGATATTCACTTTATGG - Intergenic
1096787797 12:54027643-54027665 TTTTATACATTTTCCCTTTTAGG + Intronic
1096859936 12:54518424-54518446 TTCTATGTAATTTCACTTAGTGG - Intronic
1097506379 12:60477850-60477872 TTTTTTATTTTTTCATTTTAAGG + Intergenic
1097591844 12:61584236-61584258 TATCATGATTTTTCACTTTAGGG + Intergenic
1097593121 12:61595513-61595535 TTTTATGTATTTTAATTTTAAGG - Intergenic
1097656696 12:62372920-62372942 TTTTTCATATATTCACTTTATGG - Intronic
1097989662 12:65822350-65822372 TTTTATATATTTTCATTCTTTGG - Intergenic
1098287570 12:68923214-68923236 TTTTGAGTAATTTCACTTTAAGG + Intronic
1098296972 12:69013692-69013714 TTTTAAGAATTTTCACTTTTTGG - Intergenic
1098401707 12:70083482-70083504 TTTTATTTATTTGAAATTTAAGG - Intergenic
1098401708 12:70083552-70083574 TTTTATTTATTTGAAATTTAAGG - Intergenic
1098656290 12:73034402-73034424 TTTTATTTAATTTCTTTTTATGG - Intergenic
1098719407 12:73876806-73876828 ATGTATGTATTTTCAATTTGAGG - Intergenic
1098784074 12:74727460-74727482 CTTTATGTTTTTACACTTAAAGG + Intergenic
1098876963 12:75875943-75875965 TTTTTTTTATTTTCAAATTATGG - Intergenic
1098903195 12:76133966-76133988 TTTTATGAAGTTTGGCTTTATGG - Intergenic
1099140388 12:78966788-78966810 TTTTATGAATATTAACTTTTTGG - Intronic
1099599080 12:84708771-84708793 TTTTATGTATATTAACATTAGGG + Intergenic
1099617841 12:84961309-84961331 CTTTTTATAATTTCACTTTATGG + Intergenic
1099638035 12:85241252-85241274 TTTAAGGTCTTTGCACTTTACGG + Intronic
1099647764 12:85380995-85381017 TTTTAGGGATTTTGACTTTGGGG + Intergenic
1099867213 12:88298094-88298116 TTTTTTTTTTTTTTACTTTATGG - Intergenic
1099958500 12:89374466-89374488 TTTTATGCATTTTAGATTTAAGG - Intergenic
1100119623 12:91353902-91353924 TTTTACTTATTTTAAGTTTAGGG + Intergenic
1100683761 12:96961740-96961762 GCATATGTTTTTTCACTTTATGG - Intergenic
1100734858 12:97515619-97515641 TTTTATTTATTTTCCCTATTGGG - Intergenic
1100948026 12:99809364-99809386 TTTTCTTTATTTTAACATTAGGG - Intronic
1101082953 12:101208071-101208093 TTTTATTTCTTCTCACTATAAGG + Intronic
1101155803 12:101926334-101926356 TTTACTGTATTTTCATATTAGGG - Intronic
1101519590 12:105469109-105469131 TTTCATGTAGATTAACTTTAAGG + Intergenic
1101623318 12:106412492-106412514 TTTTATGGCTTTTCACCTAAGGG - Intronic
1101780357 12:107829481-107829503 TTTTAAGTATTTTCACTGGCTGG + Intergenic
1102120923 12:110440457-110440479 TTGTATGTGTTTTCCCTTTATGG - Intronic
1102743112 12:115225360-115225382 ATTTATGTATTTTCAAAATAAGG - Intergenic
1103024306 12:117561123-117561145 TTTTACTTATTTTCTATTTATGG - Intronic
1103877115 12:124136463-124136485 TTCTATGTTTTTTCCCTTTATGG + Intronic
1104006204 12:124894432-124894454 TTTAATGTAATTTAATTTTATGG - Intergenic
1104287482 12:127437825-127437847 TTGTATCGATTTTCACTTCATGG - Intergenic
1104734090 12:131125740-131125762 TTAAATGCATTTTCAATTTATGG - Intronic
1105622063 13:22077563-22077585 CTTTATTTATTTTTTCTTTAGGG - Intergenic
1106282013 13:28282896-28282918 ATTTATTTATTTTGACTTAATGG + Intronic
1106285185 13:28312502-28312524 TTTTTTTTTTTTTAACTTTAAGG - Intronic
1106500001 13:30318782-30318804 TTATATGATGTTTCACTTTAGGG + Intergenic
1106668514 13:31879583-31879605 TATTATGTAATGCCACTTTAGGG - Intergenic
1106976924 13:35229486-35229508 TTCTTTGTATTTTTATTTTAAGG + Intronic
1106996907 13:35495366-35495388 TTCTATCTGTTTTCGCTTTATGG - Intronic
1107088751 13:36452936-36452958 TTTATTATATTTTCACTTTCAGG + Intergenic
1107144607 13:37045701-37045723 TTTTATATATTTGCATTTAATGG - Intronic
1107185756 13:37517673-37517695 TTTTCTTTTTTTTCTCTTTAAGG + Intergenic
1107240629 13:38230259-38230281 ATTTATTTATTTTAACTTTTAGG - Intergenic
1107269367 13:38596360-38596382 TTTTATGTTTTCTCATTTTTAGG - Intergenic
1107274073 13:38657072-38657094 TTTTATATATTTACATTCTAAGG + Intergenic
1107287146 13:38806569-38806591 TTTTAAGTATTTTTTATTTAAGG - Intronic
1107422247 13:40258438-40258460 TTTTCTTTTTTTTCACTTTATGG + Intergenic
1107801632 13:44113773-44113795 TATTATTTATTTTGACTTTGGGG + Intergenic
1108142327 13:47436910-47436932 TTTCAGGTATTCTAACTTTATGG - Intergenic
1108169201 13:47723878-47723900 TTTTATTTTTTTTTATTTTACGG - Intergenic
1108816610 13:54299790-54299812 TTTAATGCATTTTCATTTTAGGG + Intergenic
1108916027 13:55612960-55612982 TGTTTTGTATTTTCAGTTTAAGG - Intergenic
1108918697 13:55649745-55649767 TATTCTGAATTTTCAATTTAAGG - Intergenic
1109142007 13:58725025-58725047 TTTAAATTATTTTCAGTTTATGG - Intergenic
1109195059 13:59369824-59369846 TTTCAAGTATTTTCAGATTATGG - Intergenic
1109239383 13:59865567-59865589 ATTTATGTATTGTTTCTTTAAGG + Intronic
1109582290 13:64357052-64357074 ATTTATGTTTTTTCACCTCATGG + Intergenic
1109602242 13:64646439-64646461 TTTTAATTATTTTGAATTTATGG + Intergenic
1109714193 13:66199697-66199719 TTTTATGTATTTTAGGTTCAGGG - Intergenic
1109743234 13:66583782-66583804 TTTTTTGTTTCTTCATTTTATGG + Intronic
1110034740 13:70668988-70669010 TGTTGTTTATTTTCACTTTAGGG + Intergenic
1110346691 13:74456326-74456348 TTTTATTTTATTTTACTTTAAGG - Intergenic
1110384209 13:74889859-74889881 TATTATTTATGTTAACTTTAAGG + Intergenic
1110458555 13:75718069-75718091 TTTAATCTGTTTTCACTTAATGG + Intronic
1110612687 13:77506514-77506536 TTTTTTATATTTTAACTTTTAGG + Intergenic
1110628795 13:77681903-77681925 TTTTAATTTTTTTCAATTTATGG - Intergenic
1110908177 13:80919011-80919033 TCTTATTTATTTTCACCTTATGG - Intergenic
1110956286 13:81556280-81556302 TTTTATCTATATTCATTTTTTGG + Intergenic
1111091772 13:83455537-83455559 TTTTATTTTGTTTCAGTTTATGG + Intergenic
1111155698 13:84321186-84321208 TTATATGTTTTTAAACTTTAGGG + Intergenic
1111222612 13:85223963-85223985 GTTTATGTATTTCCTCTTTATGG + Intergenic
1111487131 13:88918622-88918644 TTTTATTCTGTTTCACTTTATGG - Intergenic
1111538785 13:89642600-89642622 CTTTATCTATTATCCCTTTATGG + Intergenic
1111573858 13:90124390-90124412 TTTTGTATTTTTTTACTTTATGG + Intergenic
1111658940 13:91185293-91185315 TTATATTTATTTTTGCTTTAGGG - Intergenic
1112067199 13:95805925-95805947 TTTTATGTATTTTTTCATTGTGG - Intronic
1112444861 13:99454766-99454788 TTTTAGTTGTTTTCACTTTGGGG + Intergenic
1112464468 13:99631452-99631474 TTTAATGAATCTTCAATTTATGG - Intronic
1112525508 13:100142974-100142996 ATTTATGTTTTTTCACATTTTGG + Intronic
1112849867 13:103692471-103692493 TTAAATGTATTTTTAGTTTAAGG + Intergenic
1112894269 13:104279219-104279241 TTTTCTGTATTTTTACTACATGG + Intergenic
1113232028 13:108222350-108222372 TTTTATTTATTTTTAGTTTTTGG + Intronic
1113700606 13:112383902-112383924 TTCTAAGTATTCTCAATTTATGG - Intronic
1115182161 14:30641841-30641863 TTATATGTGTTTTCACTTTCAGG + Intronic
1115322206 14:32094362-32094384 TTTTATCTTCTTTCACTTTGTGG - Exonic
1115764016 14:36604265-36604287 TTTTATATACTTTCAGTTTTTGG - Intergenic
1115909767 14:38242394-38242416 TTATATAGTTTTTCACTTTATGG - Intergenic
1115915437 14:38307557-38307579 TGTTAGGTATATACACTTTAAGG - Intergenic
1116030595 14:39566816-39566838 TTTTATGTTTATTTATTTTATGG + Intergenic
1116318072 14:43423491-43423513 TTTTATATTTTTTTAATTTATGG + Intergenic
1116365173 14:44051696-44051718 TTTTATCTTTTTTCCCTTAAGGG - Intergenic
1116383489 14:44301484-44301506 TTAAATTTATTTTTACTTTAGGG + Intergenic
1116562843 14:46403144-46403166 TTACATGTAATTTGACTTTAGGG - Intergenic
1116595023 14:46830317-46830339 ATTTATTTATTTTTCCTTTATGG - Intergenic
1117443244 14:55779554-55779576 TTTTATTTTTTTTTACTATATGG + Intergenic
1117524798 14:56588712-56588734 ATTTATGTATTGTCCCCTTAAGG + Intronic
1118200665 14:63669063-63669085 TTTTAACTATATTCACTCTACGG + Intergenic
1118471190 14:66076848-66076870 TTTTATGCATTTCCATTTAAAGG + Intergenic
1118525264 14:66633574-66633596 TTTTATACATTCTCAGTTTAAGG + Intronic
1118670647 14:68123091-68123113 TTTTATGTTTTATCATTTTCAGG + Intronic
1118910497 14:70058337-70058359 TTTTATGACCTTTCACCTTATGG + Intronic
1119005750 14:70926254-70926276 TTTTATGTGCTTTCACTTACTGG + Intronic
1119009850 14:70973082-70973104 TTTTTTGTATTTTTTCTTAAAGG - Intronic
1119906094 14:78303478-78303500 TTTGCTTTATTTTCACTTTTAGG - Intronic
1119965733 14:78913754-78913776 TTTCATCTGTTTTCTCTTTATGG - Intronic
1120022259 14:79544050-79544072 TTGTATTTATTTTCACTGTTGGG - Intronic
1120246845 14:82016842-82016864 TTTTGTCTATTTTTACTTAATGG - Intergenic
1120264043 14:82226445-82226467 TTTTATGAATTGTCATTTTATGG + Intergenic
1120316843 14:82905235-82905257 TTTAATGTCTTTTTACCTTAAGG + Intergenic
1120348936 14:83327849-83327871 TTGTATGTATTATTACATTATGG - Intergenic
1120549805 14:85856502-85856524 TTTCATTTATTTTACCTTTATGG - Intergenic
1120663335 14:87276826-87276848 TTTTAAATATTTTAACTTTTAGG + Intergenic
1120736748 14:88061497-88061519 TTTTATGTATTTTACATATAAGG + Intergenic
1121393734 14:93599223-93599245 TTTTGTGTGTTCTCATTTTATGG + Intronic
1121478182 14:94233870-94233892 TCTTAACTATTTTAACTTTATGG + Intronic
1121575163 14:94978859-94978881 CTTTAATTATTTTCATTTTAGGG - Intergenic
1121776044 14:96591816-96591838 TTTTATTTATTTTAATTTTTTGG + Intergenic
1121950232 14:98165304-98165326 TTTTATGTAGTTTGAATTTTTGG + Intergenic
1122240159 14:100359244-100359266 TTTGAGTTATTTTCACTTTTTGG - Intronic
1123635141 15:22298693-22298715 TTTTAGCTATTTTCTCTGTATGG - Intergenic
1123675489 15:22707241-22707263 ATTTGTGTATGTTCACTTAAGGG + Intergenic
1123972517 15:25521504-25521526 TTTTATGTATTTTTGATTTAGGG - Intergenic
1124026390 15:25970457-25970479 TCTTTTGTATTTTCCTTTTAAGG - Intergenic
1124338936 15:28877305-28877327 TTTTATATATTTGGACTTTCTGG + Intergenic
1124674572 15:31673083-31673105 CTTAATGTATTTTCAACTTAAGG - Intronic
1124802057 15:32842625-32842647 TTTTACGTATTATTAGTTTAGGG - Intronic
1125049012 15:35275705-35275727 TTTTTTTTTTTTTTACTTTAAGG - Intronic
1125129432 15:36264616-36264638 TTTTATAGTATTTCACTTTATGG - Intergenic
1125338178 15:38648728-38648750 TTTTATGTCTTTTCTCTCTGAGG + Intergenic
1125713151 15:41803543-41803565 TTTTTTTTATTTTTACTTTTTGG - Intronic
1125836627 15:42757659-42757681 TTTTATGTCTTTATAGTTTAAGG - Intronic
1126196802 15:45940325-45940347 ATTTATTTATTTTGACTTTTAGG - Intergenic
1126251811 15:46576016-46576038 TTTTCTGTCTTTTGACCTTAGGG + Intergenic
1126300737 15:47193277-47193299 TATTTTGTATTTTCATATTAGGG - Intronic
1126478206 15:49089484-49089506 TTTTCTTAAATTTCACTTTAAGG + Intergenic
1127229376 15:56971768-56971790 TTATCTGTAGTTTCACTTTCTGG + Intronic
1127750422 15:62035121-62035143 TTTTATGCTTTTTCGCTTAATGG - Intronic
1128011521 15:64301349-64301371 TTTGCTTTATTTTCACTTTGGGG - Intronic
1128049673 15:64652984-64653006 TTTTATGTATTTATTTTTTAAGG - Intronic
1128603909 15:69020405-69020427 TTTTATTTATTTTTACATTTAGG + Intronic
1128640981 15:69337266-69337288 TTGTGTGTATTCTCAATTTATGG + Intronic
1128985599 15:72218592-72218614 TTTTTTTTTTTTTCACTTTTTGG + Intronic
1129707123 15:77800683-77800705 TTTGTTGAATTTTCACTTTATGG - Intronic
1130000700 15:80044021-80044043 TTTAATTTATTTTAACTTTTAGG + Intergenic
1130068225 15:80624103-80624125 TTTTATTTTATTTCATTTTATGG + Intergenic
1130233231 15:82112604-82112626 TTTTTTGTTTTTTAACTTGATGG + Intergenic
1130854127 15:87825998-87826020 GTTTATGTCTTTCCATTTTAAGG - Intergenic
1131412365 15:92220556-92220578 TTTTTTGTATTTTCAGTAGACGG + Intergenic
1131852242 15:96555513-96555535 TTTTATGTTTTTTTATTTCATGG - Intergenic
1131856995 15:96607876-96607898 TTCCCTGTATTTTCACTTCATGG - Intergenic
1132248094 15:100312870-100312892 ATTTATGTATTATTACTTAATGG - Intronic
1133400892 16:5486119-5486141 TTTTAAGTGTTATTACTTTAAGG - Intergenic
1133574965 16:7080159-7080181 TTTTATTTACTTTTACTTTTTGG - Intronic
1133591601 16:7249674-7249696 TTTTATGTATTTTTTATTTTTGG + Intronic
1134037074 16:11039402-11039424 ATTTATGTAAGTTCAGTTTATGG + Intronic
1134651595 16:15913404-15913426 TTTGATTTGTTTCCACTTTATGG + Intergenic
1134873186 16:17670625-17670647 TTTCATGTACATTCACTTAAAGG + Intergenic
1135804265 16:25527990-25528012 GTTTATTTATTATCATTTTATGG - Intergenic
1135966687 16:27041417-27041439 TTTTATTTATTTTTATTTTGTGG + Intergenic
1136177179 16:28525222-28525244 TTTTTTGTATTTTTATTTTGGGG + Intergenic
1138925302 16:61583049-61583071 TTTTAGGTTTTTTCTCTTTGTGG + Intergenic
1139051752 16:63132050-63132072 TTTTATGTCATTCCACTGTATGG - Intergenic
1139066429 16:63321076-63321098 TTTTATGTATTTACACATTGTGG + Intergenic
1139151210 16:64383725-64383747 GTTTGTGTATTTTCTTTTTATGG - Intergenic
1139212450 16:65092814-65092836 TATTATTTATTTTTCCTTTAAGG - Intronic
1139333967 16:66217858-66217880 ATTTATGTATATTAACTTAATGG - Intergenic
1139689246 16:68629425-68629447 TTTTCTGTAGTATCACTTTAGGG + Intergenic
1140320357 16:73945128-73945150 TCTGAAGTAATTTCACTTTAGGG - Intergenic
1140837339 16:78807290-78807312 TTTTAAGTATTTTGACATTGTGG - Intronic
1142317808 16:89359892-89359914 TTATATGTTTTTTAACTTTTAGG + Intronic
1143052628 17:4138685-4138707 TCATATGAAATTTCACTTTAGGG + Intronic
1143063634 17:4224810-4224832 TTTTATTTATTTTTACTCTCTGG + Intronic
1143827922 17:9627889-9627911 TTTTATATATTTTTATTTTTTGG + Intronic
1144027923 17:11294855-11294877 ACTTTTGTGTTTTCACTTTAAGG + Intronic
1144042344 17:11423118-11423140 TTTTGTGTCTTTTCTCTATATGG - Intronic
1144237843 17:13279377-13279399 TTTTATGTTTTTTAATTCTATGG + Intergenic
1144261273 17:13523931-13523953 TTTTATGTATTTTAATATTAAGG - Intronic
1144751333 17:17650530-17650552 TTTTCTGTGTTCTCACTTTCTGG - Intergenic
1145050059 17:19652918-19652940 TTTTAGGTGTTTTCATTTAATGG + Intronic
1146209906 17:30933987-30934009 TGTGATGTCTTTTCACTTCAGGG - Intronic
1147457383 17:40546349-40546371 TTTTTTTTAATTTTACTTTAAGG + Intergenic
1147501397 17:40967508-40967530 TTTTATGTTATTACATTTTATGG - Intergenic
1148040931 17:44706669-44706691 TTTAAAGTATTTTCATTTTTTGG + Intergenic
1148261672 17:46189477-46189499 TTTTATGTTTTTTCAGCTTGTGG - Intronic
1148289136 17:46427574-46427596 TTTTTTTTTTTTTCTCTTTATGG + Intergenic
1148311305 17:46645151-46645173 TTTTTTTTTTTTTCTCTTTATGG + Intronic
1149096576 17:52848262-52848284 TTTAATGCATTTTGGCTTTAAGG - Intergenic
1149143924 17:53466992-53467014 TTTTAACTATTTTCAATTTAAGG - Intergenic
1149175155 17:53860645-53860667 TTTTATTTATTTTTATTTTTAGG - Intergenic
1149801355 17:59571038-59571060 ATTTATGTTTTTTAACTGTAAGG + Intronic
1149875163 17:60225284-60225306 TTTTGTGTGTTTTTATTTTAGGG - Intronic
1149991390 17:61385490-61385512 TTTTCTGCATTTTCCCTTGATGG - Intronic
1150685121 17:67314448-67314470 TTTTATCTATTTTCAAGTTTTGG - Intergenic
1150888597 17:69117604-69117626 TTTTATATATTGTCACTGTGAGG - Intronic
1151861057 17:76762304-76762326 TTTTATGTATTATGAGTTTCAGG + Intronic
1152512073 17:80797043-80797065 TTTTATGTTTTTTTAATTTTTGG + Intronic
1152725938 17:81946046-81946068 TTTTTTGTATTTTCAGTCTGAGG - Intronic
1152910013 17:82998296-82998318 ATTTATCTATTTTCCTTTTATGG - Intronic
1153117470 18:1677065-1677087 TTATTTGTATTTTTAGTTTAGGG + Intergenic
1153169324 18:2297256-2297278 TTTTAAGTATTTTATTTTTAAGG - Intergenic
1153176918 18:2385539-2385561 TTCTATGTTTTCTCACTTTCAGG - Intergenic
1153248193 18:3094370-3094392 TTTTTTTTTTTTTCACTTGATGG - Intronic
1153318231 18:3745617-3745639 TTTTATTTATTTTTATTTTCTGG - Intronic
1153363214 18:4222921-4222943 TTTTATTTCTTTTCTGTTTATGG - Intronic
1153369579 18:4298753-4298775 TTTTATTTATTTAAATTTTAGGG - Intronic
1154235628 18:12603011-12603033 TTAGATGCATTTTCACTATATGG - Intronic
1154256601 18:12786483-12786505 TCTCATTTATTTTTACTTTATGG - Intronic
1154457856 18:14546281-14546303 TTTTATTTATTTTAACTTCTGGG - Intergenic
1154955172 18:21246686-21246708 TTTCTTGTATTTTCAGTCTATGG + Intronic
1155104806 18:22652840-22652862 TCTTATGTATTTTCCCTTTCTGG + Intergenic
1155142749 18:23057696-23057718 TTTCAGATATTTACACTTTATGG - Intergenic
1155653011 18:28163113-28163135 TTCTATGTATTTTGACCTTTTGG - Intronic
1155685385 18:28542067-28542089 TTTCATGTATTTTCCCCTTCTGG - Intergenic
1155715566 18:28938753-28938775 TTTTATGTCTTTTAAATTTATGG - Intergenic
1155742845 18:29311552-29311574 TTTTTTTTATTTTCTTTTTAGGG + Intergenic
1156917381 18:42477628-42477650 ATGTATGTATCTTCACATTAGGG - Intergenic
1157063047 18:44315716-44315738 TTTTATGTTTTTTGTCTGTATGG - Intergenic
1158285770 18:55880883-55880905 TCATATTTATTCTCACTTTAAGG + Intergenic
1158308126 18:56128608-56128630 TTTTATTTTTTTGCACTTTCTGG - Intergenic
1158977173 18:62720495-62720517 TTTTATTTATTTTCTCTTCTGGG + Intronic
1158983257 18:62786668-62786690 TTTTTTGTATCTACACTTAAAGG + Intronic
1159039840 18:63313813-63313835 TTTTTTTTATTTTTAATTTATGG + Intronic
1159468593 18:68819123-68819145 TTATAAATATTTTTACTTTACGG + Intronic
1159784882 18:72701461-72701483 TGTTATGAATTTTCAGTTTCAGG - Intergenic
1159859769 18:73633492-73633514 ATATATGTATTTTCTCTGTAAGG + Intergenic
1159981606 18:74788151-74788173 TTTTATTTATTTTTTCCTTATGG + Intronic
1160374567 18:78401660-78401682 TTTTTTTCATTTTTACTTTAAGG - Intergenic
1160390941 18:78532187-78532209 TTTTTTGTTTTTTCATTTTAAGG - Intergenic
1162219555 19:9164575-9164597 TTTTTTGCATTTTCAAATTAAGG + Intergenic
1164283092 19:23786464-23786486 TTTTAAGTATTGTCAATTTTGGG + Intronic
1164383607 19:27755255-27755277 TTATATGTACTTTTACTTTTTGG + Intergenic
1164492649 19:28728673-28728695 TGTTTTGTGTTTTCACCTTATGG - Intergenic
1165507722 19:36245080-36245102 TTTTATTTCTTTTGAGTTTAGGG + Intronic
1165582661 19:36881627-36881649 TTTTATGTCTTTTTAATTTGAGG + Intronic
1165639812 19:37374837-37374859 TGCTATCTGTTTTCACTTTAAGG - Intronic
1166577591 19:43857193-43857215 TTTTATGTATTTTCTTTCTCTGG + Intergenic
1167091299 19:47345883-47345905 TTTTATTTATTTTTATTTTTTGG + Intergenic
1167847776 19:52178525-52178547 TTTTTTGTATTTTGTATTTAGGG + Intergenic
1167956211 19:53066238-53066260 TACTATGTATTTTCACTTCATGG + Intergenic
1168357255 19:55709229-55709251 GTATATGAAATTTCACTTTATGG - Intronic
1168463258 19:56580084-56580106 TTTTATATCATTTCTCTTTATGG - Exonic
1168542807 19:57227118-57227140 TTTTCTGAATTTTGACTTTCAGG - Intergenic
1168637458 19:58007680-58007702 GTTTGTTTTTTTTCACTTTAGGG - Exonic
1168656973 19:58137102-58137124 TTTTATGTAGTTGTACTTTTAGG + Intronic
1168665748 19:58203751-58203773 TTTGAGGTATTTTCATTTTGGGG - Intronic
925028608 2:629622-629644 TTTAAAATATTTTTACTTTAAGG - Intergenic
925237043 2:2288503-2288525 TTTTGTGTATTTTACCTTTACGG - Intronic
925439771 2:3875188-3875210 TTTAAATTATTTTCAATTTAAGG - Intergenic
925486963 2:4345777-4345799 TTTTATTAATTTTCCCTATAAGG - Intergenic
926453616 2:13037803-13037825 TCTTATGTATTTTTGCTTAATGG + Intergenic
926479484 2:13373006-13373028 TTTTAGCTATTTTCGCTGTATGG - Intergenic
926505192 2:13705494-13705516 TTTAATTTATTTTGACTTGAGGG - Intergenic
926603779 2:14876140-14876162 TTTTATTTATTATCACTGTTGGG + Intergenic
928366044 2:30703864-30703886 TTATTTGTATTTTTACTTTTTGG + Intergenic
928643909 2:33331249-33331271 TTTTTTATATTTACACTTTGGGG + Intronic
928785394 2:34879073-34879095 CTTTATGAAATTTCATTTTATGG - Intergenic
928994273 2:37270305-37270327 TTTTACCTATTTTACCTTTAAGG + Intronic
929000458 2:37343277-37343299 CTTTATGTCTTTTCACAATATGG - Intergenic
929206021 2:39294223-39294245 TTTTATGTTTTGTAATTTTAAGG - Intronic
929225993 2:39512224-39512246 TTTTATGTCTTTCCAGGTTAGGG + Intergenic
929250909 2:39754023-39754045 TTTTATGTATTTTCACTTTAGGG - Intronic
929289586 2:40174296-40174318 TTTTATGTATTTTCTCAATATGG + Intronic
929483533 2:42335381-42335403 TGTTATTTATTTTCAAGTTAAGG - Intronic
929617122 2:43320141-43320163 TTTTATGTATTTTCTTTGAAAGG - Intronic
929630802 2:43459969-43459991 TTTTATGTGTTTTGAGTTTGAGG - Intronic
929849621 2:45572953-45572975 TTTTAGGTATCTTGACTTTTTGG - Intronic
930071622 2:47370191-47370213 TTATATGTTTTTACTCTTTACGG - Intronic
930131023 2:47850930-47850952 TTTTATGAATTTTGACTCTTAGG - Intronic
930242692 2:48952937-48952959 TTTTTTTTTTTTTCATTTTATGG + Intergenic
930539264 2:52684006-52684028 TTTTGTGTCTTGTGACTTTATGG - Intergenic
930693088 2:54384533-54384555 TTGTATGTCTTTGAACTTTAGGG + Intergenic
930881595 2:56276814-56276836 TTTATTGTATTTTAACTTGAAGG + Intronic
930957640 2:57222419-57222441 GTTTATCTATTTTTCCTTTAAGG - Intergenic
931124375 2:59257721-59257743 TTTTTTTTATTTTCTCATTATGG - Intergenic
931213227 2:60216964-60216986 TTTTTTTTTTTTTCACATTATGG + Intergenic
931242415 2:60465501-60465523 TTTTATTTCATTTTACTTTATGG + Intronic
931375494 2:61704043-61704065 TTTTATTTATTATTACTTTTGGG + Intergenic
931672205 2:64657586-64657608 TTTTATGAATTGTGACTTCAGGG - Intronic
931851848 2:66259205-66259227 TTGTGTGTATTTTCCCTTGAGGG + Intergenic
931924465 2:67056386-67056408 TTTTATGAATCTTAAGTTTAGGG - Intergenic
931928306 2:67099265-67099287 TTTTATGTAGTTGAACTTAATGG + Intergenic
932258542 2:70307654-70307676 ATTTATATTTTTTCCCTTTATGG + Intergenic
932293317 2:70602832-70602854 ATTTATGTATTTACCCTTGATGG + Intergenic
932650936 2:73555580-73555602 TTTATTATATTTTCCCTTTAGGG - Intronic
932727662 2:74193466-74193488 TTTTATTTATTTTTATTTTTGGG + Intergenic
932914529 2:75841675-75841697 TTTTATGTTCTTTCCTTTTATGG + Intergenic
933430665 2:82173382-82173404 ATTTATCTATTTTCAGTTTAAGG - Intergenic
933475332 2:82782498-82782520 TTTTATACATTGTAACTTTAGGG - Intergenic
933551286 2:83780043-83780065 TTTTATCTATTTCAAGTTTAAGG + Intergenic
933565654 2:83947378-83947400 TTATAAATATCTTCACTTTAAGG + Intergenic
933667921 2:84979598-84979620 TTTTATGAATATGCAGTTTAGGG - Intronic
933869827 2:86555188-86555210 TTTCATGTATTTTAACTTCATGG - Intronic
934163653 2:89274890-89274912 TTTAATAAATTTTCACTTAATGG - Intergenic
934203619 2:89907634-89907656 TTTAATAAATTTTCACTTAATGG + Intergenic
935232909 2:101114950-101114972 CTCTATGTATTGTCACTTTATGG - Intronic
935417808 2:102837239-102837261 TTTTTTGTTTTTCCAATTTAGGG + Intronic
936137556 2:109908706-109908728 CCTTATGTATTTTCTCGTTAAGG + Intergenic
936207141 2:110462779-110462801 CCTTATGTATTTTCTCGTTAAGG - Intronic
936637495 2:114275727-114275749 TTTTCTTTATTTTCTCTTTCAGG + Intergenic
936733297 2:115408842-115408864 TTTTATGTTTTTTAAAATTAAGG - Intronic
936747615 2:115597497-115597519 CTTTATGTTTTTTCTCTTTTTGG - Intronic
937754933 2:125525656-125525678 CTTTCTGTGTTTTCACTTTACGG - Intergenic
938986146 2:136578465-136578487 ATTTATTTATTTTTACTTTTAGG + Intergenic
939209819 2:139159838-139159860 TCTTATTTATTTTACCTTTAAGG - Intergenic
939267012 2:139887270-139887292 TTTAATGGTTTTTCTCTTTATGG - Intergenic
939407927 2:141783404-141783426 GTTCATGTATTTTGACTGTAAGG - Intronic
939512965 2:143129121-143129143 TTTTATCAATTTTAACTTAAGGG - Intronic
939848372 2:147275038-147275060 TCTTATGTGTTTTCATCTTAGGG + Intergenic
939925329 2:148166647-148166669 CTTTAAGTATTTTCACATGAGGG + Intronic
939925406 2:148167891-148167913 TTTTGTTTGTTTTCACTTTGGGG + Intronic
939925501 2:148169092-148169114 ATTCATATATTTTAACTTTAGGG - Intronic
940314903 2:152318529-152318551 CTTTCTTTATGTTCACTTTAAGG + Intergenic
940423138 2:153501778-153501800 CTTTATGTCTTTTCTCTTTGTGG - Intergenic
940568634 2:155402384-155402406 TTTTGTGTACTTCCAATTTATGG + Intergenic
940590302 2:155716066-155716088 TGTTAGGAATTTTCACTTGAAGG - Intergenic
940688957 2:156890567-156890589 GTTTATTTATTTTAATTTTATGG + Intergenic
940833065 2:158490095-158490117 TTTAAAATATTTTCAATTTAAGG + Intronic
941303932 2:163837320-163837342 TTTTCTCTATTTTCATTGTAAGG - Intergenic
941441906 2:165548705-165548727 TTTTAGGTACTTGCTCTTTAGGG - Intronic
941517511 2:166497700-166497722 TTTTATTTTATTTTACTTTATGG - Intergenic
941543916 2:166821520-166821542 TTTTATGTCTTATTGCTTTATGG - Intergenic
941732926 2:168938326-168938348 TTTTATGGATGTTTATTTTATGG - Intronic
941931921 2:170950160-170950182 TTTTATATATATTAATTTTAGGG + Intronic
941938742 2:171010264-171010286 TTTTGTGTTTTTTCACTTGAGGG + Intronic
942679145 2:178458500-178458522 TTCAATATAGTTTCACTTTATGG + Exonic
942712776 2:178856077-178856099 TATTATGTATTTTTACATGAAGG + Intronic
942959443 2:181812384-181812406 TTTTTTTTTTTTTCAGTTTAGGG - Intergenic
943099750 2:183473469-183473491 TTTTGTGTTTTTTAACCTTATGG - Intergenic
943203246 2:184858129-184858151 TATTATGTATTTTTGCTTTGTGG + Intronic
943497233 2:188636512-188636534 TTTAATGAAATTTCACTTTTTGG + Intergenic
943499892 2:188674578-188674600 TTTTAGGTATTTTCTATCTACGG - Intergenic
943522293 2:188967504-188967526 TTTAATTTATTTTTATTTTAGGG - Intergenic
943586953 2:189751972-189751994 TTTTTTGTATTTTTAGTTTTTGG - Intronic
943698536 2:190963279-190963301 TTTTGTGAATTTTCAATTTATGG + Exonic
944246905 2:197540089-197540111 ATTTATGTATTTGCATTTTCAGG + Exonic
944258705 2:197652850-197652872 TTTAATATATTTTCACTGAAGGG + Intronic
944326455 2:198410738-198410760 TTTTAAGTGATTTCACTTCAGGG + Intronic
944447042 2:199802426-199802448 TTTTATGCAATTTTAGTTTATGG - Intronic
944469730 2:200040209-200040231 TTTTTTATATTCTCACTTTCTGG - Intergenic
944559639 2:200923245-200923267 TTTTATTTATTTACTCTTTTTGG + Intronic
944759091 2:202794749-202794771 TTCTATGTATTTTATCTTTCTGG - Intronic
945015806 2:205514835-205514857 TTTTTTTTTTTTTTACTTTAAGG + Intronic
945310213 2:208303124-208303146 ATATATGTTTTTTTACTTTAGGG + Intronic
945502630 2:210595824-210595846 CTTTATATGTTTTCACTATAAGG - Intronic
945714738 2:213344389-213344411 TTTTTTGTATTTTAAGTTTTAGG + Intronic
945767325 2:213997073-213997095 TTTTTAGTATTTTCATTTTTAGG + Intronic
947013700 2:225593828-225593850 ATTTTTGTTTTTTCACTTAATGG - Intronic
947022197 2:225691817-225691839 TTCTCTGGATTTTCCCTTTAAGG - Intergenic
947038169 2:225884060-225884082 GTTTATGTAAGTTCACTTGATGG + Intergenic
947111917 2:226727862-226727884 TTTTACTAATTTTTACTTTACGG + Intergenic
947298384 2:228658997-228659019 GTTTATATATTTTCTCTTTCTGG + Intergenic
947465947 2:230346513-230346535 TTGTATGTTGTTTCACTTGATGG + Intronic
948026817 2:234785034-234785056 TTTTATGTATTTTATTTTTATGG - Intergenic
948068029 2:235096569-235096591 TTTTCTGTATCTTGACTATAGGG + Intergenic
948224991 2:236302073-236302095 TTTTATTTATTCTTAGTTTAAGG + Intergenic
948260077 2:236597650-236597672 TTTTTTTTCTTTTCACTTTGTGG - Intergenic
948537471 2:238656887-238656909 TTTTATGGATTTTCATTTTGAGG - Intergenic
1169361543 20:4953934-4953956 TGTTACTTTTTTTCACTTTAAGG - Intronic
1170150799 20:13223312-13223334 TTTTATTAGTTTTCTCTTTACGG - Intronic
1170269539 20:14508979-14509001 ATTTATGTATTTGCACTCAATGG + Intronic
1170972366 20:21127904-21127926 TTTTTTCTTTTTTTACTTTAAGG - Intronic
1172039518 20:32034281-32034303 TTTTATTTATTTTCATTTTCTGG + Intergenic
1172999625 20:39096269-39096291 ATTCATTTATTTTCACATTATGG + Intergenic
1173097928 20:40054782-40054804 TTTTATTTATTTTTATTTTTGGG - Intergenic
1174318812 20:49724430-49724452 ATTAATGCATTTTCAATTTACGG + Intergenic
1174786287 20:53436361-53436383 TTTTGTGAATTTTAACTTTATGG - Intronic
1174947927 20:55009278-55009300 TTTTTTGTGTGTTCATTTTAGGG + Intergenic
1176227378 20:64008954-64008976 TTTTAGGTATTTTTATTTAAGGG + Intronic
1176656900 21:9595190-9595212 TTTTATATATATACACTTTGGGG + Intergenic
1176766360 21:13023135-13023157 TTTTATGTTTTTTCTTTTTTTGG + Intergenic
1176816300 21:13607026-13607048 TTTTATTTATTTTAACTTCTGGG + Intergenic
1176979254 21:15360569-15360591 ATTTATGAATTTCCACTTTCAGG + Intergenic
1177118484 21:17113320-17113342 ATTTATTTATCTTCATTTTATGG - Intergenic
1177283039 21:19009613-19009635 TTTTATTTATTTTTATTTTTTGG - Intergenic
1177352840 21:19966963-19966985 TTTTATGTAATTTTAATTGAAGG + Intergenic
1177373662 21:20239815-20239837 TTTTGTGTATTTTCACACCATGG + Intergenic
1177493597 21:21860859-21860881 TTTTATATATGTACTCTTTAGGG + Intergenic
1177552469 21:22643363-22643385 TTTTCAGTATTTTCATTTTCAGG - Intergenic
1177946983 21:27482797-27482819 TTTTAATTATTTTTACTATAGGG - Intergenic
1177951703 21:27546195-27546217 TGTTGTGTAAATTCACTTTATGG - Intergenic
1178144681 21:29725343-29725365 TTTTATGTTTTTAAACTTTCAGG + Intronic
1178292734 21:31383268-31383290 TTTTAAGTATTCTGAATTTATGG - Intronic
1178293843 21:31392122-31392144 TTAAATGTATTTTCAACTTAAGG + Intronic
1179424124 21:41259998-41260020 TTTTTTGTATTTTCTCTAGAGGG + Intronic
1179914709 21:44468762-44468784 TTTTTTTTTTTTTCATTTTAGGG + Intergenic
1180564949 22:16655333-16655355 TTTTCTGTATTTTCTATTTCGGG - Intergenic
1180627115 22:17201037-17201059 TTTTTTGTATTTTCAGTAAATGG - Intronic
1182344430 22:29651078-29651100 TTTTATGGATTTTCATTTATAGG + Intronic
1182953449 22:34398685-34398707 TTTTATGTACTTTAAGTTTTAGG - Intergenic
1183332351 22:37228433-37228455 TTTTGTGGTTTTTCACTTCAGGG - Intronic
1183814319 22:40287005-40287027 TTTTATTTATTTTTATTTTTTGG + Intronic
1184869203 22:47223706-47223728 TTTTATGTCTTTCAACTTTATGG + Intergenic
1185198443 22:49487457-49487479 TTTTATGTATTTTCTGCTTGGGG + Intronic
949214598 3:1550668-1550690 GTATATTTATTTTCACTTTCAGG - Intergenic
949323325 3:2836521-2836543 TGTTATGTATTCCCATTTTATGG + Intronic
949454638 3:4225749-4225771 TTTTGAGTATTTGCACTTCAGGG - Intronic
949499952 3:4670359-4670381 GTTTAGGTATTTTCACATTTCGG + Intronic
949719025 3:6967185-6967207 TTTTATTTATTTTTATTTTTTGG + Intronic
950112471 3:10428347-10428369 TTTTTTCTATTTTTCCTTTAGGG + Intronic
950760937 3:15225629-15225651 TTTTCTTTTTTTTCTCTTTAAGG + Intronic
950973962 3:17220548-17220570 TTTTATGTCTTTTATTTTTAGGG + Intronic
951110744 3:18801167-18801189 TTATATCTATTTACAATTTAAGG - Intergenic
951154402 3:19331998-19332020 TTTTAAGTATTAGTACTTTAAGG + Intronic
951685058 3:25334699-25334721 ATTTATTTATTTTTACATTAAGG - Intronic
952145705 3:30529769-30529791 ATTTATGTATTTTAGCTTCAGGG - Intergenic
952300229 3:32098317-32098339 TTTTTTGTATTTTCAGTAGACGG - Intergenic
952452337 3:33443901-33443923 TTTTATTTATTTAAATTTTATGG + Intergenic
952485029 3:33801078-33801100 TATTAAGTATTTTCACTTTTTGG + Intronic
952833296 3:37583430-37583452 TTTAATGTATTTTCTGTTGAGGG + Intronic
953259514 3:41323987-41324009 ATTTCTGTTATTTCACTTTAAGG + Intronic
953372272 3:42398889-42398911 TTATTTGTATTTTGATTTTATGG - Intronic
954653501 3:52179441-52179463 TTTTATTTTTTTTCAGTATAGGG + Intergenic
956032491 3:65054259-65054281 TTTTATTTATTTTAAATTTTTGG - Intergenic
956078450 3:65531796-65531818 TTCTATTTATTCTCATTTTATGG - Intronic
956544320 3:70383333-70383355 TTTTTTTTATTTTTATTTTAAGG - Intergenic
956967916 3:74484882-74484904 TTTCATGCTTTTTCATTTTAAGG - Intronic
957363184 3:79185417-79185439 CTCTATGTATTTACACTATAGGG - Intronic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
957503443 3:81088553-81088575 ATTTCTGTATTTTTATTTTATGG - Intergenic
957665664 3:83222368-83222390 TACTATGTATTTTGAATTTATGG - Intergenic
957696989 3:83651409-83651431 TTTTCTGTCTTTTCACTATCAGG + Intergenic
957951989 3:87139384-87139406 TGTTATTTAATGTCACTTTAGGG + Intergenic
958688319 3:97427675-97427697 TTTTTTTTAATTTTACTTTAAGG - Intronic
958941850 3:100325530-100325552 TTTTTTGTATTTTCAAGATAAGG + Intergenic
958984128 3:100760887-100760909 TTTTTTAAATTTTCATTTTAGGG + Intronic
959142012 3:102496990-102497012 TTTTAATTATTTTAACTTTAGGG - Intergenic
959215305 3:103444755-103444777 TTTAATGTCTTTTCAGTTTGAGG + Intergenic
959218833 3:103488293-103488315 TTTTAAATATTTTTATTTTATGG - Intergenic
959245748 3:103865424-103865446 TTTTATGGAGGTTCACTTTATGG - Intergenic
959346794 3:105205171-105205193 TTCTATGTATTGTCATGTTATGG + Intergenic
959657155 3:108820924-108820946 TTTTCTGGAATTGCACTTTATGG + Intergenic
959800791 3:110493362-110493384 TTTTCTGTCTTTTCTCTGTAAGG + Intergenic
959837356 3:110935520-110935542 TTTTGTGATTTTTCCCTTTAGGG - Intergenic
960120482 3:113943913-113943935 TTTTATTTATTTTTATTTTTTGG - Intronic
960360829 3:116709059-116709081 TCTTTATTATTTTCACTTTATGG + Intronic
960452565 3:117828429-117828451 TTATATGTATTTTTAATTTTAGG - Intergenic
960472696 3:118087076-118087098 TTTTATTCATTTTCACATTTAGG + Intergenic
960599081 3:119437505-119437527 TTTTAAGTATTTTTAGTTTCTGG - Intronic
960866988 3:122211714-122211736 TTTTATTTATTTTTATTTTTTGG - Intronic
960934817 3:122891899-122891921 TTTTATAGATTTTTATTTTATGG + Intergenic
961176460 3:124839550-124839572 TTTTATGGATTTTCTTTTTTTGG - Intronic
962054358 3:131854139-131854161 TTTTATTCATTCTCCCTTTATGG - Intronic
962134083 3:132714862-132714884 ATTTATTTATTTTTACTTTCTGG - Intronic
962228965 3:133643136-133643158 TTTTATTTATTTTGACTTCTTGG - Intronic
962293432 3:134157361-134157383 TTTTATTTATTTTTACTCTCTGG - Exonic
962485952 3:135842497-135842519 CTTTTTTTCTTTTCACTTTAAGG - Intergenic
962587773 3:136860114-136860136 CTTAAGGTATTTTCAGTTTATGG + Intergenic
962631899 3:137285256-137285278 TGTTATTTATTTTCACTTAAAGG - Intergenic
962693375 3:137924125-137924147 CTTCATGTTTCTTCACTTTAGGG + Intergenic
963196804 3:142541245-142541267 TTTTTTGTTTTTTCCCTTGAAGG + Intronic
963218199 3:142774707-142774729 TTTTATGTATTTTTTTTTTGTGG + Intronic
963351401 3:144156251-144156273 TTTTATTTATTTTAAGTTCAGGG - Intergenic
963360262 3:144263580-144263602 TTTTATTTATTTTCTCCTTTGGG + Intergenic
963427145 3:145145142-145145164 CTTAATGTCTTTTCAATTTATGG - Intergenic
963446742 3:145420786-145420808 TTTTATGTCCCTCCACTTTAAGG - Intergenic
963505022 3:146173555-146173577 TTTTAATTCTATTCACTTTATGG - Intergenic
963507432 3:146204624-146204646 TTTTATGAGTTTTCCCTTTTAGG - Intronic
963572199 3:147012258-147012280 TTTTTTTTTTTTTCAGTTTATGG + Intergenic
963613043 3:147496224-147496246 TTTTATTTATTTCTATTTTATGG - Intronic
963969198 3:151410588-151410610 CTTTGTGTATTGTCACCTTATGG - Intronic
964224901 3:154387048-154387070 TTTTATATATATTCAGTTAATGG - Intronic
964275192 3:155001911-155001933 TTTTATGTATTTTATACTTATGG - Intergenic
964382156 3:156108092-156108114 TTATTTGTTTTTTCACTGTAGGG + Intronic
964547154 3:157847019-157847041 GTTTATGAATTCTCTCTTTAGGG + Intergenic
964565574 3:158048011-158048033 TTTTATATATGTTTACATTATGG - Intergenic
964592183 3:158377126-158377148 TTTTCAATATTTTCTCTTTATGG + Intronic
964592922 3:158386193-158386215 TTTTTTGTCTTTTAACTTTGTGG + Intronic
964735135 3:159909384-159909406 TTTTATTTCTTATAACTTTATGG - Intergenic
964978846 3:162653353-162653375 TTCTTTGTATTTTTCCTTTATGG - Intergenic
964989523 3:162790495-162790517 CCTTATATATTTTCCCTTTAAGG + Intergenic
965047816 3:163601738-163601760 TTTTAAGTATTTTATCTTTAAGG - Intergenic
965553087 3:169990098-169990120 TTTTATATATATTCATTTTTTGG + Intronic
965932637 3:174065035-174065057 TTTTATTTCTTTTTAATTTAAGG - Intronic
966114462 3:176444941-176444963 TTTTATACATTCTCAATTTAGGG + Intergenic
966364316 3:179166404-179166426 GTTTATGTTTTATCATTTTATGG + Intronic
966367543 3:179206225-179206247 TTTTTTGTATTTTCAGTAGAGGG + Intronic
966699433 3:182830387-182830409 TTTTATGTATTTTCCCCCTGGGG + Intronic
967456653 3:189694706-189694728 TGTTAGGTTTTTTCACTTTGAGG + Intronic
967620587 3:191629035-191629057 TTTTATTTATTTTTCCTGTATGG + Intergenic
967633678 3:191776698-191776720 ATGTATGTATTCTCACTATAAGG + Intergenic
967762292 3:193240286-193240308 TTTTATGTATTTTGTCATAATGG - Intergenic
967952226 3:194850268-194850290 TTTTATGTATTAACACTTTCTGG - Intergenic
968169250 3:196495995-196496017 CTTTATGTATTTTTAATTTATGG - Intronic
968595825 4:1483302-1483324 TTTTATCAATTTCCACTTAATGG + Intergenic
970252652 4:14132287-14132309 TTTTATGCTTTTACAGTTTACGG + Intergenic
970533724 4:17007969-17007991 TTTAATGTTTTTTCACTTGGAGG - Intergenic
970769842 4:19598420-19598442 TTTTATTTTTTTTTAATTTATGG + Intergenic
970800130 4:19963538-19963560 CTATATTTAATTTCACTTTATGG + Intergenic
971316740 4:25573975-25573997 ATTCATGGATTTTCACCTTAGGG + Intergenic
971441182 4:26687851-26687873 TTTTCTGTATTATGAGTTTAAGG - Intronic
971445039 4:26735466-26735488 TTTCATGGATTTTCAATGTATGG + Exonic
971580491 4:28332734-28332756 TTTCATTTAGTTTTACTTTAAGG + Intergenic
971639357 4:29110879-29110901 TTTCATATATTTTGACTATAGGG - Intergenic
971705926 4:30042726-30042748 TTTTATGTGTTTTGAAATTAAGG - Intergenic
971816718 4:31500198-31500220 ATTGATGTATTTTCAATTTTTGG - Intergenic
971835153 4:31752824-31752846 CATTAGCTATTTTCACTTTAGGG + Intergenic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
972185926 4:36528364-36528386 ATTTGAATATTTTCACTTTATGG + Intergenic
972435626 4:39031996-39032018 TTTTAAATATTTTCATTTTTAGG + Intronic
972493510 4:39610995-39611017 TTTGTTGTATTTTCATTTTATGG - Intronic
972528595 4:39940401-39940423 TTATACGTATATTCACTTTGTGG + Intronic
972581805 4:40401634-40401656 TTTTATGTATTTTTTTTTTGAGG + Intergenic
972617930 4:40718131-40718153 TTTTTTTTTTTTTTACTTTATGG - Intergenic
972763060 4:42125714-42125736 ATTTATTTATTTTCATGTTACGG - Intronic
972864254 4:43210953-43210975 CTTTATGTTTTTTCTTTTTATGG - Intergenic
972887150 4:43506722-43506744 TTTTAGGAATTTTCACTGGATGG - Intergenic
973583165 4:52364629-52364651 GTTTATATATTTTGACTTCATGG + Intergenic
973654118 4:53027897-53027919 TTTTATTTTTTTTTTCTTTATGG + Intronic
973667192 4:53173744-53173766 TTTTATGCATTTTTGCTTTGTGG + Intronic
974041618 4:56862810-56862832 TTTTATATATATTAATTTTAGGG + Intergenic
974055325 4:56977816-56977838 TTTTGGGTTTTTTCACTTTCAGG + Exonic
974109083 4:57505961-57505983 TCATCTGTATTTTCACTTTTGGG + Intergenic
974176382 4:58330994-58331016 CTCTATGAATTTTCACTTTAGGG + Intergenic
974393889 4:61310218-61310240 TTTTATATATTTTCATTTATTGG - Intronic
974423935 4:61715939-61715961 TTTTTTTTTTTTTTACTTTAAGG - Intronic
974465202 4:62246687-62246709 TTTTTTGTATTTTTTTTTTAGGG - Intergenic
974655337 4:64812069-64812091 TTTTATGTATATATATTTTATGG + Intergenic
974771465 4:66419906-66419928 TTTTATTTGTTTTCTCTTTAAGG - Intergenic
974869550 4:67622925-67622947 TTTTTTGGATATTCACTTTTAGG - Exonic
975151732 4:71030377-71030399 TTTTATGTATTTTAAAATAAGGG + Exonic
975266322 4:72373201-72373223 TTTTAACTATTTTAGCTTTATGG - Intronic
975373759 4:73618928-73618950 TTTTATGAAGTTTCACTTAAAGG - Intronic
975445231 4:74456308-74456330 TTTTCTGTATTTTCTCTTTCAGG - Intergenic
975775478 4:77782008-77782030 TTTTGTGTTTTTTCAATTTTAGG - Intronic
975881861 4:78919318-78919340 TTTTATGAATGTCTACTTTAAGG + Exonic
976112019 4:81685628-81685650 TTTTCTGTATTTTCAGTTGTGGG - Intronic
976204432 4:82611029-82611051 TTTTATGTATTTACTCTTCAGGG + Intergenic
976804345 4:89028753-89028775 TTTTATGTACTTTAAGTTTTAGG - Intronic
976862976 4:89688783-89688805 TTTTATATATGTTCACTTTCTGG - Intergenic
976906972 4:90249751-90249773 TTTGAGTTATTTTCACTTTTTGG + Intronic
976966284 4:91045400-91045422 TTTTATGCATTTTCACAATTAGG + Intronic
977355427 4:95940289-95940311 TTTTATTTAATTTTGCTTTATGG + Intergenic
977636315 4:99302545-99302567 TTTTGTATTTTTTCACTTCATGG - Intergenic
977841623 4:101713719-101713741 TTTTATATTTTCTCACTTGATGG + Intronic
978177346 4:105748326-105748348 TGTTTTGTTTTTTCACTTTCTGG + Intronic
978237758 4:106480432-106480454 ATTTATGTATTTTCAAGATAAGG + Intergenic
978263126 4:106787417-106787439 TACTATATATTTTCACTTTGTGG + Intergenic
978450613 4:108829028-108829050 TTTTATTCATTATTACTTTACGG + Intronic
978495293 4:109352915-109352937 TTTTATTTGTTTATACTTTAGGG + Intergenic
978639683 4:110855313-110855335 TTTTTTCCATATTCACTTTATGG - Intergenic
978747629 4:112211865-112211887 ATTCATGTAATTTCATTTTAAGG + Intergenic
978866353 4:113516924-113516946 CTTTATCTACTTTCTCTTTATGG - Intronic
979098169 4:116576940-116576962 TTTTATGTATTTTTCCTTGTTGG + Intergenic
979286564 4:118932178-118932200 TTATAAGAATTTTCACTTTGAGG + Intronic
979315732 4:119259650-119259672 TTTAATAATTTTTCACTTTATGG + Intronic
979501280 4:121443173-121443195 TTTTTTAAATTTTGACTTTAGGG - Intergenic
979591239 4:122482910-122482932 TTTTATGCTTTTTCTCTTTTTGG + Intergenic
980251220 4:130318170-130318192 ATTTATATATTTACCCTTTATGG - Intergenic
980267197 4:130532427-130532449 TTTTTTTTTTTTTCATTTTATGG - Intergenic
980416055 4:132489962-132489984 TTTGATTTATTTTTACTCTAAGG - Intergenic
980578082 4:134711575-134711597 TTTTCTTTATTTTCACTTTTGGG - Intergenic
980717625 4:136647773-136647795 TTTGCTGTATTTTCAGTTTATGG - Intergenic
980827897 4:138094007-138094029 CTGTATGTATTTTTACTATATGG + Intergenic
981620226 4:146688234-146688256 TTTTAAGGATTTGCATTTTAAGG - Intergenic
981927437 4:150155230-150155252 TGTTACGTATTTTTACTTTTTGG - Intronic
982177154 4:152716473-152716495 ATTTATTTATTTTTACTTTTTGG - Intronic
982653027 4:158110937-158110959 TTTTATGAAGTATCACTTTTTGG + Intergenic
983075778 4:163324731-163324753 TTTTTTTTTTTTTCACCTTAAGG - Exonic
983100278 4:163617320-163617342 TGTTAGCTATATTCACTTTATGG - Intronic
983390535 4:167125229-167125251 TTTTATTTATTTTTATTTTTTGG + Intronic
983443672 4:167820891-167820913 CCTTATGGATTTTCACCTTATGG + Intergenic
983548370 4:168987859-168987881 TTTTATTCATATTCAATTTATGG - Exonic
983758164 4:171368367-171368389 TTTAATGTATTTTAACTTGAAGG - Intergenic
984109868 4:175599463-175599485 TTTAATGTATTTTAAATTGATGG - Intergenic
984258462 4:177415104-177415126 TTTTATTTTATTTTACTTTATGG - Intergenic
984343714 4:178491702-178491724 TTTTCTGTCTCATCACTTTAGGG - Intergenic
984642936 4:182189920-182189942 TTTTGTGGATTTTGCCTTTAGGG + Intronic
986017621 5:3771458-3771480 TTTTATTTTTGTTCACTTAAAGG - Intergenic
986185497 5:5432439-5432461 TTTAATTTATGTTCACTTTTTGG + Intronic
986204598 5:5611520-5611542 TTTGATGTCTTTTCACTCTAAGG + Intergenic
986340229 5:6782785-6782807 TTTTATGTTTTTTCCCTTATTGG + Intergenic
986584120 5:9297058-9297080 TTTCATGTATTTTCTCATAATGG - Intronic
986928043 5:12782787-12782809 TTTTATATTATTTTACTTTAGGG + Intergenic
987378462 5:17260114-17260136 TGTTATTTATTTGCACTTAACGG - Intronic
987561564 5:19530307-19530329 TTTTATATATTTAAACTTTGAGG - Intronic
987632935 5:20499406-20499428 TTCTAAATATTTTCACTTCAAGG + Intronic
987781187 5:22437474-22437496 TTTAATGTATTCTCACTTTATGG - Intronic
987999085 5:25326863-25326885 TTGTATGTACTTTAACTATAGGG + Intergenic
988322904 5:29723408-29723430 TTATATGCAGTTTCACTTTCTGG + Intergenic
988350777 5:30104828-30104850 TTTTATTTATCTGCAATTTAGGG + Intergenic
988463781 5:31467667-31467689 TTGTATGTTTTTAAACTTTAAGG - Intronic
988515122 5:31897905-31897927 TTTTTTGTATTTTTATTTTTTGG + Intronic
989608742 5:43271694-43271716 GTGTATGTATTTTAACTCTATGG + Intronic
989665123 5:43845317-43845339 TTTTATTTTTTTTGACTTTTTGG + Intergenic
989796908 5:45485413-45485435 TTTTTTGTACTTTCACATTTTGG - Intronic
989809366 5:45654414-45654436 TTCTAAGTATTTTCATTTGATGG + Intronic
989998815 5:50868241-50868263 GTTTTTTTATTTTTACTTTAAGG + Intergenic
990079959 5:51900332-51900354 TTTTCTGTATTTTAATTGTAGGG + Intergenic
990198853 5:53348535-53348557 TTTTTTTTTTTTTCACTTTAAGG + Intergenic
990204985 5:53419163-53419185 TTTTATGTGTTTTCAATTGGGGG - Intergenic
990343045 5:54843513-54843535 ATTTATGTATAATTACTTTATGG - Intergenic
990521558 5:56586373-56586395 TTCTCTGTATTTTCACTTGTTGG - Intronic
990772052 5:59258934-59258956 TTTTATTAATTTTCAAATTAAGG + Intronic
990824408 5:59881132-59881154 ATTTATTTATTTTTACTTTTGGG + Intronic
990857693 5:60288688-60288710 TTTTATGTGCTTTCAGTTTGAGG + Intronic
991133057 5:63148385-63148407 TTTAAAGTAGTTTAACTTTAAGG - Intergenic
991163740 5:63536708-63536730 TTTTATGTAAGTTAAATTTATGG - Intergenic
991334079 5:65527095-65527117 TTTTATTTATTTTTATTTTTGGG - Intronic
991382655 5:66047384-66047406 TTTTAATTATTTCCACTTTTTGG + Intronic
991483463 5:67108969-67108991 TTCTCTGTATGTTCACTTTTAGG - Intronic
991672387 5:69061741-69061763 GTGTATGTATTTTTAATTTAAGG + Intergenic
991919778 5:71644376-71644398 TTTATTGTATTTTTACTTTTTGG + Intronic
992755056 5:79896319-79896341 TTTTATTTATTTTTATTTTGTGG + Intergenic
992917177 5:81468773-81468795 GTTTATTTACTTTTACTTTAAGG + Intronic
992970629 5:82053436-82053458 TGATATGTCTTTTGACTTTATGG + Intronic
993132000 5:83910194-83910216 CTTTATGTATTGTCATCTTAAGG + Intergenic
993136845 5:83979657-83979679 GTTTATATTTTTTAACTTTAAGG + Intronic
993145591 5:84089693-84089715 TGTGATGTATTTTCACATTTTGG + Intronic
993193752 5:84712966-84712988 TTTTATGCATTTGTTCTTTAGGG + Intergenic
993212464 5:84970474-84970496 TTTTATTTATTTTTATTTTGGGG - Intergenic
993223326 5:85132529-85132551 TTTTAAGCATCTTCACTTTTTGG - Intergenic
993224369 5:85147944-85147966 ATTTTTGTTTATTCACTTTAAGG + Intergenic
993487966 5:88509785-88509807 TTTTAGCTGTTTTCTCTTTAAGG + Intergenic
993666204 5:90699605-90699627 TTTAATGAATTTTAACTGTAGGG + Intronic
993782291 5:92082294-92082316 TTCTGTGTTTTTTCACTTCAAGG - Intergenic
994023235 5:95052028-95052050 TTTTTTGTTTTTTAACTTTTAGG - Intronic
994332559 5:98524354-98524376 TTTTATGTTTTCTTATTTTATGG - Intergenic
994456501 5:100014811-100014833 TTTTGTATATTTTTAATTTATGG - Intergenic
994806530 5:104454832-104454854 ATATGTGTATTTTCTCTTTATGG + Intergenic
994877547 5:105445270-105445292 TTTTATCAATATTCGCTTTATGG - Intergenic
994984809 5:106918898-106918920 TTTTATGTCTAATCACATTAAGG + Intergenic
995306940 5:110663110-110663132 TTTCAATTATTTTCAATTTATGG - Intronic
995391536 5:111645573-111645595 TTTTATTTAGTCTCACTCTAAGG + Intergenic
995476497 5:112553634-112553656 ATTTATTTATTTTAACTGTATGG + Intergenic
995711345 5:115039261-115039283 TTCTATTTATTTTAGCTTTATGG + Intergenic
995733489 5:115272093-115272115 TTTTTTGTATTTTTAGTATAGGG + Intronic
995841008 5:116443248-116443270 TTTTATGCATTTTCTTTTTATGG - Intergenic
995906105 5:117125506-117125528 CTTTAGGTAGTTTCACTTTTTGG + Intergenic
996031221 5:118706009-118706031 TTTTATGTCTTTTCCCCTTGGGG - Intergenic
996507232 5:124281136-124281158 TTTGATGTATGTACACGTTATGG + Intergenic
996685463 5:126275415-126275437 TTTTATGTATTTATAATGTAAGG + Intergenic
996686006 5:126281447-126281469 TTTAATCTCTTTTCACTCTAGGG + Intergenic
996946210 5:129072128-129072150 TTTTATGTGTTTTATCATTATGG - Intergenic
997016432 5:129940777-129940799 ATATATGTTTTTTCACTTTCAGG + Intronic
997087055 5:130813937-130813959 TTTTTTGCATTTTAAGTTTATGG + Intergenic
997299710 5:132793730-132793752 TTTTGTTTATTTCCACTTGAGGG - Intronic
997922111 5:137991556-137991578 TTTTATTTACTTTGGCTTTATGG - Intronic
997970615 5:138398439-138398461 TTTTATTTTCTTTCACTTAACGG + Intronic
998806467 5:145921891-145921913 TGCTATTTATTTTCACTTAAAGG + Intergenic
998881617 5:146651144-146651166 TTTTATGTCTTTTCATCTCATGG + Intronic
998907427 5:146921184-146921206 TTTTATTAATTAGCACTTTATGG - Intronic
998912955 5:146980660-146980682 TTTTATGTATTCTAATTTTATGG + Intronic
999036179 5:148353101-148353123 TTTTAAGTAATTGCACTTAAAGG + Intergenic
999215681 5:149932991-149933013 TTTTATGTATTTATTTTTTAGGG + Intronic
1000126948 5:158254676-158254698 TTATATGTTTTTTCATTTAATGG + Intergenic
1000150122 5:158491981-158492003 TTTTATCTATTTTTTCTTTTAGG + Intergenic
1000306310 5:159997638-159997660 TTTTATCCATTGTCCCTTTAGGG - Intergenic
1000510843 5:162180641-162180663 TTTTATTTATTTTTATTTTTTGG + Intergenic
1000863214 5:166481646-166481668 GGATATATATTTTCACTTTAAGG - Intergenic
1000910120 5:167012046-167012068 TCTTCTGTATTTTCATTTTATGG - Intergenic
1000942476 5:167378922-167378944 TTTTTTGTTTTTTCCCTTTCTGG - Intronic
1000994904 5:167948904-167948926 TTTCATGTATTTTGGCTTTTTGG + Intronic
1001067602 5:168550317-168550339 TTAAATGTATTTTCAACTTACGG + Exonic
1001366124 5:171141898-171141920 TTTTATATACTTTCATTTTTTGG + Intronic
1001907002 5:175480940-175480962 TTTAATGACTTTTCACTTTCTGG - Intronic
1002206240 5:177564571-177564593 TTTTTTGTATTTTCAGTAGACGG + Intergenic
1002338798 5:178500829-178500851 TTGTTTGTTTTTTCATTTTAGGG - Intronic
1002378918 5:178810897-178810919 TTATATATATGTTCACTTTTTGG - Intergenic
1002667852 5:180839755-180839777 TTTTATTTATTGTAACTTTTAGG - Intergenic
1002808318 6:601062-601084 TTTTATGTCTTTCTTCTTTAGGG + Intronic
1002833378 6:844509-844531 TTTTCAGTATTTTCATTTTGTGG - Intergenic
1003203155 6:3981787-3981809 TTTATTGTCTTTTAACTTTAAGG + Intergenic
1003565872 6:7221566-7221588 TTTTATGTCTTTTGACTTATAGG + Intronic
1003666021 6:8112204-8112226 TTATATAAATTTTCACTGTAGGG + Intergenic
1003781917 6:9438643-9438665 TTTTATGTATATTAACTTAACGG + Intergenic
1004267498 6:14161656-14161678 TTTTTTGTATTTTTACTAGACGG + Intergenic
1004433840 6:15570747-15570769 TTTTGTAAATTTTCACTTAAAGG + Intronic
1004625109 6:17367523-17367545 TTTTATTTATTTCTACTATATGG + Intergenic
1005365994 6:25077550-25077572 TTACACGTATGTTCACTTTAGGG + Intergenic
1005587118 6:27287791-27287813 TTGTTTTCATTTTCACTTTAAGG + Intronic
1005682465 6:28220199-28220221 GTTTATGTATTTTTAACTTAAGG + Intergenic
1007015196 6:38459015-38459037 TTTTATTTATTTTTATTTTTTGG + Intronic
1007389858 6:41544978-41545000 TTTTATGTATTTGCCTTTTTGGG - Intergenic
1007461624 6:42023333-42023355 TCTAATGTATTTTCTCTGTAAGG - Intronic
1007559038 6:42790624-42790646 TTTTCTCTAATCTCACTTTACGG - Intronic
1007893982 6:45328645-45328667 TGGTTTGTATTTTCAGTTTAAGG + Exonic
1008233758 6:49018456-49018478 TTGTATGTTTTTTTACTTTTTGG + Intergenic
1008266819 6:49438226-49438248 TTTTTTGTATTATCATTCTATGG + Intronic
1008379842 6:50828735-50828757 TATGATGAATTTTCACTTTGGGG + Intronic
1008705975 6:54159559-54159581 TTTTATAGTTTTTCACCTTACGG + Intronic
1008727424 6:54439884-54439906 TTTTCTCTACTTTCTCTTTAAGG + Intergenic
1009247378 6:61255932-61255954 TTTTATATATTTCCAATTTAGGG + Intergenic
1009265081 6:61544233-61544255 TTTTATTTATTTTAATTTTTAGG - Intergenic
1009542722 6:64983820-64983842 TTTTATGACTTTTCTGTTTAAGG - Intronic
1009661357 6:66615451-66615473 TTTCATGAGTTTTAACTTTAAGG - Intergenic
1009687636 6:66985088-66985110 TGTTCTCTATTTTCTCTTTAAGG + Intergenic
1009747784 6:67841362-67841384 TTTTTTATATTTTAAGTTTAGGG + Intergenic
1009976835 6:70680313-70680335 TTTTCTCAATTTTAACTTTATGG - Intronic
1010104080 6:72147661-72147683 CTTTATGTCTTTTCTCTTTGTGG - Intronic
1010131766 6:72502562-72502584 TTTTATGTCTGTTTACTTTAGGG + Intergenic
1010176540 6:73034045-73034067 TTTTGTGTATTTCCACATTTTGG + Intronic
1010382201 6:75238348-75238370 TTTTTTTTACATTCACTTTAGGG - Intronic
1010553130 6:77247669-77247691 TTCTTTTCATTTTCACTTTATGG - Intergenic
1010673603 6:78716295-78716317 TTTTTTGTTTTTTCTATTTAGGG - Intergenic
1010920085 6:81670239-81670261 TTTTTTCCATTTTCATTTTAGGG - Intronic
1010958853 6:82122705-82122727 TTTAAATTATTTTCACTTCATGG + Intergenic
1011182809 6:84640351-84640373 TTTGTTGTATTTTCACATAATGG + Intergenic
1011724183 6:90191776-90191798 TTTTAAGTATTACCATTTTATGG - Intronic
1011840812 6:91496159-91496181 TCTTATGGAGTTTCATTTTAAGG - Intergenic
1012216827 6:96597308-96597330 TTTAATGAATTTTCCCTTAAGGG + Intronic
1012325629 6:97912822-97912844 TTTTTTTTTTTTTCAATTTATGG + Intergenic
1013050310 6:106527511-106527533 ATTTATGGATTCTTACTTTAAGG + Intronic
1013571137 6:111427162-111427184 TTTTATTTATTTGCATTTGAAGG - Intronic
1013723959 6:113069528-113069550 TTTTTTTTCTTTTCACTTTATGG - Intergenic
1013728498 6:113132654-113132676 TTTTTTGTATTTGTACCTTAAGG + Intergenic
1014315580 6:119860735-119860757 TTTTATTTATTTTCGCTTGGAGG - Intergenic
1014318533 6:119896821-119896843 TTTTATTTCTTTTCTCTTTATGG + Intergenic
1014562261 6:122905694-122905716 TTTTTTGTCTTTTTGCTTTAGGG + Intergenic
1014585818 6:123196469-123196491 TTATAAGTATATTCACTTAATGG - Intergenic
1014693340 6:124588934-124588956 TTTTGGGTATTTTCCCGTTATGG + Intronic
1014769915 6:125449153-125449175 TTTTATCTATTATTTCTTTATGG - Intergenic
1015127859 6:129774392-129774414 TTCTATGTACTATCAATTTAGGG + Intergenic
1015500229 6:133924152-133924174 TTTTCTGTATGTTCACAATAGGG + Intergenic
1015742574 6:136472830-136472852 TTTTATTTATTTTTTTTTTAGGG - Intronic
1016129711 6:140452298-140452320 TTTTTTGTATTGTCTCTTTCTGG + Intergenic
1016174704 6:141066540-141066562 TTTTATTTCTTTTAACTTTTAGG - Intergenic
1016196535 6:141350168-141350190 TTTTAGGTATTCTAACTTGATGG - Intergenic
1016401995 6:143690896-143690918 TTTTCTGTGTTTTTATTTTAGGG + Intronic
1016598234 6:145825688-145825710 TTTAATGTATTTTTAATTTAGGG + Intergenic
1016754103 6:147664603-147664625 TTTTATTTATTTTCATTATATGG - Intronic
1017566019 6:155687714-155687736 TTTTTTTTATTATAACTTTAGGG - Intergenic
1017715528 6:157208811-157208833 TTTTATATATTTTTTCATTAGGG + Exonic
1018572016 6:165221955-165221977 TTTTAGATATTTTCTCATTAGGG - Intergenic
1018692247 6:166356295-166356317 TGCTATGTATTTTCTCATTATGG - Intergenic
1018827309 6:167418787-167418809 TTTTATGACTTTTCAATTTCAGG - Intergenic
1019841875 7:3454185-3454207 TTTTATGTATTCTTACTGTATGG - Intronic
1020735485 7:11944027-11944049 TTTTATGTTTTTTAAGTTCAGGG + Intergenic
1021144127 7:17064722-17064744 TATTATGAAATTTCACTTGAGGG + Intergenic
1021273476 7:18621689-18621711 TTTTATATATTTTGACACTAAGG - Intronic
1021296688 7:18916753-18916775 TTCTATGTATGTACACTTTTTGG - Intronic
1021476081 7:21062749-21062771 TTATTTTTATTTTCATTTTATGG - Intergenic
1021551417 7:21874885-21874907 TCATATGTATTTCCTCTTTAGGG - Intronic
1022431112 7:30321872-30321894 TTTTTTGTAGTTTCATTTTTAGG + Intronic
1022591988 7:31672239-31672261 TATGATGTATTTTCTCTTTTTGG - Intergenic
1022693592 7:32682687-32682709 TTTTATATACTTTCAGTTTTAGG + Intergenic
1023179007 7:37462434-37462456 TTTCATCTATTTTCACTTTTGGG + Intergenic
1023701842 7:42899924-42899946 TTTTATATATTCTCATTTTCTGG - Intergenic
1023918943 7:44611782-44611804 TTTTTTATGTTTTCACTTTATGG + Intronic
1023977122 7:45038917-45038939 ATTCATATATTTTCATTTTAGGG - Intronic
1024002295 7:45198601-45198623 TTTTTTTTAAATTCACTTTATGG + Intergenic
1024334105 7:48187653-48187675 TAGTATGTATTTTCTTTTTATGG + Intronic
1024623079 7:51180068-51180090 CTATTTGTATTTTCATTTTATGG + Intronic
1024815664 7:53267537-53267559 TTTTATGTATCTTTACATGATGG + Intergenic
1024840919 7:53586538-53586560 TTTTATTTATTTTTATTTTTTGG - Intergenic
1024957372 7:54937367-54937389 TTTTATCTCCTTTCACTTTGCGG - Intergenic
1024979800 7:55147582-55147604 TTTGTTTTATTTTCATTTTATGG + Intronic
1025298403 7:57795505-57795527 TTTTTTAAATTTTCACTTTTTGG + Intergenic
1026135064 7:67652774-67652796 TTTTATTTTTTTTCTCTTTAGGG + Intergenic
1026209142 7:68287828-68287850 ATCTATGTAAGTTCACTTTAAGG - Intergenic
1026215267 7:68342887-68342909 TGTTAAGTATGTTCCCTTTAGGG + Intergenic
1026375657 7:69748028-69748050 ATTTATGGATTTTTTCTTTAGGG + Intronic
1026470191 7:70688511-70688533 TTTTGTTTATTTTCTCTGTATGG - Intronic
1027126801 7:75562470-75562492 TTTTATGTATTTATATTTTTAGG + Intronic
1027247295 7:76375799-76375821 ATTTATTTATTTTTACTTTCTGG + Intergenic
1027435215 7:78157238-78157260 GTTTATTTCTTTTCAATTTAGGG - Intronic
1027751892 7:82159620-82159642 TTTTATTTTCTTTCACTTTTTGG - Intronic
1027942307 7:84698765-84698787 TTTGATATATTATCATTTTAAGG - Intergenic
1028242220 7:88435350-88435372 CTTTATGTCTTTTCATTTAAGGG - Intergenic
1028302500 7:89218133-89218155 ATTTATGTATTTTTTCTTAAAGG + Exonic
1028363606 7:89999181-89999203 TTTTATTTATTTTGTGTTTATGG - Intergenic
1029488573 7:100857945-100857967 ATTTTTGTATTTTTATTTTATGG - Intronic
1029539406 7:101173892-101173914 TTTTATTTATTTTTATTTTTTGG + Intronic
1029835269 7:103302692-103302714 TTTTAATTAAGTTCACTTTAAGG - Intronic
1029897219 7:103996002-103996024 TTTTGGCTATTTTCAGTTTAGGG + Intergenic
1030009064 7:105147918-105147940 TTTGGGTTATTTTCACTTTAGGG + Intronic
1030208870 7:106976990-106977012 TTTTATGTGTTTTCCCTTTCTGG - Intergenic
1030399720 7:109033226-109033248 TTTTCTTTAATTTTACTTTAAGG - Intergenic
1030409351 7:109155994-109156016 TTTTCTGTCCTTTCACTTTTTGG + Intergenic
1030424704 7:109359887-109359909 TTTTAGCTATTTCCAGTTTATGG + Intergenic
1030606813 7:111646424-111646446 TTTTTTTTTTTTTCTCTTTAGGG + Intergenic
1030760405 7:113343073-113343095 TTTTATATTTTTTAACTTTTAGG + Intergenic
1030849353 7:114463594-114463616 TTTTATGTGTAATCATTTTATGG + Intronic
1030961176 7:115925155-115925177 TTTTATTTATTTTCCTTTTCTGG - Intergenic
1031178958 7:118391133-118391155 TTTTTTGTATTTTCATTAGAGGG + Intergenic
1031211809 7:118838664-118838686 TTTTCTGTATTTTTATTTTCTGG + Intergenic
1031220224 7:118956389-118956411 TTTTTTGTTTTTTCCTTTTAAGG + Intergenic
1031307946 7:120156780-120156802 TTTCAAGTATATTCACTTTAGGG - Intergenic
1031354401 7:120773208-120773230 TTTTATATAATTTCAATTTATGG + Intergenic
1031388540 7:121183696-121183718 TTCTATGTATTTTAATTTTCAGG + Intronic
1031631797 7:124052081-124052103 TTTTACCTATTTCAACTTTAAGG + Intergenic
1032107296 7:129043891-129043913 TTTTCTGTATTTTGGCTTTCAGG - Intronic
1032680175 7:134174282-134174304 TCTTATCCATGTTCACTTTAAGG - Intronic
1032828594 7:135597520-135597542 TTTAATGTATTTTTATTTGAAGG + Intronic
1032970200 7:137152352-137152374 TTTGCTGTATTTTCAGTTTGGGG + Intergenic
1033309471 7:140250265-140250287 TTTTCTGTATTCTCTCTTTATGG + Intergenic
1033521154 7:142161566-142161588 TTGTATGTCTTTTCACTGTAAGG + Intronic
1033896942 7:146083734-146083756 TTTTAATTCTTTTCACTTTCTGG - Intergenic
1033915534 7:146320496-146320518 TTTCATTTATTTTCATGTTACGG + Intronic
1034089863 7:148353621-148353643 TTTTAAGTATTTTCATTTTCAGG + Intronic
1034856691 7:154555742-154555764 TTTTCTCCATTTTCACTTCAAGG - Intronic
1035734658 8:1879379-1879401 TTTTATGTATTTTTATTTATTGG + Intronic
1035819161 8:2573245-2573267 TTTTATATATTTTGACACTAAGG + Intergenic
1035876863 8:3199918-3199940 TTTAAAACATTTTCACTTTATGG + Intronic
1036023608 8:4877833-4877855 GTTTAAATATTTTCACTTGAAGG - Intronic
1036055494 8:5248592-5248614 TTTTATGTATTTCTATTTAAAGG + Intergenic
1036828999 8:12006124-12006146 TTTTGTTTATTTTCAATTTTGGG + Intergenic
1036834231 8:12046080-12046102 TTTTGTTTATTTTCAATTTTGGG + Intergenic
1036856075 8:12292645-12292667 TTTTGTTTATTTTCAATTTTGGG + Intergenic
1036993119 8:13622135-13622157 TTTTTAATATTTGCACTTTATGG - Intergenic
1037066529 8:14585425-14585447 TTTTTTCTATTTTCATTGTAGGG + Intronic
1037067308 8:14597884-14597906 TTTTGTATATTTACTCTTTAGGG - Intronic
1038370925 8:26989607-26989629 TTTTATCTATTCTCTCTTTCTGG - Intergenic
1038550738 8:28466373-28466395 GTTTTTGTTTTTTCATTTTAGGG - Intronic
1038769910 8:30467888-30467910 TTTTATGTATTTATACATTTTGG - Intronic
1039055188 8:33530620-33530642 TTTTATTTATTTTTATTTTGTGG + Intergenic
1039532403 8:38275233-38275255 CTTTATTTATTTTCATTTTTAGG - Exonic
1039570846 8:38585401-38585423 TATTATGAATTTTCAGTTTTAGG + Intergenic
1040696927 8:50010963-50010985 GTATATATATTTTCAATTTAGGG - Intronic
1040751638 8:50716607-50716629 TTTTTTGAATATTTACTTTAGGG - Intronic
1041282149 8:56221178-56221200 TGAGCTGTATTTTCACTTTATGG + Intergenic
1041328763 8:56699358-56699380 GTTTTTGTATTTTCACTTACTGG - Intergenic
1042425783 8:68646387-68646409 TTTGATATATTTTTATTTTATGG + Intronic
1042458818 8:69038241-69038263 TTTTATGTATTTGCATTTGTTGG + Intergenic
1043652929 8:82621334-82621356 TTTTATGTAATTATATTTTATGG + Intergenic
1043734707 8:83729051-83729073 CTTTATGTCTTTTCACTTCTTGG - Intergenic
1043739203 8:83788197-83788219 TTTTAAGTATTTTAAATTTGAGG - Intergenic
1043827796 8:84949773-84949795 TTTTTTGTCTGTTCACTTTGGGG + Intergenic
1043957501 8:86378058-86378080 TTTTAATTATTTTCACTTTATGG + Intronic
1044144819 8:88699541-88699563 TTTTATGTATTATAAATTTAAGG - Intergenic
1044461379 8:92448620-92448642 TTTTTTGTATTTTAAAATTAAGG + Intergenic
1044564986 8:93653093-93653115 TTTTTTGCATTTTCAAATTAAGG + Intergenic
1044795728 8:95895416-95895438 TTTCATGTATTTTCAATATTTGG + Intergenic
1045572395 8:103381604-103381626 TTTTATGTTTTTTCACTATGAGG + Intronic
1045787014 8:105933658-105933680 TTTTATTTATTATCATTGTATGG - Intergenic
1045818909 8:106311860-106311882 TTTTTTATCTTTTCACTTTCCGG + Intronic
1046243120 8:111525651-111525673 TTTCATATATTTTCAGTTTTTGG + Intergenic
1046363532 8:113194030-113194052 TTTTATATTTTTTCCATTTATGG - Intronic
1046611180 8:116427262-116427284 TTTTATTTTTTTAGACTTTAAGG - Intergenic
1048653460 8:136507724-136507746 TTTTATATATTTTTATTTTTAGG - Intergenic
1048680895 8:136840375-136840397 TTTTATGTATTTTAACCTTATGG - Intergenic
1049100564 8:140575931-140575953 GTTTATGAATTTTTCCTTTAGGG - Intronic
1050226142 9:3457729-3457751 TTATATGGTATTTCACTTTAAGG + Intronic
1050466572 9:5931610-5931632 CTTTATGTATTTTCAGTCTGGGG + Intronic
1050569544 9:6923106-6923128 TTTAATGTTTTTACTCTTTACGG + Intronic
1050654373 9:7810067-7810089 TTATATGTTTTTTTTCTTTAAGG + Intronic
1050973344 9:11906097-11906119 TTTTAAATATTTTGACTTTACGG + Intergenic
1050998092 9:12245123-12245145 TATTCTGTAATTTCAATTTAAGG - Intergenic
1051012481 9:12434913-12434935 TTATATGTATCTTCATTTTAAGG + Intergenic
1051144269 9:14009929-14009951 TTTTCTGTATTTTTATTCTAAGG - Intergenic
1051664875 9:19459174-19459196 TTTTAAGTATTTTTAATCTAAGG - Intergenic
1051667698 9:19480918-19480940 TTTTATGTTTTTACATTTTTTGG + Intergenic
1051690100 9:19702837-19702859 ATTTATTTATTTTCTATTTATGG - Intronic
1051831080 9:21277762-21277784 TATCATGTATTTTTACTTTGTGG - Intergenic
1051901490 9:22047707-22047729 TTCTAAATATTTTCCCTTTAAGG + Intergenic
1052160544 9:25253278-25253300 AATTATGTATTTTAATTTTAAGG + Intergenic
1053679723 9:40476992-40477014 TTTTAAATATTTTAACTTTTAGG - Intergenic
1054292804 9:63312528-63312550 TTTTAAATATTTTAACTTTTAGG - Intergenic
1054504899 9:65899306-65899328 TTTTAAATATTTTAACTTTTAGG + Intergenic
1055050867 9:71979148-71979170 ATTTATGTTGTTTCATTTTAAGG - Intronic
1055120957 9:72660216-72660238 TTTTCTGATTTTTCACTTCATGG + Intronic
1055448991 9:76413458-76413480 TTTTCTGTAATTTCATCTTAAGG - Intergenic
1055470810 9:76608439-76608461 TTTTTTGAATTTTTACTTTTTGG + Intergenic
1055700926 9:78945087-78945109 TTTTCTGTGTTTGCACTTAAAGG + Intergenic
1056023232 9:82463690-82463712 TTTGATGTATTTTCTCATTTGGG - Intergenic
1056450033 9:86707733-86707755 TTTCATGCATTCTCACCTTAGGG - Intergenic
1056683336 9:88739185-88739207 TTTGATATATTTTTACATTATGG + Intergenic
1056923330 9:90811187-90811209 TTGTATATTTTTTCATTTTATGG - Intronic
1056993659 9:91434608-91434630 TTTTTTGTCTTTTAATTTTAAGG - Intergenic
1057420835 9:94910862-94910884 TTTTATGTAGTTCAACTTAAAGG + Intronic
1057771501 9:97972182-97972204 TTATATGTATTTTTCCTTTAGGG + Intergenic
1057932635 9:99209131-99209153 TTAAATGTTCTTTCACTTTAAGG + Intergenic
1058022865 9:100108229-100108251 TTTTAAGGATTTTCTCTTTGGGG - Intronic
1058358770 9:104116417-104116439 TTTTTTGTATTTTAATTTTGTGG - Intronic
1058398408 9:104583377-104583399 TTTGATCTATTTTCAATTAATGG - Intergenic
1058498552 9:105587497-105587519 CTTTATCTTTTTTCACTTTTGGG + Intronic
1058524843 9:105847077-105847099 TTTTATGTAATTTTTGTTTAGGG - Intergenic
1058708398 9:107656765-107656787 TTTTATATAATTTGACTTTCAGG - Intergenic
1058782855 9:108355944-108355966 TTTTAAGTAGTTTTATTTTATGG - Intergenic
1058788563 9:108417246-108417268 TTTTATGTATTTATACATTTTGG - Intergenic
1058858076 9:109086256-109086278 TTTTATGTATTTTTAATTGTTGG - Intronic
1059097802 9:111437656-111437678 TTTTGAGTTTTTTCATTTTAGGG - Intronic
1059116176 9:111601755-111601777 TTATCTGTATCTTCAATTTAAGG - Intergenic
1059249800 9:112878336-112878358 TTTGATATATTTTCACCTTCAGG + Intronic
1060380817 9:123169549-123169571 TTCTATGTATTTTGGCTTAATGG - Intronic
1060386892 9:123239043-123239065 TTTTATGTATTTTTATTTTTAGG - Intronic
1060769820 9:126324673-126324695 TTTTTTTTATTTTTACTTTTTGG + Intergenic
1203531057 Un_GL000213v1:142441-142463 TTTTATTTATTTTAACTTCTGGG - Intergenic
1203634609 Un_KI270750v1:98662-98684 TTTTATATATATACACTTTGGGG + Intergenic
1185895807 X:3857909-3857931 ATTTTTGTATTTTCATTTTTGGG - Intergenic
1185900926 X:3896333-3896355 ATTTTTGTATTTTCATTTTTGGG - Intergenic
1185906041 X:3934772-3934794 ATTTTTGTATTTTCATTTTTGGG - Intergenic
1186241795 X:7576105-7576127 TTTTCAGCATTTTCACTTGAGGG + Intergenic
1186306350 X:8263564-8263586 TTTGAAATATATTCACTTTATGG + Intergenic
1186946662 X:14576092-14576114 TTATATGAATTTTCTCTTTTTGG + Intronic
1186982917 X:14977076-14977098 TTTTATCTGTGTGCACTTTATGG - Intergenic
1187123311 X:16430147-16430169 TTTTATGTATCCTCACTTGCTGG + Intergenic
1187204806 X:17171688-17171710 TTTTATGTATTTTTTTTTTGTGG + Intergenic
1187568828 X:20480020-20480042 TTCTATGTATTGTCATTATAAGG + Intergenic
1187587483 X:20679611-20679633 TTTTATGTATTTTAAGTTTTGGG - Intergenic
1187895498 X:23976288-23976310 TTTTATGTACTTTTTCCTTATGG - Intergenic
1187956829 X:24527284-24527306 TTTTTTTTTTTTTCGCTTTACGG - Intronic
1188024769 X:25196564-25196586 TTTTATCTCTTTTCACTTAAGGG + Intergenic
1188060875 X:25600203-25600225 TTTTGAGTATTTACATTTTAAGG + Intergenic
1188178666 X:27026032-27026054 TTGTATGTATTTTATCTTTGTGG - Intergenic
1188382476 X:29512950-29512972 TTCTCAGTATTTTCACTTTTAGG - Intronic
1188784879 X:34333584-34333606 TTTTAAATATTTTAACTTTGTGG - Intergenic
1188832246 X:34913184-34913206 TTTTATTTATTTACTTTTTAAGG - Intergenic
1188938656 X:36209710-36209732 ATTTATGTATTTTGATTTTAAGG + Intergenic
1188946478 X:36310632-36310654 TTCTATGTATTTTTACTTTGAGG - Intronic
1189190998 X:39105802-39105824 TTTTCTTTATTTTCACATTAAGG + Intergenic
1189266179 X:39718335-39718357 TTTTATTTATCTTCACATAAAGG - Intergenic
1189365744 X:40387188-40387210 TATCATGTATTTTCTCTGTAAGG + Intergenic
1189589917 X:42499880-42499902 TTTCAAATATTTTCAATTTATGG - Intergenic
1189619209 X:42817865-42817887 TTCTGTGTATTTACACTATATGG + Intergenic
1189681591 X:43522053-43522075 TTTAGTGTATTTTCAATTTGAGG - Intergenic
1189828568 X:44946673-44946695 ATTTATATAGTTTCACATTAGGG + Intronic
1190013864 X:46809383-46809405 TTTTATATATGTTTACTTTGAGG + Intergenic
1190424533 X:50321023-50321045 ATTTATGTATATTCACTACAGGG - Intronic
1190578428 X:51866266-51866288 TTTTATGAATGATCACTTTGTGG + Intronic
1190849098 X:54221114-54221136 TTTTATTTTTTTTCCATTTATGG - Intronic
1190983408 X:55478677-55478699 TTTAAAGTATTTTCAATTGACGG - Intergenic
1190985291 X:55494506-55494528 TTTAAAGTATTTTCAATTGACGG + Intergenic
1191667793 X:63721179-63721201 ATTTATGTATTATCTCTTTTTGG - Intronic
1191789773 X:64957529-64957551 ATTTATTTATTTTTACTTTTTGG + Intronic
1192013577 X:67302603-67302625 TTTTTATTTTTTTCACTTTAAGG - Intergenic
1193109111 X:77709573-77709595 ATTTATTTATTTTAACTTTTAGG - Intronic
1193282234 X:79666843-79666865 TTTTATTTTTTTTCTCTTTATGG - Intergenic
1193336855 X:80299915-80299937 TTTTATTTATTTTCTGTTTATGG + Intergenic
1193648200 X:84094299-84094321 TTTTTTTTTTTTTCCCTTTAAGG - Intronic
1193841049 X:86408965-86408987 TTTAATGTACTTTCACTTTCTGG - Intronic
1194083422 X:89497385-89497407 TTTTCTCTATCTCCACTTTAAGG + Intergenic
1194339260 X:92689261-92689283 TTTTATGTATTGTCATATTTGGG + Intergenic
1194395064 X:93373141-93373163 TTTTATTTATTTTCAAATTTTGG + Intergenic
1194460725 X:94164425-94164447 TTTTCTCTATTTTCTCTTTTAGG + Intergenic
1194653937 X:96548589-96548611 GTTTGTGTGTTTTCCCTTTAGGG + Intergenic
1194742029 X:97585182-97585204 AGTTTTGTGTTTTCACTTTATGG - Intronic
1194839934 X:98727518-98727540 TATTATGTATTTTCACTTTAAGG + Intergenic
1195056711 X:101152841-101152863 TTTTTGTTATTTTCACTTTTTGG + Intronic
1195101977 X:101563724-101563746 TCTTACATATTTTCCCTTTATGG + Intergenic
1195632953 X:107078719-107078741 TTTTATGTTTTTTGACATTGGGG - Intronic
1195841995 X:109184170-109184192 TATTACTTAATTTCACTTTAAGG + Intergenic
1196181972 X:112702765-112702787 TTTTATCTATTTTTGCTGTAAGG + Intergenic
1196241609 X:113348449-113348471 TTTTTTATATTTTCAAATTATGG + Intergenic
1196418383 X:115497735-115497757 TTTTATGTTTATTAACTATAAGG + Intergenic
1196801114 X:119544192-119544214 TTTTATTTCTTTTTTCTTTATGG - Intronic
1197105846 X:122714527-122714549 TTTTTTGTTTTTTCAAATTATGG - Intergenic
1197131964 X:123015619-123015641 TTTTATGCATTTTCATTATTCGG - Intergenic
1197291237 X:124660961-124660983 TTTTGTGGATTTTCACTTTTGGG - Intronic
1197403139 X:126018135-126018157 TTTTATCTACTTCCTCTTTAAGG + Intergenic
1197485455 X:127044732-127044754 TTTTAGTTATTTCCACTTTATGG + Intergenic
1198390884 X:136172609-136172631 TTACATTTATTTTCATTTTAGGG - Intronic
1198429816 X:136554127-136554149 TATTTTGTATTTTCCCTTTGGGG - Intronic
1198635386 X:138693084-138693106 TTGTACCTATTTTCTCTTTATGG - Intronic
1198646691 X:138815427-138815449 TTTTACGTATTTACAATGTACGG - Intronic
1198647515 X:138825425-138825447 TTTTATGTAGCTGCACATTATGG - Intronic
1199206625 X:145156630-145156652 TTGTTTGTTTTTTCAGTTTAAGG - Intergenic
1199910033 X:152276454-152276476 TTTTAACTTTTTTCAGTTTAGGG - Intronic
1200383470 X:155865143-155865165 TTTTATATCTTATCAGTTTAAGG - Intergenic
1200436074 Y:3153264-3153286 TTTTCTCTATCTCCACTTTAAGG + Intergenic
1200647647 Y:5806042-5806064 TTTTATGTATTGTCATATTTGGG + Intergenic
1201623393 Y:15985759-15985781 TTTTATTTATTTTTATTTTTTGG + Intergenic
1202093969 Y:21225089-21225111 TTTTATATAATTTCAATTGATGG - Intergenic
1202094452 Y:21232305-21232327 TTTTTTCTATTTTCTTTTTATGG + Intergenic
1202601335 Y:26596301-26596323 TTTTCTGTATTTTCTATTTTGGG - Intergenic